Entry information : AbAPx-CcP02_bisporus
Entry ID 7608
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: AbAPx-CcP02_bisporus
Name AbAPx-CcP02_bisporus
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbAPx-CcP02_bisporus
start..stop
S start..stop
AthiAPx-CcP01 568 0 10..559 7..559
AbAPx-CcP01_bisporus 557 0 27..561 23..561
HsubAPx-CcP02 556 0 24..560 17..557
LameAPx-CcP01 556 0 21..568 16..560
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 716252..716566 315 N° 2 716122..716188 67 N° 3 715733..716060 328 N° 4 715548..715676 129
N° 5 715335..715509 175 N° 6 714882..715277 396 N° 7 714423..714824 402  
complement(join(714423..714824,714882..715277,715335..715509,715548..715676,7157 33..716060,716122..716188,716252..716566))


exon

Literature and cross-references AbAPx-CcP02_bisporus
DNA ref. JGI genome:   scaffold_2 (716566..714423)
mRNA ref. JGI transcript:   199045
Protein sequence: AbAPx-CcP02_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   604 (579)
PWM (Da):   %s   66149.65 (63536.2)  
PI (pH):   %s   4.73 (4.68) Peptide Signal:   %s   cut: 26 range:26-604
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLLARTSRLLADLLAAGIWCTSVSAGYSWPSPQYEALETFLYEGRRYDGSNLASLQHPCKNRSDTGASIGAEWLRLAYHDVSTRDAEAGTGGLDGSIAYELDREENAGQAMSASLADFESFSNKYVSRSDVIAAGTIFAVASCGGPIIPFRGGRFDAVTAASSSFSVPEPFQDFQTHLDMFRRQGFSQTEMITLVACGHTIGGVRNTDFPHIVSPKGDSEKPTLENFDPSPQYDNLVVQQYLDGSTNNPLVVHPNKTITSDFRIFSSDNNATMKRRAAFNLSSPDAYLNSCRTVLEKMLNMVPSNVALTDEIRLLQEKVFNVQLTLEHGELVFKASLRLAQSVGSTPSKGRVVRMFWCNRYGDDKDCSTNANVVFQAASTQDSPEISPITERLGYYFINHQFVVKVDPSKSISLFWFESDEHDGSTPKIIDNGGSGYQFDQDRILYVPMSSQLDITGGDEASKVYQIVAAVRSDVSPSRVYMSGFDNAIPKHGPAITIAEDLTLNTTLTPVEGYNFYSTSIQSAGLQLTVDLHADIDGNTYTVDFQQTYFLGSSLPYTPPTISNITAVARIPGEPTDTNSVRSLHPSFLIFSYLILVTYIGLF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 6 introns). No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTATTGGCGCGCACCAGTCGGCTCCTCGCCGACTTGCTGGCAGCAGGGATCTGGTGCACCTCGGTTTCTGCTGGTTACTCATGGCCTTCACCACAATACGAGGCATTGGAAACATTT
TTATACGAAGGGAGGAGATACGACGGTTCGAACTTGGCTTCGCTCCAACACCCATGCAAAAACAGGTCTGATACGGGCGCGTCAATTGGTGCTGAATGGCTGAGGCTGGCATATCATGAT
GTTTCGACGCGAGATGCTGAAGCTGGGACGGGCGGGTTGGATGGATCAATTGCATACGAGTTGGATAGAGAAGAA
GTGAGTCAAATGGTCCAAGTAGCGTTGAGAATCATGGACTCTGAG
CTTCATGTCCGGGTCTAGAATGCGGGACAGGCGATGAGCGCTAGTTTGGCCGACTTTGAATCGTTCTCTAATAAATACGTATCTCGTGGGTCTTCGAATGTTTACCTGTTCCCCTATCGC
AGACTAACCTCATATATCCTTTTCAGGATCGGATGTCATCGCCGCCGGTACAATATTCGCCGTTGCATCCTGCGGGGGTCCCATTATACCTTTTCGTGGCGGCCGTTTCGATGCAGTCAC
CGCAGCTTCAAGTTCTTTTAGTGTTCCAGAACCGTTCCAGGATTTTCAGACTCATCTAGACATGTTCCGCCGGCAGGGATTTTCACAGACGGAGATGATCACTTTAGTTGCTTGTGGACA
TACTATCGGTGGAGTGAGAAACACGGATTTCCCTCATATTGTTTCCCCGAAAGGCGATTCAGAGAAACCTACCCTTGAAAACTTTGATCCTTCCCCGCAGTATGATAATCTAGT
GTAAGT
CCCGACTACGTGACGCATTGCTGGACGTATGTTGATGAGGATATGATCAGGGTGCAGCAGTATCTGGATGGCAGTACAAATAATCCGCTTGTTGTTCATCCGAACAAGACGATTACTTCG
GACTTTCGAATATTCTCAAGCGATAACAATGCGACTATGAAGAGGCGAGCTGCTTTCAA
GTCTCAACTTTCGAGTAGCTGGCTGACATCTACTTCAGTTTGTCATCCCCTGATGCATATT
TGAATTCATGTCGAACGGTTCTCGAGAAAATGCTCAACATGGTTCCTTCAAATGTCGCGCTGACAGATGAAATACGGCTCTTGCAAGAGAAAGTTTTCAATGTTCAGTTGACACTTGAAC
ATGGGGAATTAGTTTTCAAGGCATCGCTTCGG
GTACGGGTTCCTGTAATCTTGAGCCTAGACTTGTTTTTACTCAACATATTTGTATAGCTCGCTCAGTCTGTGGGCTCCACTCCCAGTA
AAGGCAGAGTTGTTCGAATGTTCTGGTGCAACCGCTACGGAGACGACAAGGATTGTTCTACCAACGCCAATGTTGTTTTTCAGGCAGCATCTACTCAGGACTCACCAGAAATTTCACCAA
TCACAGAACGACTAGGCTACTATTTCATCAACCATCAATTTGTTGTCAAAGTCGATCCGTCAAAGTCGATTTCTCTTTTCTGGTTTGAGAGTGACGAACATGATGGTTCAACGCCAAAAA
TTATCGATAATGGAGGGTCGGGGTATCAATTTGACCAAGACCGTATACTGTACGTCCCGATGTCTAGTCAGTTGGATATCACAGGTGGAGATGAAGCTTCCAAAGTCTATCAAATTGTCG
CCGCA
GTGAGTTGATTTGCAAAAACCGTGACATTTTCGTTCATGACCCTTTATTTCATTTAGGTTCGCAGCGACGTCTCGCCTTCTCGAGTATATATGTCTGGTTTTGACAATGCCATAC
CCAAGCATGGACCCGCGATTACTATTGCCGAGGACCTCACACTAAATACAACCCTCACTCCCGTAGAAGGCTATAATTTCTACTCTACCTCGATTCAATCTGCTGGACTTCAGTTGACGG
TCGATTTGCATGCTGATATTGATGGTAATACTTATACGGTTGATTTTCAACAGACGTATTTTTTGGGTTCAAGTCTTCCTTATACACCGCCGACTATTTCTAATATCACCGCTGTTGCTC
GGATTCCTGGAGAACCTACTGATACTAACTCTGTACGATCTTTGCATCCTTCGTTTCTAATATTTAGTTATCTAATACTCGTAACCTACATTGGACTTTTTGTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTATTGGCGCGCACCAGTCGGCTCCTCGCCGACTTGCTGGCAGCAGGGATCTGGTGCACCTCGGTTTCTGCTGGTTACTCATGGCCTTCACCACAATACGAGGCATTGGAAACATTT
TTATACGAAGGGAGGAGATACGACGGTTCGAACTTGGCTTCGCTCCAACACCCATGCAAAAACAGGTCTGATACGGGCGCGTCAATTGGTGCTGAATGGCTGAGGCTGGCATATCATGAT
GTTTCGACGCGAGATGCTGAAGCTGGGACGGGCGGGTTGGATGGATCAATTGCATACGAGTTGGATAGAGAAGAA
AATGCGGGACAGGCGATGAGCGCTAGTTTGGCCGACTTTGAATCG
TTCTCTAATAAATACGTATCTC
GATCGGATGTCATCGCCGCCGGTACAATATTCGCCGTTGCATCCTGCGGGGGTCCCATTATACCTTTTCGTGGCGGCCGTTTCGATGCAGTCACCGCA
GCTTCAAGTTCTTTTAGTGTTCCAGAACCGTTCCAGGATTTTCAGACTCATCTAGACATGTTCCGCCGGCAGGGATTTTCACAGACGGAGATGATCACTTTAGTTGCTTGTGGACATACT
ATCGGTGGAGTGAGAAACACGGATTTCCCTCATATTGTTTCCCCGAAAGGCGATTCAGAGAAACCTACCCTTGAAAACTTTGATCCTTCCCCGCAGTATGATAATCTAGT
GGTGCAGCAG
TATCTGGATGGCAGTACAAATAATCCGCTTGTTGTTCATCCGAACAAGACGATTACTTCGGACTTTCGAATATTCTCAAGCGATAACAATGCGACTATGAAGAGGCGAGCTGCTTTCAA
T
TTGTCATCCCCTGATGCATATTTGAATTCATGTCGAACGGTTCTCGAGAAAATGCTCAACATGGTTCCTTCAAATGTCGCGCTGACAGATGAAATACGGCTCTTGCAAGAGAAAGTTTTC
AATGTTCAGTTGACACTTGAACATGGGGAATTAGTTTTCAAGGCATCGCTTCGG
CTCGCTCAGTCTGTGGGCTCCACTCCCAGTAAAGGCAGAGTTGTTCGAATGTTCTGGTGCAACCGC
TACGGAGACGACAAGGATTGTTCTACCAACGCCAATGTTGTTTTTCAGGCAGCATCTACTCAGGACTCACCAGAAATTTCACCAATCACAGAACGACTAGGCTACTATTTCATCAACCAT
CAATTTGTTGTCAAAGTCGATCCGTCAAAGTCGATTTCTCTTTTCTGGTTTGAGAGTGACGAACATGATGGTTCAACGCCAAAAATTATCGATAATGGAGGGTCGGGGTATCAATTTGAC
CAAGACCGTATACTGTACGTCCCGATGTCTAGTCAGTTGGATATCACAGGTGGAGATGAAGCTTCCAAAGTCTATCAAATTGTCGCCGCA
GTTCGCAGCGACGTCTCGCCTTCTCGAGTA
TATATGTCTGGTTTTGACAATGCCATACCCAAGCATGGACCCGCGATTACTATTGCCGAGGACCTCACACTAAATACAACCCTCACTCCCGTAGAAGGCTATAATTTCTACTCTACCTCG
ATTCAATCTGCTGGACTTCAGTTGACGGTCGATTTGCATGCTGATATTGATGGTAATACTTATACGGTTGATTTTCAACAGACGTATTTTTTGGGTTCAAGTCTTCCTTATACACCGCCG
ACTATTTCTAATATCACCGCTGTTGCTCGGATTCCTGGAGAACCTACTGATACTAACTCTGTACGATCTTTGCATCCTTCGTTTCTAATATTTAGTTATCTAATACTCGTAACCTACATT
GGACTTTTTGTA

Retrieve as FASTA