Entry information : AImePxd01
Entry ID 7610
Creation 2010-09-21 (Marcel Zamocky)
Last sequence changes 2011-02-01 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-09 (Christophe Dunand)
Peroxidase information: AImePxd01
Name AImePxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Ursidae Ailuropoda
Organism Ailuropoda melanoleuca (Giant panda)    [TaxId: 9646 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AImePxd01
start..stop
S start..stop
FcaPxd01 2747 0 39..1466 21..1448
EcabPxd01 2720 0 43..1466 8..1431
BtPxd 2674 0 41..1466 51..1475
HsPxd01 2643 0 55..1466 68..1479
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 154121..154225 105 N° 2 151791..151846 56 N° 3 134213..134284 72 N° 4 133203..133274 72
N° 5 129657..129728 72 N° 6 126721..126792 72 N° 7 126276..126347 72 N° 8 125157..125326 170
N° 9 123586..123703 118 N° 10 121937..122106 170 N° 11 119510..119782 273 N° 12 118313..118429 117
N° 13 117175..117333 159 N° 14 116712..116824 113 N° 15 115674..115830 157 N° 16 110820..110928 109
N° 17 110146..110303 158 N° 18 105478..106981 1504 N° 19 102960..103094 135 N° 20 102116..102324 209
N° 21 98716..98836 121 N° 22 98479..98611 133 N° 23 95550..95663 114 N° 24 94775..94894 120
complement(join(94775..94894,95550..95663,98479..98611,98716..98836,102116..1023 24,102960..103094,105478..106981,110146..110303,110820..110928,115674..115830,11 6712..116824,117175..117333,118313..118429,119510..119782,121937..122106,123586. .123703,125157..125326,126276..126347,126721..126792,129657..129728,133203..1332 74,134213..134284,151791..151846,154121..154225))


exon

Literature and cross-references AImePxd01
Literature Li R., et al.,. (2010) The sequence and de novo assembly of the giant panda genome. Nature 463:311-317.
Protein ref. UniProtKB:   D2HIH9 [Fragment]
DNA ref. GenBank:   NW_003217834.1 (169293..109843)
mRNA ref. GenBank:   XM_002922030
Cluster/Prediction ref. Genebank:   100482606
Protein sequence: AImePxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1467
PWM (Da):   %s   163075.93  
PI (pH):   %s   6.92
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVFLVKPLVLCPPPRALLSTLTEQLRALAPSVPKLTLGKLEQVRSLSAIYLEKDLRFNRIREIQPGAFRKLRNLNTLLLNNNQIKSIPGGAFEDLENLKYLYLYKNEIQAIDRQAFKGLASLEQLYLHFNQIETLDPESFQHLPKLERLFLHNNRITHLVPGTFDHLESMKRLRLDSNALHCDCEILWLADLLKTYAQSGNAQAAATCEYPRHIQGRSVATISPEELDERPRITSEPQDADVTLGNTVFFTCRAEGNPKPEIIWLRNNNELSMKTDSRLNLLDDGTLMIQNTQETDQGIYQCMAKNVAGQVKTQEVTLRYFGSARPAFVIQPQNTEVLVGESVTLECSATGHPPPRITWTRGDRTPLPEDPRVSITPSGGLYIQNVLQGDSGEYTCFASNSVESIHATALIIVQALPQFTVTPADRAVIEGQTVDFQCEAKGYPQPVIAWTKGGSQLSVDRRHLVLSSGTLRISAVALHDQGQYECQAVNIIGSQRAVAHLTVQPRVTPVFASIPSDMTVEVGTNVQLPCSSQGEPEPVITWNDGVQVTESGKFHISPEGFLTIHDVGTADAGRYECVARNTIGQASVSMVLSVSVPDVSRNGDPFVATSIVEAIATVDRAINSTRTHLFDSRPRSPNDLLALFRYPRDPYTVEQARAGEIFERTLQLIQEHVQHGLMVDLNGSYHYNDLVSPQYLSVIANLSGCTAHRRVNNCSDMCFHQKYRTHDGTCNNLQHPMWGASLTAFERLLKAVYENGFNTPRGIDAGRLYHGHALPMPRLVSTSLIGTETITPDAQFTHMLMQWGQFLDHDLDSTVVALSQARFSDGQHCSSVCSSDPPCFSVAVPPNDPRVRSGARCMFFVRSSPVCGSGMTSLLMNSVYPREQINQLTSYIDASNVYGSTEHEARAIRDLASHRGLLRQGIVQRSGKPLLPFAAGPPTECMRDENESPIPCFLAGDHRANEQLGLTSMHTLWFREHNRVATELLALNPHWDGDTIYHEARKLVGAQMQHITYQHWLPKVLGEVGMKALGEYRGYDPGVNAGIVNAFATAAFRFGHTLINPVLYRLDENFEPIAQGHVPLHKAFFSPFRIVNEGGIDPLLRGLFGVAGKMRVPSQLLNTELTERLFSMAHTVALDLAAINIQRGRDHGIPPYHEYRVYCNLSSAHTFEDLKNEIKNPEIREKLRRLYGSPLNIDLFPALMVEDLVPGSRLGPTLMCLLSTQFKRLRDGDRLWYENPGVFSPAQLTQIKQTSLARILCDNADNITRVQRDVFRVVEFPHGYGSCDEVPRVDLRVWQDCCDCRTRGQFNMFSHHFRGRRSLGFSYQEDEHAGEVGSGGTPSIGKHRKHPGNATAPSRERPQVPGTSDFKDFVLEMQKTITDLREIKRLESRLSTGDCTDADGEPHANGAKWKRDACSVCECRDGQVTCFVEACQPANCPAPVRARGACCPVCPKDGTGKKP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (unplaced genomic scaffold). No EST found yet.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTGTTCCTCGTCAAGCCCCTCGTCCTCTGCCCTCCGCCACGGGCACTGCTGTCCACGCTCACCGAGCAGCTCCGAGCTCTCGCCCCTTCTGTCCCCAAGGTCTGCTAGATGCCG
GGCTGCTGCTGGCCTCGGGGCTCCGTGCACCGTGACTACAGGTCTTCCCCCCGGACCCCTGTGTTGCTTCGCTCTGGCTCTGGGCTGCAGCACGTGCCACCGCGGCTACATGGGGCTATC
AACCTGCCCCCCCTTCTTCTGACAAAATAATTTTGTTATTTGGGGTTAACGGCAGTTTATCCCCCATTGAGAGTTGCCTGGTGTGATCGTCTTCGGTGGGCGGAGAACAGGCCAGTGGTA
GTGAGTCCGACATCAGAGCCACATCTCCCGGGAGCCGGCTGTGAACTGCAGACTTCTCCCAATGGCGGCAGATTTGGGCTTGCGTCCCTCCCGCGCGCGTACAGAGGTCAGGCGCCACGG
AGTGGGGGGCAGAAGGAGAAAACCCAAGAGGCATAGGACCTCAGGTTGGGTCGTGAGCTTCTGTTGTGTTTCCGAGGTCCCTACTCTGGATCGAACCCGTGCTGCTCCTGCAGCCTGCGT
GCCACGTCGCATGTTGCCCGGGAATGTGCACGTGGTGCCACGTCGCACTTCGCCCGTCGCCCGGGAATGTGCACGTGGTGCCACGTCGCATGTCGCCCGGGATTGTGCACGTGGTGCCAC
GTCGCACGTCGCCCGGGATTGTGCACGTGCCCCTGCCTGCAGGACCCGGCTCTTCCTGTTTACTTCGTGTAATTCTGGAGTTGTGCATGAATTTGTGGTATCTTTGGACACGGGCCGCGC
GGCCTTCGGTCTTCGGCGCCCTCAAGTGGTCGCTGTTCACCCCGCCCGGGCGCAGAGTCCGTTAGAAGCAGGGTGGGCCTCAGAGCCCTTCCCGCTTGCAGGAAGGTGGGCCACGTTCGC
GCCACGAGCCAAAGCAGAGGAAGCTGTGAGACCTGCCCTCTTGCCCACTCACTGCACCGTCCAGCGTACGGTTCTTACGACATTTTGGAAGTATTTTATGCAAGTTGTAGATGTTCAGAA
CAGAAAAATGTGAAAATACACATGAACACAACACAACAAATTGTTTTCTTATCATTAGAGGAAACTTAACAGATGGGTTGGATGTGCACGGAAATATGTGTATGACTGTGTCTTTAGGAC
GTGTATCCACATCCCTGTCTCTGTATTTACTCTCTGTCCGTCTGCATTAGTCCATCCATGTCTTCTGTCCATCATTTATATACCTATGTCATCCCTCTATCTTCATTCATCTTTCAGTCC
ATCCATCCATCTGTCAATCTGTTTTTCCATTTGTCTACCCATCTATCTTTGTACCTTCTATATCATCCATCTATCATCCATCCATCCTTCCATCCATCCATTTATCCATCTGTTATCTGT
CCATCTATTTATGTAACCATTTATCTGTTAATCCATCCTATCCATCAATCTATCCATACAACAGTCTTTCTGTCTGTCTGTCTATCCATCCATCCATTCATCTAGCTGAGCATTGACCCC
TTACCTGCTGCAGAGCTAACACAGTCAGATCGAGGGGAGTCTAACGGAGAGAGTGCAGTGCTTTCACCATTGCCATGGCTGGTGCGAAGCACGGTGCACGGGCACCTCTCTGATGCCTGC
CCCGTGGAAATGCGGTGCATGCACCCATGTTGCCTTGCTCAGTAAGGGCATGTTAGTCATTACGATTTGTCTACTCTCTTGAAGACTTTGAGGTCAGTTTGGACTGACAGTCGCATTGTC
ACCCCGAGAACCTGCCCTGGGCTGCCGCTCGACGCCTGGGCTTCTGCTGCCAGAGTCGGTACTTATGGTTCATCCTCCTTGGCGGTGGTTACGTTTGTGAAGTCACTGCAGACGCTGGAT
CAGTGAACACTTACCCGTTGGTCCAGGAGACGTACAGGGCCAGGTTCCTGGGAGCCCCTTGTCACACTTTCATCAGCCGATCAGTAGATGACCTTATTTTGTATGTGCTTCTGCTTAAAG
ACACTTAATGCAGACTTCTGCTTGATTAACCATGAGTTCGACCTGAGTAAAGCTCATCTCACACCCCCATTTCCTCCTGAGACACGTGAGGGTGTCTCCAACTCAGGAGCGCTAGACACC
AGCACCATGCTTGGGGGCAGTTCTAAGCTGCAAAGTCACCAAAAGAAAGCACAAAATGCAGACAATTTAGCACTCGGTGGCCGGTGAGAAGGACGCTGTGTCCAGCCAGGGCAGGAAGAA
GCAGGCAGAGGGCCACCTTGCTCCGCCACCGCGGGGAGCGTGAGCAGTCGGGCAGCTCAGCCTGTCCACCGCCCCCCGCGGGTCCTTGACCGACCGTAGCTGACCCTGGGCAAGCTGGAG
CAGGTCCGCAGCCTGTCTGCCATCTACCTGGAGAA
GTGAGTGAGCCTGCGCGTGGCCCGGGAGCTGCGGCGGTGGGAGGGCTCTGAGCAGAGGGGGCCTGACCACTGTGTGCTGGCGGAG
GACGAGCCGATGGGGGCCGTGAGGACGGGTCTGCTGAGGGCTCTGGCCAAGAGGTGGGTGTGGCCGGAGGGCCAGAGCTCTGTGAGTATTGATTTTAGGGTCACAAATAGATGTTAGTGA
GTGGGAAAATTGCAAATATGGAATCTCCGAATCATGACGATTGAGTGAGTATGTTCTCCAGTGTTCTGGGTAGAGACGCCGACGCCTGAGGGGCGAGGGAGGGGCCCCCCAGTGTATATA
CCGCGGTCCCACTCACTGCTGGGAGACCTTCTCAGTCTGGACCACGGTTTCTGGGAGGTGCTGGGAACAAGGCGGGTCCCTGCAGAACATGGAAAACCTGACTTGTGAGAGACTTAAAAG
TCATGACATTTAGTTACTATTTAGAAATGTCCTAAGGACCCCACCTTGGGGGGCACTCCAGGTGAGGTGCTGGGCATCAGAATAAACCAGGCTGCCGCCCGTTTTCCTGCACGCCGTGGT
TGGAGGGCAGGGGGACGACTGCATGGAGACCAGGGTGTGCGACGCTGGGGGCTGGCCTTGGGGATGGTGGGTGAGGAAGGGCGGGTCTTTACCGGAGGGCTGAGGGAAAGCAGGCCGAGT
GGGACCCTGTGGCAGGCTCGGGGTGTGCCCCGCCCGGAGCTGAGATTCTAGCGCCATGCTTTCGGGGTGAGCTCATTCACCCCGGGAAGCCTCGGTTTCCCCATCTGTAGGGGCATCCGA
GCAATAAGGAAGGTATGCGTGTGGCTCTGCGAACACAGCTTGGCTCGCTGGATGCGTTTACTGAGTGTGTTAAATTAACTGTGGGGCTGCCGCAGCGGAGCCCGGGGGCGGGAGCGCCCC
ATCTGCTAGGCCCGGGCAGGCGGGATCTGGGGTGCTGGGGATAGCCCCCATTCCTCCTGCTGGGCGCGGGCCGTGGGATGCCAGGCGCCACCGTTCCGTACGTGGTGCGCGTACTTCGAG
GCAGACGTTGCGGTTCAGAAGGAAATACCACTAAGCGTAATTTTCAGTGCATTTCAGAAATGCGGTTTTCTCTAGCAGACCAAACCCAAACCTTCAGAAAGCATGACATTGACCCCATGT
GGACAGCACCTGCAAGGACCCGGGAAGCCCTCGGACCCGCCCAACCTTTGTGAGGTGCCCCTCTGGCACCTAACTAGCAGACGTCTCACGGTACGTACTGGCTGAGGACGAAGGACAAGA
ACAGAATTCAGAGTTACTCTAATAAATGGAAGGTTCACATCAGTCCATGTTGCCTTTGCAAGGATTGGAGCTCTTGGATCATTGTTTTCTCCTTCTGTGGGGAACATAAAGCTTCTCCAG
CTCCTGGGCAGGCAGAGTGCGTCCCTCAGGAGTGCTGCGGAGAGAAGCCTGACTTTGCGGACACTGAGAGAGTGAGTCACCAGAGGACAAGGCTGCAGCTTGTCTGAAGTCCTCGTCCAG
CTCATGCCTCACTTCCCTTCACAGCTTCCGCTGGGGAAGGAGAAGCTGGACTGGAACAGTGTTTCTGGGATTCTGCAACCCGCTGTGCAGCCCTTCAGCTTTCAAAAATAGCAGTCAAAG
TGAATACAGTTAGTCATTGTTATTTACTCAGACATGTGGGATGTTTGTGTTGGCATGGCAACAGGTGGCTAAATATTAATCTTGAGCATTTGTTTTCTTGCGGATTTTTTGTGTAATTTT
CTTACGTCAGTGTCTGTCACCCACCCCATTAATCCAGTCATCCATCCTTCTTCTGTCTTCACATTCATTACCCACCTACCAACCCATCCAGACATCCGCCTTCCTGTCCATCCATCCATC
CATCCATCCATCCATCCACCCATCCATCCATCCGTCTGCCCACCTGTCCGTCCATCCATCCTTCTGTCCATCCATCCGTCCATCTGGCCACCTGTCCGTCCGTCCATCCATCCATCCATC
CATCCATCCATCTGCCCGCCCACTTGTCCATCCATCCATCCATCCATACTCATCCGTCGATCCACCCACACACTCAGCTACCCCTCCATCCATCTGCCATCCTGTTCATCCCTCCCTCCC
TCCTTACTGGCATCCACATAGTGTCAGGCGTTGGTGCTGAGACATGCACACTCTGCTGCTGGGGGGCTCCCTGTATAGGGGGCAGGCTGCACCTGCCGTGCCCTCCATGTGTGATGGCCG
GGGACCTCCGTCCTGACACAGTCCAGTCCCTGTTCCTTCATTCCCTCTCATGGGTCAGAAGTGGGATTGGAAGCCTGTCTAGAGAGACACAGGAAAGGGAATGGTTGTGGAAAGAACGTT
CTGTAGACCCAAGCCTCTTTTCTCCTAAGCTCTGAATGCACCAGCTTTGAAATCCCTCTTCCTTGGGGTGCCTGGGTGGTGAAGTATCTGACTCTTGGTTTTTTGTTTTGTTTTGTTTTG
TTTTTTAAAGATTTTTTATTTATTCATTCGACAGAGAGAGACAGCCAGCGAGAGAGGGAACACAAGCAGGGGGAGTGGGAGAGGAAGAAGCAGGCTCCCAGCGGAGGAGCCTGATGTGGG
GCTCGATCCCATAATGCTGGGATCACGCCCTGAGCCGAAGGCAGACGCTCAACCCACTGTGCCACCCAGGTGCCCCTGACTCTTGGTTTTGGTTCAGGTCGTGACCTCAGGGTTGTGGAA
TTGAGCCCCTCATGGGGGTGTGCACTCAGGGTGGAGTCTGCTTGAGCCTCTCCTCCTCTCTCTCCCTCTCCCCCTCTCTCCCACTCTCTCCCCCTCTCTAATAAATAAATAAATAAATAA
CAATAAATAAAAACAAAAGATTAAAATCCCAGTTCCTCATCATTTTCTTGAGCCATGGAGAAGCCTTCTAATTCCTCAGAGCTTTCCTGGCGGTCCAAGTGTAGCAGGCTTCTCGGCTCC
TGGGGGATGACGTCCTGCAGAGAGTTATGGGAGTGGTTGGTCATCAGCGCCTTCCAGGCTCCTACGCAGCGTCTGGAGGCTGGGGAGGGCCCAGCTCAGTGCACAGTGGGGGCTGCGTTC
GGCTTCACGTGTTCTCACTGGGGAAGGACTCTGAAGATCAGGACAGAGGAAGAAAGCGGCCCCACTGTGGAGCTGCGGGCCGGGCAGGCTGAGCACGCGGAAGAACCTTGATCAGAAGGA
ACAGGTCCCCGTGGCAGACTTCCAAGAGGGGCTTCCCTGGCTAGAGTGTATTTTCCTTTTCTTTGGAAGGTGCCTGTTGGTGTCCCCTTCCCTCAGAAGCCTTTCCTGACAATTTACCCC
AAACCCATCTGTTGTGAGCACCTTTTGTGGTTAATTATCCCGTGTTCCTTTGTCCTGGGGTAGTTTTTGATGGATGAAACTATCTTATTTAGCATTCTAAAATGTTTTCTTCTCCAGTAA
TTAATTGAGTTGCATTTCTTGTCTTCCTAAAACTTCGTTCTGTGTGTAGGAAGCCCTTTGGGTGAGATGTTCTCAGAGCCTCTTGGGTGGACCGTGAGCTGTTTGCTCTCCGTATTTATT
GATTTCATTTTATGATCCATTTCCTCAGTGTAGGTGATTAAAACACAGCCTGATGTGAGACTTAGAAAAGCAGCAAGCAAAAATGAATCTGCTTTGTTAGAGCCTGAAGTCGGCTGCTTC
TGGGGCTTGGTTTGTGCTGACAGACTGACTCTCTGCTTACCAGTCGGTGAAGATTGGGTGAGTGCCCAGTGGGATAACATGATTTATCCATTTATTTTGCTGAACTCAGAGAGCAAGCTC
TGTCTCTCCCTCTCTGCAGGAATGATCTCAATTAACCCGTTCAGCAGTTTAAATTACGATACTTGTTGCAGTAAGTAGACCACCTCAATGTAGCCAGGTGTCTCTGATGGTTAATTGTGT
ATGTCAGCTTGGCTGGGCCACAGCACCCATATATTTGGTGAAACATTACTCTAGACTTTACTAAGTCAGTAGCCTTTGAGCAAAGCAGATTATCCTCCACAGTGTGGGTGGGCCGCATCC
AAGCAGTTGAAGGGCTTAGGAGAAAAGGTTGGGGTGCCCCAAGGAGAAAGGAATTCTGCCAGCAGAAAGCCTTGGGACTCAGACAGCACTTCTTTCCTGGGTCTCCAGCCTGCTGGCCCA
TCCTGCAGATTCTGGACTTGCCAGCCTTCCATACTAAATGTCTCCATTAAATAAATACCGCCTCCTGTATGGGTATGTGCCTGGACACGCGCGCGGACATGCACGCGGACGCGGACACAC
ACACACACATGCCCTGTTGGGTCTGTTTCTCTAGACAAGCCTGACCCATGCAGCATCCTTGTTGTGTGTCCCATGACCCTGGCTGTCCCGGCCACAGCTGGGTGGATCTGGTGGGCACCT
GACCAAGGACAGTCAGTCCATGTGCTGGCCAGTTGCTGATGGTCAGGCCTAGCCTTGACCCAGAACAGACGGCTCTCTGGGGAACTGGAACTAGAAAATATTAAGGGAATAAACAGCTAG
CAGTGGGCGCCGGCACCAGCAGGCTGTGGCTGCAGGGGGTTCAGAGCGCGGTAAAAGCTGTGCTGCAGGCACAGAGCCCTGAGGGCTCAGAGAGGTGGCCGGAGAGTGCCCCCGCGCCCC
GTGTGCCCTCCGGGCCCCAGAGAGGAGCAGGTGTCCACACGCCCCTCTGCTCCTGCGCAGGATCGTGAGTCCTTAAGCGGGTTTTCATTACTTGAGCCCAAAGGAGCAGGAAAACTTGAA
AACTTTGTTTTAAAACATTTTCCCCGAAACAGAAGGAGCCTCCCATTTTTTAGTTATGTGTTATTCTGTAAGCAAGACCATTCATTTAAGAAGACTTTTAAAGCCCATTAAGGACAACCA
GAGAAATACTTGTAATCTTGCTGCCCGCGTGCTTGGGCATAGAAACTTGGCCATTTCCGCCTACACGTCTGTGTGTTTCTGGACTGTCGGGTTGCTCATTTTCCGCAAGGAGATCTTCCG
CTCGCCTGTCCCCAGCCCCACGGCGTTGGTTTCGTTTCTCTGCCCCTGCTTTCCCATATGCTGAGATGAGAGTGCTGACTGAAGATGTCTCGTTGGCGGCACGAGCTGGTCCCCATTCGG
CTCTCTCCTGCTCACCCTCGAGGCAGTCATTTTCTTTCTTTTTTTTTTAAGATTTTATTTATTTATGTGACAGAGAGACAGCCAGGGAGAGAGGGAACACAGCAGGGGAATGGGAGAGGA
AGAAGCAGGCTCCCAGCGGAGGAGCCCAATGTGGGACTTGATCCCGGAACGCCGGGATCACACCCTGAGCCGAAGGCAGACGCTTAACGACTGCGCTACCCAGGCACCCCCGGGCGGTCA
TTTTCTGTGCAACGATCGTTGCCATGACCTGCTGAGCACCTGCCGGTAGCCCCGCTTTTCGGGGAAGGAGACCAGCCGTGGTTGTAGGGCTCAGGAGAGAGCCCCCTCCGGTGGCAGGTC
AGGGGAGAGCCAGGGTCCCAGCGGGCTGCCCGCACTCAGGACACCGTGCACGGTGCTTCTCAGGGGCACGTGCCTCGAGTGTGTGCACCGGGGTGGGAGCATGGTCTCGCCTGGCCGGCC
CGGTGCTCAGAACGCGTGCCGGGGACTCGTCTGAGGGTGCGGTCTGATGAGGGAATCCTGACTGGGTGCGGACCCCTTCTGTGGGGTTCCTGCTGCACGGTGGCCTTGGGGGCCGGAGCA
CTGGGCCCTTCCTGCGCGGCGGCCCCTCGGCACCGTGTTGTTCCCACCTCCTCCGGGTCCCCTTTGCCCTTTCCACTCTGGCGGGCACCGTTCCCAGCGCTGGCAGGCGTCCACCCTGGT
TAGGTGCCATCTGGTGGCCCGCCTGCTCCCTCCCCTCCCCAGCCCCGCCTCTCACTTCCCGCGGGCTGGTCGAAATTACGGACAAAGGGACAGTAACTCAGAGCGAGCAGGCCCCGGTCC
GCCCATGAGCTTAGCGGGGAAGGTTAGTATAGGAGGTTAGTGGGATTTGTTGGTGGGACGTTAGTGGTAGTCGGTCAGCGGGGCGGGTGAGTAGAGAGCGTTGATGTGGTAGGCGAGTTC
ACAGATTATCCCGGAGGAGCAAGTTTGTCAGTGGTTTGGCGGCTTCTGTGGGTGGTAACAGCCGGCTAGTCCGCGTCACGGGCGGTCTTGCAGGTGAGGGCCGCACAGCAGTGTGGGCGC
CGGTTTGCAGGGCACAGACCAACCTTGTACGTCAGTGCAGTCGACCTTGGGTTCCAGGAACCCAGAGCAGCAGTCTCAGAGCTCGTTTCAAGCCAGGGTCCCCTCTGTGCCCCACACCGG
GGCTGGAGGATGTGCTGGGGAGGCCGGCTACTGTGTCACGTCTGGGCTCTGTGTGGCGGCTGTGCTCACGTCCGCGGTGAGGCACCGTCGGTCCTGACGTGTCCACGCCCCGGAGAGCAC
AGTCACCACCATCCCCCTGCCCCTGCCCCTTTGCATCCCCCCCCTTGGCTCTGGCCCCACCCCAGGCTCTGAGAGTCACGGGCTGGTGTCTGTGGCTCAGGGGAGGGGGGCGGCTCGGGA
GATCTGACTTATGTTCAGCTCATCGCGGTCTTTTCTCTCGTCTTTCCTCCTTTTATGGAGCAGTTCTGTGTAATTTTAGGTGTCTATGGTGAGGGTTTCTGTGTGCCCACGACGTCATTC
TCACGCTGAGTTACACAAAACAGTCGTGGTCTTGCACGCTCGGGAGAGTTGCACACTCTGACCCACTCGGAGCGAGCAGAGAGCGTGTCCTGCTTCCTCTGTGTGCCTGCAGTGGAGACA
GTCCTGGGTTTAGACGTGTCTGACCTGTGCAAAAATCAGGGATCAGAGATCCGGCCTCCTCAGTTTGCAGTCACTGGTTTCCTGGATCAAGGAGGGTCTTACTTACCTTATCAGTCACTT
GCATTTGAAGAGTCTCCGGAGTCACCTGGCCATGGCGCTAGGATTGTCTGCCGTCTGCCCTCGGAGACTGAGTGAGAACATTGCCTCCCAGACGGCTCCTTTCCCGACACAAACAAGAGC
AACAGAACAGAAACTGAGCTGATCCAGGTGTTTAAAGGTTTTTACCAAGTTTCGTTTTATTTGAAGGAAAGGACATGAGCTGTCTAAACAGTTGTTCACCACCCCGCTGTTTAATCACAC
ATTCTCCTTGGGTGGCCACTGGTTAGCCAGGCGCCAGCCCTGACCCCCGGTGTGCAGGGGGGCTCCGCAGGCGGGCTCGTAGCAGGGTGCGTATGTCCTGGCGTGACTGCGCTGTCAGTC
ACAGATGCGGCACACGGTAAGGGGTGCGGCACACTGGAATTCTCTCAGGGCAGTTCGACAGGTGCTTATGGACGGGCGTGATGCAGACTGAACGATGGGCTGATTTTGATGTGTCACGTG
GGGGACAGCCTCCTGCCAGTTGCGGGAACGCTGTGAGCAAAGTCGGAGACCTTGGGGAGCGTGGGGTACATTTGGGGACGTGGCTGACTGCAGCGTGTTGCGGGAGCGGGAGCGGCGGGA
CCCCGAGTGCCGAAGACCGGGGGCTCTGGGGTGGGAGGCCTGCTGGCCTGCAGGGTGGGAGAGAGGGGTGTCTTCCACAGGAAGTCCTCTGATTTCCATCCTATCTACGGTGGACTGAGG
CCGGAGCCCGTGAGTGGACAGAAACAGCCCCGCCCTTTAGCCCTGCTGCTGCTGCCCATCTGGCTGCCGTTCTAGTCGGCTGGCTTTTTAGGAAAGAGAACTGTATTACTTGTAACAAAG
TATTTTTGTTTCAGTTTTTCAGTTTTATTTTTCATTTTATCCATATATACTTTAGTATGTATCTCTAAGATAAAAACATCTTCAAAAATAAGCAAATAATGCATCTAAAAATCGTCCGAT
ATCCTGCCAGCGTTTCCCTTTCCCATCCACCCTGTGTGTGCACATCTGTGTACGTCTGTGTGCATGCCTTGCACACATGTGTGCACGCATGTGCGTGTGTGCGGCCTGTAGACAGTCGGT
TCGTTGCGGTTGGGATCCAGAGACCATCTCCGTGCAAGTGGCATTTAGTCAGCTTGTTGCTTGAGCTTTCCAGTCCGCTGTTCCGTGCGCATCTTCCTTATTTCTTGCACAGCTGATGGC
TCGTGTGTCCTGCCGGTTTCCGTGCTCTAGACTGTGGTGATGTGTTCTGTGCACGATGTGAGTCTAACCCTGTCGTCCCACAGCTGCTCGCCGGGGCGTGAGAATCTGTCTTTACTTCTC
CGGCAAGTGGGCTTGTCGGTGGCGCGTCGCGGCCGGTCCCACGTGACTTGTGGCTGCTCTTCTTCTCTTGTAATGTTTGGGCAGATGGGTCTCTGGTTTCCTGCGACGTCAGCCGCACTC
GGTCCCCGAGATTCTCCCTCAGCAAATGCTCTGCCACCTGATTCCGATTCTGGGACTGCTGCATAGACGTGCTGTGAGTGAGGGCTCCCTGCACCCACAGTTCGGCGGTCCGATGCCGAG
CTGCTCGTGCATCGGGGAAACGGGGTGCCTGCGTGGTGGTTCCTCCCAGCGGGGGCTTAGAACCTCAGGGGCGGCGTGCTGAGGCCGTGTGTGTGCATGTGTGTGTAGGCTCCACTGTTC
CTGGTGACGTGGTGACCAGTCGGGAGAAGCTGCTGAGCCCCGTCCGATGCGATTGCCCCAGGCTGAAAGCATTTGCTCTGGTCCACAGGCGCCCGAGCAGAGAACAAAGCGGCCTTGAAC
CGCAGCAGACCGCTGGAATCTGCGCCTGTCAGACTTTCCACGGCCCGTGGGGGATTAGCGGTCGTGGATGGAAGGTGCGGATTCCCGGCACGTACCCGCTTCTGTCCCACACTCGCCCCA
ACTGTGGGGACGCATGGAGCCATGTCCACGTGGCCATGCTTTCTGGACGTGAGACCGGACTGGCTTTAGCATTTGTACTAAGATCACGTCGGTCTTTCCCTCGAAGCAGGCGTCTTAACC
ACATTTAAGTCGGGAAACAGTGAGCACTAGTCTGACCCTTTTCAGATCGCGTCCCGGGAGGGGCCTGCAGGACACAGCCAGGGAGGGAAAGGGTCTCAGGGCCCTGTGGGCCGGTCAGCT
CGCCTCTCTGCCCTTCCGTCACGTGTAACCTAGAGGAGTGCCGTGTGGGGTGGGCTGGAGGTGGCCTGTCTCTTTCAAGGGTGGCCCCTCAGAGCGCGCTGTAGGCCCACCGTTCATTCT
GGCGGGTGACTCAGGCCCCCCTCTGACCTCTCCTACCAGTCGGTTTCCTGCTCTGCTCACCTCATTTCCTGCTGTCCTCACAGGATGGGCAGGGAACATCATTGCTTTCTTCTGCAGAGG
AGACCTGGGATCAGAGAGGTCAAGACACGTGTTCAGGAGTGCACAGCCAGTAAAATGTGGAGGAGGGATTTTAACTCAGGCCTCTGGTGTTTCCTCTGGGCAGCCGTCAGCCTCCCTGCT
GCCAAACTAGAAAATGACACACCTACCCAGGGCAGTGGCCTGGAGAAAACATGCGTGTGCGTGTCCATGTGTGCACACACGTGCACACACTATTTTTGTTTCTCACGGACCAGTCCTGGG
ATGCAGGGTGGAGTCTGCTCGCAGGGAGACCGGCCCTTTGAGGGCCCGTGCTGTGCGCTGTGGGGCCCCCAGGTCAGAAGCCGGCGCGCCCAGGCGTCTGTCCCTGCAGGGTCCCAGTCC
CCTGGCTGGCGCGTCATCCATTTCCCACTGTTTTCACCGCAGCCCGCTTGGCTTCCCCAGGCCAGAGCGGGAGCCAGGCCAGCCAGAGAGCTGGTGGACCCCTCGTCAAGCCCCGTGATG
TCGCAGAAGTCACCCCACCACGCGGCGCCGAGCCGCTCTTCCCGAGAGGAGACACTCACTTATCCGCACCCGCGTCCTGTTTTCAAAACAGGAAGACCGCACATACGAGTTCTCAGGAAA
AGCAGGAGCTCCCGCCTCCATGGCCCGGGATTGTGTTGGCATGATCCTGCTGGGATCGTGCCCCATTTATTTGCTGTTTTCTTGGCTGTTTCTAATTAGAGCGATGTCCGCCCGCTCTGT
CTTCCCTGACACACTTCGTTGGAGAGAATGGATTTCATGCTCGCCCATGCAGGTTTCTGTGCCTCCTTGTTTGCTTAGAAGAGACGAGTGGGGCCTCTTTCCCTCTAATTACACGGCTGT
CCTCGGTTTAACCCCTGCGTGCTGGGCTTTCTGGGAAAGAACAAAACGGCCTTGGGAAAAGCCCGTGGTACACAACTCTGGTTTCGGTTTTTTTTTTTTTCCTTTCTTTTTTGGTCTGGA
AAGTAGGAAAAATACTGATTTCATTTTTTAACCACTGACGGAGGAAGTTTGGGTTTTTTTCCCCAGAGGAAACAAAGGCATGAACCAGTAGATTTATTTTGTTCATTTGGGGCAGAGAGA
AGGCTTCGCACGAATCGGTTGCCTTTGCGTGCGGCCTGGAAAACACACCTCCTGAAACATAAAGCCCGGGCATAAGTCAGTAGGATGTGGCGGGAAGGACACGGGGCGCCCGACGGGCCT
CCCTGCACCCAGGGGCAGACCCGGGCCGAGGGGCGGGAGAAGCCCTTGCCTGCTTTCATCTGGATTGCGAGCTTGAATTTTACAGTTCTGAATGGTCGAGAGTAGTATTTCCTGAAGTCA
CAGTTGGGTTGCAGACCCTGGTGCAGAGCTGGGACTTCTTGGAGCGGAACATGCCCAGCGCCTCCTCGCCGTCCGGGGCAGCGTAGCTGCCGTGACAGAACCCAGAAACTTCCACGGGCA
CCGAGCGGGTGTGAAGCCCACCAGCTTCCTGTTGGCCTCCTGGGGAGCCAGGCTGGCTGTGCCCTCCGGGAGGGCATGACCCCCGGGAGGGGCTGACGGTCTGGGTGGTGCCGCTCACGG
GTCCCCACTCCGCTTGGAGGGGACGTGCCTTCTCTCAGACACACAGGAGCTGCCAGCACTGCTGGTGGGTCCCTGAGGGCCTGCGCGGTGGGTGGTCTTGCAGGGGCCTTCGCCGGGTCT
CCTGGGATGTGGGCTGTCTGGATGGCCAGAGAGGTGACAGGCAGGTCCCCAGTACATGAGGAACGGGGGGCCGCGCACGGCTGTCAGAGGCAAACATTCACACCATCCTCGATGCCGACC
TTGGGGCTGGGGAAGTTGTAACTGGTGCTGCAGACGCTCCTGGGAACGTTTCTGCCTGAGGGCGGTTTGCAAAGCCACCAACTGCAGAATAGCTGTCAACCCCTTTGCTCTCCTGCTGGA
CACGCTTGCCAGTGGCCTGCGCTCAGGTCTGCCTTGCGCGCGCCACCGAAATACCTCCCACTTCCTTCTCTTTTTAAGCCACAGGAAAGCGTGGGGTCTTGGGCCAGGACAGCGACCTGC
CTGCTTCACAGCGTTTTGACCCGGAGATGTCCCCGCACGTGGCGGACGTCTGGAAGCGGCAGCATCGGCCGGCTGTCCTTCAGGACCGGGCTCAGGCCCCCGGCTTGTCCCTCCACAGTA
TCGCTCACCTGGAAGGAAGTCAGGAGTCTTTCCAGCCACACGCCCTCCTTCCAGTCCCGTTCTCATTTGGGTTTGGTAGCGTAGCTGGGGTCGCTCTGCCTTGGGCTGCATGTGATGACC
CCCGTTAGGAGGCAGGGCACCGGCCTTGCGTTCCTCCCTTCTCCCCTGCTGCCCGTCCCTCCGAGTCTCCTGCGTGGTCTAATGAGTCACATTCTGAGTCAGTCTGGACAGACGTGTCTT
CATGCTTTATCTGTAGCTTGCTTGTAAGAATTTAAACCCAGAAGAACAAGGTTTACGAGGTCAGGGTTATTTATCACGCATTACAAATCTAAGCGATAGTGTCGCCTTTTCTGTGAAGGG
AATGATGTCACCAAATCCCGGAGAACTCTAAGTATCATTGCTGCCTTTATACCTTTACCAATAAAGGAAAACCTCTCAATAACTAAAACCAAAATAGAAATTTCTACGTCTTTTTTTCCT
TTGACTGGGTCAGTACCTTGATTGATTTAGGAAAGTCAGTTTTCTTTTAAGGTTTTCTCTCCCATGCTTTGAACTACGCTCACTTGTTTCCGTTTTGAAGTGTATATTGGAGAAAGGCAT
TTTTGCCTTCCTTTCGGTTTTTTAGGATAAACACTCCTGTATATTTTTACCAACCAGACTTGTAAGGCATTGATCAGAAGACTACACAACGATTGGCCTGATTGGGCATCCCGCCTTCTG
GGGGCGTCCCTGGAGGTGGTGGAGCAGTCCCCCGGGCCAGCTGTGCCCGGGCCATCCCCTTCCGCAAGCCCTGGGCTTGGGGAGATTGTGACAAGCCGAAGTCGATGTCCCTGAGTAAGG
GAGCTGAGGTCTCGTCAGACCCCAGTTCCCAGCCTCTCCGTGAGTGGGGGCTCTCGTGGGGGCCGCTGGAGCAGGTAGGGAGGCTGCTCAGCCTGGAGCCTCCCACACCCTGTCTGCACT
TTTGAGCCCGGCACCGAAATTCAGAGGCGGAGCCCGGGATGAGCAGAGCCTGCCTGGTCTGTGTGAATGGCCTTCGTTGGGGATGAGGGGCTGTGGAGTGCACACTGCGGTCCGTGGGGC
ACAGAGCACGCAGGCCTTCGTGGCTGCCTGGCTTTGGCGCCTGTCAGATTACCCACTTCTCCGGGTTCATGGGAGAGGTGAGTCAGGTCGTGGGAGCATGGGGCCTCCGTGTCTGCCTCT
CCCCGTGGCTCTGGGACTGCCCACCCAGCCGAGGTGGGGCGCTCACTCTTGTTCCGTGCCTCCCGGCGCCTGTGCCCCAAGAGCGGCCCCCGTGTCCCCGGTTCCCGGGGGTGTCACCCC
ACAGAGGGTTCTCAGCGTGCCGTCCGGGACGGACGCCAGCACGCAGGCCTCCTGGTCGCTGGTCAGCAGCCGGGCTGAAGGTGCCTGCCTGGTAATTGGACCCATAAGAACGTTGCTTGC
TGCGTTTCACAAAACCGTCCGTCCACGGTAGGGAGTGGAGGAGAGGCCCGTCCAGCGTGCTGGTCCTTACCGAGGGCGGCGGGAGCAGCGCGGGCCTCATCTCTGGCCCTGGCCTCGTGA
GTGGGTGCTCACCTGCTGCGTGGCTGGCCGCGGTGAGGAGGGTCGGAACCCACTTAGCCGGGCCTGTGGGACTCTGACGGCCCCGTCAGTTACCAACAACAGTGTGGCCCCGGGCTGTGT
CCTGGGCTCTCGTGGGCAGACGGGCGTCCGGCCGCACTGGCGTTCCGGAAGGACAGACGTGCACTCGTACCGCCTGTGCTGTCGTGTCCTTGGGCTCTCCGCGTGCAGACGCATCACGTC
CAGGATCCGGGCGGCCGCCGAGGGGCAGCCGGGCTTTTCGGGAGCAGGCTCCCTGGTTGTCCCTCGTGCAGACACACTTACTCGTGCGCATTTCATCACCCTGCGCTGGTTTTCCCATTG
TTGACCTGCAATTTTTTTTTTAATTTTAGTAACTTGGATAAAGAAGGGAGCGCATGTGACAACACGGGCCTCACGGGCTTAGCGAATCCTTGAATGCGAATCCGGGTCAGAAAGACCTCT
GGAGGCAGGAAGGATGAGCCACGATAAACAGGATGAGATCTATCGCTGCTGGCTGCAGAGCCCTGCCGGTGAGGGACCGGGGACAGCCACGCGGAATCCACCACTGAGCCTCCTTTCGGG
GTGTTGTTTACTCACAGTTACATGGCTGATATTTAAGAGGATCTGTGTGTGATTTTGCCTCTGTCTTGTATCAGTAAAAGCCTCATTTCTCCCAGCTGTTTGGCTACGGAATTTTCTGGG
CTAGGGAGTCTCGTGCTAGATGAGATCTTGTCTTGCGTGGTTGCGAGGATGCTTGGAGCCAAGCCTGCCTCCTGCCTCCTGCCTACGCTCCTTAGTCTTGTTCTTTCTCTGCCCTTGTCC
CCCCTTGTCCCCCCTTGTCCCTCAGTCCTTAAGCTCCTTTATCGCTCGTGTTTTGTGTACTTTTGTGCTGCCTCTAATTATTTGTGAAAGAAGGTAAAGGTGGTAACAAGTAAAAATGAA
TTTGTCATGTGTATGAACGTTCGTGGTTTCTAGTCATGACTCCTGTTTTTTCAGATCCATTCAGTAAATGTTGAATTACATTATATGTTTTTTAAGATTTTATTTATTTGAGAATGAGAG
AGAGAATGGGGGAGGGGAAGAGAGGGAGGGAGAGAGAGGGAATCCCAAACAGACTTGGCACGGTGTGGAGCCCGACACGGGGCTCGGTCTCAGGACCCCACGGTCACGAACTGAGCCAAA
ACCAAGGCTTGCACGCTTCACTCACTGTGCCACGCAGGTGCCCTTGAGTCCTATGTAGAAGGTGAGGTGCATGTGTCTAGGTTTTAGGGGAGACATGGAGGAAGAGCCCCTCAGGGAAGC
ACAGGCCAGGAGTCCCCGCACAGTCGCTCCGTTCTGTTCTCAGAGAGGGCAGAGTTCGTGCCCAGGGTGACGCTGAGCTCTGGTTGTCTGTCCTGGTCAGAGACAGACGACCTTACTGCT
TTCATTCGGCAACTTCGCGTGGGTCCCTGAGTCGCTTGAGTCCCTCGGGGATGACATGGGGAACCCTGCTCCATGGAGGACAGGTGTGCTGAGCCTGGAAGTGGCCTTCAGGGTGCGTGG
CGGGCCGGCTGCCCTTCGACTGGACAGGACATTGCCTCGTCCTACAAGGCTGCTGGCTGCACACTCCGTCCCCAGGAGCGGCCCGGGTAGAGGGGCCCAGGCCCCGTGTTCTCAGCACAG
CCTGCGGAAACAGGTGGGCTTGGGGCGGAAGGCTCTCCGCGCTGGTCAGACTGTTGATGGCGGGTGGTGGGTTGTGGGAGCGTGTTTGAACCTTAGAGGTGTGACGGGTGCGCTCTGCCT
GCCTCGTCGGCTGAGGAAGGGCGTGCAGAGCATAGGCTGCAGTCCGGCCTCTGGCTCAGGTCGCTTCTGTCTCCCGTGGTCCGGCCTCCCCCAAGGACCTCCGACCGCCCCGGAGTCCCA
CTGAACTTCAGGCTCCTTGCTGCCGTTGCCCACAGTGCCAGCTGCTTGCCCTCCTGTCCTGTGTGCTGACCCCCACCCTGTCTGCACAGGGGCAGACCTCCGTCTCACTGTACTTTCTAC
TCCAAACCACCCTCCATCTCTGCTCAGGAGAGGTCAGAGCACCCCAGCCAGAGGCAGGACAGGGTCGTGCTGGGATTGCAGGCAGGGCCTGATTCTCTGCGGGGTCCCGTGCTGGCTGTG
ACGTCAGCAAGTCTTTGTTGAGGTGGCCAGCCTATAGCAGGTGTGCAGTACGTGTCCGCTGTTATCACGTGTGACTGTCCTCTCGCAGGCCTGCCGAGCGTCGTGTGGGGTGGGAAGGAC
GAGTGACCGGTGGGAAACACTGACGGGAAACGGCCTGGCAGTGCATCAGAGGCAGGAAGGGAAGGAGACACGGGGTAAGCTGCTGACTCGCCTGTCCGGGTGGCCGATGTGCCAGTGAGC
CTGGTGGAATTCAAGAAGAAAGCGGGACTTGTGGGGGAAGAGAATGTGCCTCTCTGAAGACCGTGCCGTCCAAGGTGCCTGGGGGCTTCCCATGGGCGGCCCGTCGTTCCTGTGCCTGCA
AGGCCAGGCTACAACCCTGCAGAGCCTCTTCTCACCCAGTCGTGTACAGGGTGGAGTGTGAGCTGCTCTTACATTTTTAGGTAAAATGCCGGATTTCGGAAGGCAGCAGCTCTTTTGGGT
TGATAGGGGTCAGTGTCGCCCAGAATGTGCGCAGAGTTTGGTCTGTCCGGTTGTGGGTCCCTCCCCTGCCCTCACTCTGGACAGAGCAGAAAGCAGTGGGTGGGTCACAGGGTCCCTTGG
ACCAGCTGGACCCGCTCCCTAGGGCATGCTTCCCATCTTGGGGCAGAACCCAGCGCTCGTAGTTCTGAGTAGGTAGGGGTATGTGTCGCCGGAGACAATGCGGACAGTCCAGACGCACGC
GGTTTGACTGAGCGTTTTCAACTTTGTGGTGGTGGAAAACTTGGGATTTTGATTTTGATCTTTTCCAGAGCTAGTGGGATCCACAGCTGATACACGGCACCCACGCAGCCCCCATGTGCC
CCAGCACCGTGCTCTGTAATCGCGTGAGCTGTTCAACGCGTTGTGAAGTGGGCTTTGAGTGAGGGGGCTTTGCAGCCACAACGCCCGGAGGTCAGGCGTATCCCGCGCGTTCAACAGGGT
GTTTGCAATTTACGCTGGTGGACAGGACATAACCTCGTTGCCTGTCAAGCAATGTCCTGAATGACACATTTGCGCGTGAGATAAGAACTTTGTTCCAAGGTCCACACGAGACTCCGCCGT
GCCGTCCACGGGTATCTGCGAGGTTACATTCAAGTTTGAGAATCGAGACATTCCTTCTAAGACGTGGGTTATTTTTATACAGGAGGGTGATGTTTTTTTCATTTTTGTGCCTTGAAACTG
TGGAATGTGCTGGGGTGAGAAAGCCAGTCCTCTTGTTCCGTCAGCCTGTCTGCACTGCAGAGCCGCTCTGTTGCAGCCGACGTCTCGGGCGGGGAATGGTGAGCGGCACCCTGTGGGCGG
GCCCGGGGGGCACGGCGCGGGGCTGTGCGTGTGGCAGCCCGCCCTCAGCTGGGCTCTGCGTGTCTTCGGAGATAGACCACCTCGACGTGTCGGCAACTAGAGGTTTTCAGCTCGCCTGCG
TGGACAGTGCGTGCGTCCCACAGGTGGGGGCGGAGTGCTCATAGCAGGGGTCGGGGAGCGTGGCTGGCTTGGTCCTGCCGAAACCCCTCCGAGGTGAGCTGGCCCCTCTAACAGGACTGT
CCCGCTCTGCTCTGCGGTAGGAGCCCGGGCTCTCCACACACACCCCTGCCCCTCCCAGCCTCCCTGTTCCCACAGTGCTGCGCCTCCAGTGGCTGACCGGCTTCAGGACTTCCCTGGCCC
TGCCCCATCCCTCGTTCTGCCGTCGCCCGGGGGACCTTCCCAGGTCCGTGGCTCTGCTGTCAGCTCTGAGCCCCTTTGCCAACACTCACGCCTTTCTACTTGCGCGCTGGACTTCTCCGT
GCTCCAGACCTGCGTGTCTCCCTGTGGGTCTGGTCGGCATCTCGGGCATCTGTGCCTGGAACTTCTTGACCTCCTCTGACCTTTAACCCTCCGATCTCAGTGGATGGCTCAGGTACTCCC
CAGAGTCAGAGTTCCAGCTCAGGAACTGGGGGGGAGTGGGTGCGGGGGCACTTAAGCCCTCCTACAGCGGGACGACCCCGTGTTTGCCTGGGGAAGGCTTGGTGACCTGAGGTTTGGCGG
AAGATGGTCTTGGTTTAGAGTGAGTTTGTATTTCCCGGTAAGTGTTGCCTAAACAAGCTTCTGAAATGTGACAGCCGCTCTGCCATGCAGGTAAGTATATTCATTATTCGGTAGCCTCAG
GGAAGAGCTAGTCGTCCAAGAACGAGCTGGAGGCTCAGTCCCTTCCACGTCTTCCCGTCGTGTGGGAGCTGACGTGACACGGCACCGGTGACTGCTGCTTCTCTGTGTAAATGCATTGCT
TGTGTTTTGTTTCCCTTCCAGGGATCTTCGCTTTAACAGAATCAGAGAGATCCAGCCTGGAGCATTCAGGAAGCTGAGAAACTTGAACACGTTGTAAGTCCGAACATCCTGTTGGGACCC
AGTAGGAGACAAATGTAGAAATCATCACACCTTTCAGCCGTGGGTAGCCCGGATTATCCGTGGTCAGGGGCATGAGTGGGGAGAGTGGACATGGGAACCTAGAACGAAACATGCCCCTCA
AGACGCCAGGCCTGGGGACTCTGTGCTCGGCCGCCATTCTGTCTTGTCCGTGGTGGACCTGTGTGGGTCCCCCATAAGTGGCCACGTGCTCCCCTTCTCTTCCTGTGAGTGGCTGAGTCC
CCAGCTGGGCCAGAGCCCTTCACCGGTACTAGTGAACCGTGCGATGGGGCTGGTTCACACACCGCGTCGCAAGGGGGAGGGGACGGCGCTCCTCCTGGCTCTTGGATCCAGGAGGGGTTG
GGGCGCCCTCCATGTGCACCCAGCTTAGTTCCAAGGACGGACAGATGAAGGGGACAGGGCCTGCCCGGTGCTGAGAGGCTCTGCGGCTGACCTGGGCTGCTGTGGAGTAACCCAAGCATG
GCAGGCGGCTGGTGTCTCCAGAGGGCGGCTGTCGGCACGGGGGGAGAGACAGGGCCCTGGGACCAGGAGTCTGGGGGGCAGTCCGACCCTGGTGAGACCACCCTGCACGTCCACACTGGC
CTTGCACTCACCTGAGGCGGACAGTCTGACAGACAGCAGGGTGGGTAGATACTCCCTTGCTTCGGAGAGGGAATTTGGTCCGTGTGCGTGCAGAGGGGAGTGGTGTGCGGTGACAGGGAC
GCCTGCGCCCTGAGAAGACGCGTCATCAGAGGGTGAGCGCTGAGATGCTTGCGTGACTGTAGCGCCCGGCCCGTGTGGGTGCTGAGCCCCGTACCTGAGTTGTCTCAGGACCTGGTCGCA
GCGGTGGGAACGTGTTCCCACAGTGTGGTCCGGAGGCTGGCGGTAATTCTTACTGGCACTTTCTCTCGCAGACTTCTCAACAATAACCAGATCAAGAGCATACCCGGCGGAGCGTTTGAA
GACCTGGAGAACTTAAAATATCT
GTAAGTGAGCGGTCAGTTCTTTACCCCGAAAGCTTGCGTTGTTTGTATACCAGCTCTTTAATCATTGAGCTGGATTTTGTGCCGCTTTCAAATGAAC
ACAAATGCACCCATCTCCTAGGGTTTGTTTTCAGAAGGTGACTGGATTTTTGGCTGGGAGTTTTAAAATGAGTTCTTATCAGTATGAAGCTTCTGCTGCGTGATGCTGGGGTGCAAGTCC
TCAGCTGTAAGTGAAGTAGGTAGAATGAGATGAAAAGCCACAGGCCTGGAAGGTCGCGTGGGAGCAGGTGACTCCGGCCCCTCGCCGGGGCGCGTGGCTGGCGGGTGTGCCGTGGGAGGG
AAGCTTCGTTTCAGGCGGCCTCTCCAGCTGTGGGCCAAGGGTGAGAATGTCACTCGTCTCTGGAATTTCCCCGTCTTCCTCCAAGGGATTTCACCTCTTCTTATTTTTAGGTAGTAATAT
TGTGGTTTGCTTTTTATTTATTCACTTATGAGCACTGGAAACATCAGGTTTGCAGGTTAGAAGATGACCTCTTGGGCACGTGCTGGCTTAATACCCCTGCAGACAATTACTGTCGGACTG
GCAGCCGTTGAGACAGACATTCCAGTGACATTCCTGGTTGTAGGTAAAAGTACGCGTCATGTGCTCCCAGCACATTGTTCTTGAACACCTTCGATGACCTTTTAAAGAGAACCGTTTTAA
TGAGGGATTTAGCTCAGTGACTCTTTTGGGAAATTTCTGTCATAAGTGAACCTGAACATCTCTAAGTTACATTGATTTTTGAAATAAGGTCACGTTGTTAGTGTTGCTGTGCATTTTGAA
ACCTGTTGGATTTTGGATGTCCTTGGTTGCGAGCCAAGCGATCGCTTTAACTGTTTATAGCAATAAATACTCCTCAGTGAAGATAATCAGAAGTGTTAGGTATACATATTTTCCATCGCT
TTTGGCATAGTTTGTTAATTTTTAGGGTAGAATAGAATAGAGTAAAGTATGAACATTATTAAGCCTTTTTGCTCATTTTAAAAATGAAGGAGAGGCCTTCTATTTATTCTTGAGTTTTTA
TTTATTTGATTTGTTTAGCTTTTATATTTTAAGTGCTATTCAAGTCAGAGGAAAAGTTTTGGTTTCTCAGAAAGCAGGTTCAGTTAGCTTACAGCCAGCATCTCTCTGTGTGTGTGTGAC
TTTAATTTTTTATTCTATATTTTGCTTTTGGTTTGGATTAATTAAGAGCAATTTATTATTTAACCTGCAAACATATTTGGTGTTAAATAGTTTGGGATACCTTGTTTTTCACTTAAAAGA
ATTTTTTAAAGTAATAGTTTGTAAGCCTTGCCTGCTGACGGGCTCCCCATCTTGGCACCAGCACCCCAGCCTCGCCCCCCCATGTCCCTGATGCCCACTGGTGGAAGGACCCGGTCACTG
TGGAGGGGCTGGGCAGTGGTCAGCAGGACAGAGGGGAGGGACCCTGGCGAGCAGGGACCCCAGGAGCAGGGGCGAGAAGGGGTCCTGCTTCCCCATTTGATCCCCGTCCTTGACGGGAGA
GGGCCCGCCCACCAGGACACTGTGCGCAGTTTAAACGTTTGAAACGTGAAATTTACCAACTGCTTCTGCCTTTATATTTAGTCCGTGCTTTTAGAAGTTGAGTACTGGTTATCTGCTGGG
ACCCCAGTCCCTTGTGGGAAGGTGTAAGCCTTTCCCTTAACTGATACTTCCAAAGGATGCGATCACGCCCAGGGAAGGGCCTCCTGTCCGAAGTGGGCTCTGTGACGGGTAGAGTGCTCT
CCAGAGCCTGTCTTCGGAAGATGACCAGCGCCCATTATTCTCAGGAAAGCAGCGGGTGCGCCCCTGTCCTCGTAACACACGTTCTTCCCTGTTCGCGGGGCGGCTCGGTTGTCCTGCGCA
CTCCCGTTGTCTTTAATGTGTGGGCAAGGTGGGGCTGCGCTGCTAGGCTGCTGCCCTGTTGTTTAGAGCGATGAGCCCAGAAACCCTGTTCCGTAACCACAGGAGCGGGAGCTCCCACCA
GAGCCGAGGCTGCCGGGGGCCAGGCCGTACTCTTTCAGCTTCCTAAGTAGTTACTTAATTTCGGCGATTCTGAGCCGCCCTGTCTCCGAGCCTTACATAGGAGGAGCCTGAAACAGAACG
CTCAGTACCGCTTCCAGACCACACAGCCGGCGGGTGGCAGCAGGAGGCCTCAAAGCCACGCGGCCCAGCGGAGCACCCGCCGCGCCAGGCCTGTTGCGGGCACCGGGCTCTGGGCCGGCG
GTGATCACCGCTTGTTCCTGCTGAGGCTTGCCGCTGTCCATTGGTCACCTCGGCTGGTTTGTGCGGAGGGAGAAGTGACAGCCCCTCAGCGGGATGGTGGCAGTTAGATAGTGTAGCGGG
TCCTGGAAAACAAGCCTGCCCCGAGCCCTAGGGACCAGGTGCAGCAGCGCCCTGTCCAGGAACGACGTTAACTCAGAGCAGGCATAGGTGGTGCCTAAGTAGGTGGGAGCCCAGCCGGCA
GGGATGTCACGGTGGGGACGGCATGGAGTTTGAGGTCACCGGCAGGGGAGAGGCGCCCAGGGCACACGTCTGCACCTGATACAGATATCACGTCTAACGCACCGCATGTGCGGGGCTCAC
GAGATCTGCTGTCGCAGAGACGTGTTTGTCGTGAGGACGGTTCCGACCACGGGCCACGTCCCCGGAGCTGTGGTGCTTGGAGGGTCCTTGCCCTTGCAGCCTCACCCAGGAGCTGGCAGA
CACTCTGTGAAGGACCTGGCAGCACATCTCTGAGGGGTCCCGAGCGTTCGGGCTGTGCCGCAGCTGCTTGACCCTGCCGAGTAGCCCTGGATCAGCCTCGGACGCACAAGTCGGGGTGTG
TCCGTGTTACGTGTGCACACTGAAGCTCAGATTGCATGTAACTTTTCTGTGTCCCGAACTATTAGTCTTCTTTTGAAATTTTCAACCAGTTAAAAATTTAAAAACCATTCTTAGCTTACA
GATCGTATAAAAACAGGCAGCGGGCCAAGTCTGTGATTCTCCCAACCTGCCGATTGCTTCTGTTTCATAAGAATGGGATTCTGGTGGGTGAGGACACGTTTAGGCTTCATATCGTCTGCT
CCCCAAATTGTTCCCGGGTATCTTAAAACACCCACGTTCTGGAATCGTACAGCCCACACACGTGTGGGGAGGTGCTTCTGTTTCCTGCAAGCTTTGAAGCAAGCGCGTGGTCAGCACGTC
ACAAGCCACCCTCTACGAACCCGTGACTTTCTGGAAGACCAGGCGGTGGTTGGGTAACGTCCCGTTTGGACACTTCTCCTTTGAGGAGGGGCCAGGACTCTCCGCGAGGGGAGCCGCACC
GCCGTGTAAATGTTTTGTTTGTATTCTGCTACAGTCATTAATTTTAAACTCTCTCCGTGTGTCAACGTAATTCTTCTTTCCGTCTGAAGTGGCGGCCTCTCGTGTGTATGCTAACGCTCC
CCCATTTCTTGTTTCAGCTATCTGTACAAGAATGAGATCCAGGCAATTGACAGGCAAGCATTTAAGGGACTTGCCTCTCTAGAGCAACTGTAAGTGACCCCCTCGCGCACCTGAGTGTCT
TGGATGTCACCCGCCCTTTGCCTGTCGTAGGGAAGATGAACTAAGTCCGCTATTTGCACGATGCATGTCTGTACTAATGGGGACGTAGGGAGTGTGTGCATGCTGATGGAGAGAGCGGTT
CTGTCCGACACCCCTGCACCCAGGAGTGGACGGCACTGTTTCTACTGACGGCAGCCCACGCCGAGCACCCACGATACAAAGAACAGTGAGACCGAGTGGCCCCTGCCTCCACGGTGCTCC
CTGTTTAAAGCAGAGATGACTTGCGAGCAAGGGAAGGTCTTCGGGGCGGGGCATCCGGGGCAGTGCGGGGTGAGCAGTTGTCCTGCTTGTGGCTCCGCACACGTCCAGTAACTTTGTGCA
TTTATGTCATTATTGTGGATAAATGAACTTTCTCCGTGTGTTTCTAGTTAGTGTGTGTGTCGGATGTGGTTTCTCTGACGGCACATGAAGTCAGCGTGCTCATTTTTGAGTAGAATTCCT
GGTAAGAGGAGTTTGCTCTGTTTGTTCAGGCTGATGTGGCTCTGAGGAGTTTCACAGGGCCATCCTGTCCTAGTCACAGGCTGGACAGGCCTTTGGCGGTGACGCAGGCTGATGTCCTTC
CGTGGCAGCTCTTCATGAGTCTGCGTGTTTCCTCGGCGGGCCGGGCACAGCAGCGTCTCCGGAGACGCAATGGCAGAGCTGGGGCAGGGGCTCCCCCCGAAACCAGGTGCTTCAGAAACA
CACACGGTGCTGTGGGTCTAGGGGTCTTATTGCCGTGTGACCTGCTTTGCTGAGCTCGCCGTGCACGGCGTGCAGTAGGGCTGGGAAGCAGGTGTGCATTGGGTGGGTATGATCTCCGTT
TCGGAGAGCAAGAATGAGAAGTTCAGAGTGTTGCAGAAACACATGGATGTGTCTGGAAAACCTACAGGTGGATGGAGGGTTTATGAAGGGAGGAGTTCTGGCATCTGACACGCTTCTCCT
GGGACGGGGGCAGTAAGATAATCACAGCCAACACCTGAAAAACGGTGTCTGATTCAAACATGCTGAAAAAATTAGAACCGGTTGCTGCTCACCCTGACGAGGGGTGAGTCGCTTTATTCT
TGAGGGGGAAAGAGGCCGAGTCTGAGGAGACTGAGGCCCTCTTGCACCAGGAGCATGGAGCAGGGTGTCAGACTGACCGTCCTGGAGACGGCAGGTCCCCGGGTAGGATGCTTTCAAAAC
CCCAGGTTAGGTAGTCAGGATCTATGCCACGGAGACGTGGCTCTCCGTCTGTGAGTGTCGGCGAGTGTCTGATGGGACGGAGAGACACATAGGACCAGTTCCCCGCCTGCAGGGAGGGCG
CTGTGCAAGGAGCTGAGGCTGTTCCTGGTGGGTGTGCATGGTGCCGTGGTCCGGGGGGTGGGGTGGCTCCTGCCGGGGCTCCCTCTCCCCATGCCAGAAGCCCCCCGACACCCTCCAAGG
CTGTGGGGTATCTGTGGAGCCTCAGCTCCAGCCGGCTCCGGGGAGACCCTCCTCGTCCCGTGTGGTGAAGACGTGACCAGAGTCAGAGAGCGTAGATTGGGGCTGGGGTCCGTGGCCGCC
TTGGGTCGTGGGAGGGCGGCGGCACCCAGACTGCCCGGAGCTGTGGGGAGCTCAGTCCTGTCTCTGCTCAGCGAGAACGAGCCACAGTGAATCAGGACAGGCCGGCCCTCCCACCCCCTC
CTCCCCGGATGCCTCCCCCAGGGCCCCACCGGCCTGCTAACANNNNNNTGGCTGCGGATTTTCCCCTGTCCGAGCTCCCGCACACCCTGCTTGCGGGCTTCCCACCTGGAGTGGACCGCG
ATGGGCAGGGACCTGTCTGCGGGACGTGCGGGAGGCGGCTGTGGCTCTGACCTGAGCTCTGTGGGCTCTGTAGCCGCATCTGTGACCGCCCAGACTCGGGGTCACCGCGGCACCCTCCCG
GCGGCCCAGGGAGACATGGACAGGCAAGGAAGGGCAGCTGAACTTGGGTGACCTTGCAGTCACAGTAATTTCAGCATTAGTGAAGTTCTCTAAGGGATCCAGGGTGTGTTTCGAGAATGC
CTTCTGTCTGGTGTTTGGGTTCATGATGAAACCTGTAACCGCTCGCGTCTGTCCCTGTCGCTCTGCCGGGCCCCACATGAGCGAGCCATGGAGGACGGGGACCTCTCTTCTCCTCCTGTG
GGTGGGGGGCTCATTGCAGAAGCACCCCGTCACGAAGCCGCATCCAAGTCCGTGTCCACTGTTTCACTTAAGGGGGAAAACACCGATTTTCACAGCGAGAAACGCAGTGTTCAGGAAAAT
GAGAAGAAATTAGTTGTACCAAAAATGTGTAAATTATGGAAAGCAAGGAGACATAACATAAGAGTACACACTGGATATTCCGTGTAATTGAGCCCATTTGAGGAAACACCTGATCTTTAT
TATTTCTGTAGGTAATCGTACGCTCGGTCTGAAATTCAAGTGTGGTTCGCCCTCCTGCCAAATTCACACAGAGGTTAGAAGATCGAATGAAGGTGTTTGTGTACTTACGTGTGTGCTGTA
GGGAAGGTTACTGGACTGTTTCCTGCAGAGGCCCAGGGCCGCACGCAGGTCACAGGCCACGCAGTCAGGCCTCGGTCAGAGTCACCGACAGCCTGTCAGTCATATAGTCTGTGCAGTTTT
TAATTGTATTTAATCTTACGATTTGATCATTTCACTTGTTTTCCACACAGTGTAGGAAATCTAGGGTTATTGACATACAAATTTGAAAGGACTTAGGAGACATTTTTTTGAGCAGAAAAT
CTAGATTTGCGAAACGTAAAACCGTTTAAAGTTTGTTTCTTTCTTTTCTCTCTCTTTTTTTACACTTGTCTAGGTATCTGCACTTTAATCAGATAGAAACTCTGGACCCAGAGTCATTCC
AACATTTGCCAAAGCTGGAAAGACT
GTAAGTTGCATTTCCTCCCGCTCTCCCGCGTCTGCCTGTGGTCCTGGGCCGTCGCCCCGTCCAGGCTCCGCAGGAGAGAGGAGGCCACTGTCTGT
TCAGGCCTCTGAGAACTCGCCCTGCAAAGTCCCTGCTCCTTGTCTCACAATTCAGAGGCGGGACTGACAATTGTCTCTTTCTTTGGGAATGGGGATAAAATAGAAAAGAAAGAAAACCTA
GTTCTTTTCTGGACTAAACAACATTCTCAGATTCATTTGTATGAAATAATGCACTCACTGAGTTATTTTTTAAAATCTGATTTGACTGTTTATACTCTTTCCTACACACGTAAGAAACAT
TTCAATAAGTTGGTTTGTTGTATTGTCTCTTTCAACAGATTTTTACATAACAACCGAATCACACATTTGGTTCCAGGAACATTCGATCACTTGGAATCCATGAAAAGACTGTGAGTATGT
GTTCCGCGCAGCCCCGTGTCCCCGCGGCCGTTGACCGGCCCCGTGCTGGGCTGTCGAGTGTGGGTCCCTCCCAGGAAAGGGCAGGAGGCTCCGAACCCTCAGAGAGGATGCAGCCGGGAG
CCCTGGTGACTCGGGGCCTGTGCCAGCAGGTTGACCTTTTCATATGCAAGCAGAGCATTTTTAGAGTCAGTTTTAAATTCTTCAGATTAATTTTTAATCCCATTTTGCATATTTTAGTGG
TGGGAGTAAAATCCCCCGAAAAGAACCGTATCCTGTTCCCTGTATGAAGCGTTCCCACAGCTGGACGTTAAGTACACTGGTCTCCAATTTCTCAAGGCCGCTAAAAATACTTTTTCTTAT
TCCGAGTACTTAACCGTTAATAGAATAAAGGTGTGCGAGTGCCGGAGGAGACAGTTACCCGACACCTTGTGCTTTGCCCCGTGGCCGTGGCCGCGGGGCTGCCCTGCGGCTGGTGATCCG
TCCCCTGGTGATCCGTCCCCGAGGGCGTGCAAGGAGCTCGCCGTCAGGAAGAAGTGGAGAATCAGGCTAAGAAGCATAGTTCTGGTGCAGAACACAGTGACATAAGACAGCTCTCCTCGC
TGTCCAGGAGTCCTTCTGGGTAAAGCAGTCAGCAGCCGCACTAAAAATGGCGTTGTGGGGAAGACGGAGGAGCACTTCCATGTTTGAGAGAGAAGAGAGAGCAGCAGAGAAAGTGCCAGA
AAGAACAAGCTGAGGGCAGCCAGGTGGAGCCACCTGAGTGGGGAGCTGGCCGGCGTGGTTCACCTTTCCACCCTCCCTCCATGGATGGATGCCAGCCTCCCGCCTGGACGCTGCTGTCTG
TCCTGTGCGCTGCACCCCCACCAGTGGTTTGCGGGCCAGGCCTGTGTGTGGTGGGCCGGAGCTGCTCGACCCCACGTCTCGCTGTCTTCCTCCTGTCAGGCGACTGGACTCCAACGCACT
TCACTGTGACTGTGAAATCCTGTGGCTGGCGGATCTGCTGAAAACCTACGCCCAGTCGGGGAACGCGCAGGCGGCGGCCACCTGTGAATACCCGCGACACATCCAGGGACGCTCGGTGGC
CACGATCAGCCCCGAAGAGCTGGACTGTG
GTGAGTGAGCCCTGTGGACCCCCAGGGGGACAGAGGCGCCCGAGCCAGGCATTGGCGTCCGGAGGGCATGGCAGGTGCACGGCCCCGCCTG
TCTTCCGCGTCTGTATGTCCCCAGATTGCGTCTCGGTGGGACCCGACAAGGACGCCCATGGCAAAGCCGCAGTCTGTATGAGCACCTGTGAGCAGCTGCTGGGTTCCTCGGCTTTCATGT
TCAGGTTCCCGGAACGCACGGCCTCTCCTGCTGCCCCCACGGCCCTGTGCCGACAGGCCGCAGCTGCTGGGCCCGACTCCCGGGTGCTCGCGGGGCGGGGCTGGCGGGTCCATGCCTCCG
AGAGCCTCTGCTCGCTGGGCTGTGCCCACGGGCACTCACCGAGAAACCGAGCACTAGAAAAGGAGCACAGTCAGACGGCAGGGCACAATCTCACAGAGAACGCCCAAGGGCTCCTTCACT
TCCTCTTTTCCTTGTAGCACTTTTGCCGAAATTAGTTTCTGTAAAGCATCATCATTTTTTAAGTATTAAGGGTCTATGTCCTGGAAGCTAGAAGTCCGTGGCTTTCAGAAGTCTCCCGCC
CGGGACATGGCTCTCCCGTCACATCGGTGTTCGTTAACCATCCTTCTGTTGCCATGTGTGCTTGGCCGAGCACGCGGCTGCCTCGGTGGTGTGCGGCGTCCGGGACCCTGTGCCACGTGT
GCCCATCCGCTGCCGGGCACACCGGCTGTTGGGAGCCACGCTGCACATGAGCAGGGGTGCCGGGCTGTGGGCACCTCGGGGACAGGACAGGCCGGGACTGAGTGCTCGGCCACCCTGGGG
TCTAACCCTGCCCTGCACGGCACATTCCCCTGGGCCAACCCTGGGTGTCCTCGTCTGGCGTCCGCTCCCTCCTCTGGGGCACAAGCCATCCTGGCTCCGCTCACCAGCCGGCTCTGACTC
TGCCCGTCAGACCGGGCTCGGGCACCGTGGGTTCTCCTTCTGCCTCCCGGTTAACAGACTGGAGGAGACAGCTCGTCTGGGCCCAGGGCCGTGGGAGGGGGGCGCCCGGGGGACAAAGGA
CAAGGGCTCTGCGGCCCTGCCCTGCATGGTAGAGATTTCTGCTCTCAGCGTTCCTCTAGCTAAAAAGCAGCATTTTCTGTTTTACTCACTGAAAACAGCTTTCATGGAGTGCGCCGCGCG
CACGGGTCCCTCGCCCTCCTGAAGGGTGAGCAGCGGCTGGGGTCTTGCTGGTGCCTGTTGTTACCCAGGCTCTTAGAGGCAGATCTGAGGGTCGGAAAATGCTGGGTGAGGACTCAGCCT
GTCTGCGGAGAAGCCCGTCTGTCCTGCTTGTGGGAGCATTTGTGGTTGGGATATATGTTTGCTTGCGATTTTCTCTTGAACATGAGGGATTTGGTTTGGGTTCTTGTTTACTTTTACGGG
ACGGTTTAAGACCCAGAGATCTCCAATTCCTTCTTGGCACAGAAAGGCCCCGGATCACCTCAGAGCCCCAGGATGCGGACGTCACCTTGGGGAACACTGTGTTCTTCACGTGCAGAGCAG
AAGGCAACCCCAAGCCCGAGATCATCTGGCTGCGAAATAA
GTAAGTCGGGCACCGGCCAGGCTGCCACCCATGCTCACTGTCCCCCCAGATGCCCTGTGGGCTCCACCATGCACGGCCCC
ACCCCAACACCTGTGGACGCCCTTGGACAGTTCCGTCCTCCGCTGTGGGGGGGAAGGTCTGAAGAAGAGAATTTTCTGCAACTTTTCTGCTGTAAAGGGGGGCACGTGGCTCCCCCCGTG
GGGGGTGAGGAGTGGAAGGGAATCTTGGTTCTTAACCCGCCCACGTTCTGTGGCCGGAAACTGGTGCGTCTGGTCACTAGGGCTCCACAGTTGGAACTCTGGGACCGGTCCTCCTGGCTA
AGGCGGGGTCTTCCTGCTGGGGCAGTGTCTTCAGGGACACACGTCACGTGAATACTTGCATACTTAGCTCCTTGTGCATCTGATTTGCCTCAGGAACAAGGGCTCCCCACCCATCCGCAA
GCATTTTGGGTGTGTGGGGGCAGACGTGTAGGGGGCGCTCCAGGGGTCAGCCCACCACGGACGCCGTGTGAATGAGGACACCTTCCGGCGTATGGGGAGAACCGAGTCCTCAGAGGGAAT
CGTGAATGCGGAATCGTGAACCTTGTCGAGGCTCCTGGGCCCGTGCTCACAGGGACACGGACAGGCGCTCGCTTGTCGGTGGATCTCGGCTCTCAGCCCTGACGTTCTGAGCTCACGGGT
CTTGTTCGGTCATGACTGGGCGAGGAGGACGCCCCCTGAGCCGTTGTCCCAGCCCGCGCTGGGCTGGCGAGTCCAGCAGCGTTCACGGAGAAGAGGAGCGGAACTGGGATCTCGGCATTG
TGAGCCATGAGGTGCAGGAGGGGAAGACGCCTTCCTGCCTGGGTTTGTCGCCATGACCTGGGCCCAGCGCCATGCGGCAATGTCACCGGTGCTGTCCTGGCCTTCAGATAACCTGTTATC
TTGGGTGACTCTGGACTTGTTGAGATTTAAAATCCGGAGTTAACATAAGAGGAATAAGCGTGAATTTAAAAGGCAGAAAGGATCGATTCGGCCGAGCCCTCTACATCTGCTCTCGTAAGC
AAACACGTTGATACCAGAAGTTAAAATGTCATAGCTGAGCACGGTAGAGGGGAAGCCCCAAAGCCCCGGGCTTGAAGTCTGGTGCCGGCCTCTCCCTCCACCTGCCAGCCTCACCTGTGG
GCCTGCCCCATCATCTTGAATGAATTTGCCAGAAACCAAGGAAAATGTTTCCTTTGAATTTTTCCCTCTACATTCCTTTTTCCCCTTTGGAAAGAAGACTGCTTTTTAACTTTAAGATCT
TATAGATGGAACATGTGACTAAAGTAAGTCGATGAATTAGAGACCTGGGTCAGCCCCTTTCCTAGGAGTGCTGATGAAGTCGGGGCCAGCTGCGGCATCCCCTGTGCCCCTAGGTGCCAG
GTGCTCAGGGCTCTTCCTGTGGGGGGCAGGTGTGTCCTCGTGCTTTCACAGCCTAAGCACCAGTCTTCTGTCTTTGTAGCAATGAGCTGAGCATGAAGACAGATTCCCGCCTCAACTTGC
TGGATGACGGGACCTTGATGATCCAAAACACGCAGGAGACGGACCAGGGGATTTACCAGTGCATGGCCAAAAACGTGGCTGGGCAGGTGAAGACACAGGAGGTCACCCTCAGGTACTTTG
GGTCTCCAG
GTACGTGCAGACGACGGCCCTCGCTCCCCGTGCCCAGCTGGGTAGGGATGCGGGTGGGATGCAGGTGGGACGTGGCTGGTGCTCTAGTCTACAGCCAAGTGCCCTCGGCCA
CAGCCTTGCAAGCATGGTCCGCGGTGAGCCCCAACCTTTGCTCTGCTTTTTGAAAGAACTCAGACTGGCATTCGTAAAGGAGTCCGTTTGTGTTTGTTGCCGTGAGCGGTAGGTTCTGAT
TTCCAAGTTCCGCGTCTTACTTGGGATCATTTATCCAGCCTTTTCTGAGTTCCAAGCCTTCGTTGGAATAATTATTGTCCTTCCTCCATTTCCTGCTTCTAGTCTGGAAGTCGTACGGCG
TCCGCTGTGTCAGTGGTTGGCCTACAGCGTCTTACACGTGTTCTTAGGTTGTCAGAGTCAACATTCCTACCTACCGCTGTCTCCAAAACAGGCTGAGTTCTGTTTTTCAGTGTATGAAAC
TCTCTGTTTGCGCCTGGCGGTAGCGTCTTTCCCACTCCTGAGTCCTGTCATGTCTTTCTGCGCCTCTGTTGTTCCAGTGGCCCTGAGTCCTTTCTGCCCAGTGGAGCGGGAGTCAGGATC
CCCACGCGGGGACCAGCTTTCAGCTGACAGAGCCTGGAGTGAGATTCGCTTCCCTGTCCCACTGGTTTTGGCTCTCTGCCACTGAGGGGCAGCTCATGGGGCAGCCAGACACGGAGCCTG
CTGTGTGACATCGTGTTGGGCTGGCCTCGCCGTTGCCTGCCCTCATGAGGCCACTTCTCACGTGACAGCTTGAGCACGTGCCCTCCCGGTGGGCTTCGACCTTGGGGTTCTTGTCCCTAC
AAATGGCAGTGCGCTCTAGCTTGCCGTGTTCCAGAAATGCTAGTATTGGGATCATTTCTGCGTTTCCTGTCCTCTGCTGTTCTTAGATATGTGGGTAATGGAGCTTCAGTGCTAACCAAC
ATGAAAGACGCAGAGCAGTGTCTTCCCTCCTTCTTTCCTCACCCCTTAAGTTCCTACCTCCATCCCCACTCCCTGAGATTACAGCCAGCGCCTCTTTCTTCATCCCCGCCTTATGGTCTT
CCATACGTGACGGCTTCTTTTATGCTTTCCTCTTCAGTGCCGCGTGGGATTCGTTACCTGGTGGAACGTGATCTGTTTAACTGGCTCCTTAGCAGGAATACCTCCGGGTTTTTCCTCCAA
GTCTTTGCTATTATAGGTCCCTTTATCCAAAACCTTTTGGGCTGGCTATCGTTTGGAAATCAGAAATCTGGGAAATTTCAGCAGGGCCATCTGGTGCATGGCCTGCTGAGCCGGCTCGCG
CTGCCGCGGGGTCCCGGGTCCCACCCTGTAATCAGTGTCCCACAGTGAACTGTGAATAGTCAGCACGTGGGATCAGTGAAGACCGTGAACGCCTCATGCCAGATTGATAGGGTTTTACAA
AGAAGTGATGGAGAAGTATTTTATTTTTGGAGCATTTCTGGATTCCAGAACTGGGGAGAAGGGTGTTGGCCTGAATACACATCACAGGAATGTTTTAAAAACATCCCTGTTTGGGTACAT
ACATTGCTTTCCATGTTTGTAAGCTCCTAGCAGAATGGCTTCTGGGCGAAAGGGTGCAGGGACCACGGCGGTCCTGATGTGCGTGGCCGCGCTGGCCTGCAGGGGGGACGACCTAGGCCG
TGGACACCACCAGCAAGTGAGATCTATTCTGCCCAGACTCCCTCACAAGACTCATTACTAAGGGCGTGGATTTTCCCTCTGGATTCAGAGCTGAAAAGTACTATCTTGGTGTAGCTTTAA
TTTGTATTTTTGTTTTTGTGAGGGAAATTGGTTATTTTTATATGTTCTAAATACAGTTTAAAAGCAGTGTTTCACCCAAGGAAGAACCCCTAGCCGGGTCTGACCAGACTGACCTGATGT
ACTTGGAATCGCAGAAGCGGGGGTTCTCCCTGGGGCGCTGTCCACCCCGACCCGGGGCACGCTTACCCTCGCTGCCTGCACGTTCCCTTGCACGGGAAAGGAGGCGAGAGCGCGCTCTGA
TTCAATCGTGTTTGCTTTACTTATTTTAAGGGCTTCAGATGGAAGGAAGATAGAGAAACTCCAGCAAGACGCCGTCGGTAACCTGGATGAAATTAATGCAGAACTTGTGTTTCGTTGTGA
CAGCTCGACCCGCTTTTGTAATCCAGCCACAGAACACGGAGGTGCTGGTCGGGGAGAGTGTCACGCTGGAGTGCAGCGCCACGGGCCACCCCCCGCCGCGGATCACCTGGACCAGAGGGG
ACCGCACGCCCCTGCCCGAGGACCCTCGCGTGAGCATCACCCCGTCTGGCGGCCTCTACATCCAGAACGTCCTGCAGGGCGACAGCGGAGAGTACACGTGCTTCGCGTCCAACAGTGTGG
AGAGCATCCACGCCACGGCCCTGATCATTGTCCAGG
GTGGGTCAGGGCGCCCGTCCTTGCGCACGCCCAGACCCTCGCCCGCAGCCCTCCCGGCAGAGACCCCGCCCTGCCCGCCGTCCC
CACCCTGCGCCGGCGACGTGCTCCCCACACCTCATGGCTGGTGTAGGCCTTGGTGATGCAGGTGTAATGGTCGCTCCAGGAGGCTCCATAGTTTTGGGGCCTTATTTCTGGCTGTGTTAC
CTGTGGCACCAGGGCGCCCGGCGAGTGAACGCTGTCGGCGGACATGGGTGTGCGTGCATGTGTGCGCGCTCCATCAGAGAGTCTGGCCCTTGTCTCACGGTTCCCGAGCATCAGCTTCTG
GACCCAGGATGCTGAGAGTGCTTACAGTGTTAAGACCCCAGCCCTGTGTTTCCACACGTCCCAACTGACTTGATCGTTTCTTAGTTTAGAAATAAATTGCAAAGTGGGGCATTTGTGTGG
AAGCTCTCAGAGAAAGTGCAGACTACGGAGAAGTCAGTGTTTTCCCTCCCCCTCTGCCCTCCCCGACCCCTCCCGCCTGCAGGGGAGCTGCCTCAAGAGTGGTCTGTGGTGGGTCCGTCC
TGCTGTCTCCTCCTTTGCCCGTGTGACCACGCAGGCCTGCAGTCTGGTCGTTCCTTTCATGCGTATGGAGTCGATCTGGGTTTGGGGCTGTGTGACTGTTGGCCTAGCGGCCACGAAGCA
GCCCCCATCCCCACGCCGCTGTGTTATGTGACACTTAACCACTTCCAGGTGCTAACTGGGTCCGACAGCCAGAGGGACCTGGGGTTCACCTCACCGCCGCAGGCGGAAGCAGGGCGCTGC
CGCCCCCTCCCAGCAGTGCAGCCCCCGGCCGTGTGGAGTTACAGAGGCGCCGGCAGGATGCCAGGAATGCCTCCGTTTGACGCTCTTTCTGCTGTCATGGCCTTCCATGCCCGGCGTCCC
TGCTTGCAGGCCCTCCCCCTGTGGCACAGCCGGTGGCGCGGCCCGTCTTCTCAGGGCAACGGCACCTACAGGGCGCACTAACGCGACGCTAGCTTGCAGCATCTTTACCCCAAACTGTCT
TTGAAATTTTGTTTCCAATGTTTTTCCTTCCGGAAGCTCTTCCCCAATTCACCGTGACCCCTGCAGACAGAGCTGTTATCGAGGGTCAGACAGTCGATTTCCAGTGTGAGGCCAAGGGCT
ACCCACAGCCGGTCATCGCGTGGACGAAAGGAG
GTGAGAGCTGGGATGCACTCCACACTGGGCCTCTGCCCAGGCCCCAGCCCACGTGAGCCAGGGGTGGGGACGGTCGTGTCTGCGTGT
TCTGGCTGCAGGCCTCGCCCACGGCTATGGTGCAGGACACCCGGAGAAGTGCAGGCAGCCTTCTGCTGTCTGGCTCCCTCTCCTCCCAGGTGGTCCCTGTGTCTTGCCTTTAATGCACCT
TTAATTAGCATCTTGATGAAATTTCATAGCAGGTAGGATAGAATATTCTGGAAACTGTCACAGCATATGTTTGAAGCTCAGTGTCACTTTATTTTGTGGGTGTCATGCCGTCTCCATCCA
TGGTCAGACGGCTGATCACACTGATTCTTTGGGGGCGACCCCCCCGTCCTGCTCCAGCTGGTGAGCTGGTCAGATGACTTGATGAAGACAGACTTACCCCAGGACACTGGCGGCCTGGCT
GGGGGGGGTCTGGGGGGTTAACCTCAGGGCTCTGTCCTGGAATTGACCTTGAGGACCTGCCGAGGGGCCCTGCCTTGAGCCAGAGGGCAGCTCCCTGCCTCTGTCCCCTGAGGAGCGAAC
GCCCTGGGTGTGCGGGTGCGTGACCACCTAGCACCTGGACCTCCGCGTCCCCCCGGGCTAGCGCCTCACTGGGGTGTCCTGTGCTTTTGGGCCGCTCCAGCCCCTGACCCCTCCCCAGTG
GACCCTGTGTCCTGGCTCCTGCCTCTCTCTCTCTCTCTCTCCTGCTCCCCGCACTTCTGGGGAGTTTCTCAGAGGCGGGGCGGCTCTGTCTGTCCCTGAGCTGGCCGCACCGGGCTTGTG
CGGAAAGTCACTTGGGAGGTGCTGAGCTGCCGGCCCTGACTCGGGCAGAGGCCGGTCTGTCCCAGTGTTCCGTTGCTGCGAGAAAGTTCTGCTCGACCCAGCCTTCCCGAGTCCTGCCTC
TGACTCCGTCACACGGTGGCCGAGTGGCTGACCACGTGTCCGTGCCTTTCAGGAAGCCAGCTGTCTGTGGACAGGCGGCACCTCGTGCTCTCGTCAGGAACGCTCCGGATCTCAGCTGTC
GCGCTGCACGACCAGGGCCAGTACGAGTGCCAGGCCGTCAACATCATCGGCTCCCAGAGGGCCGTGGCCCACCTGACCGTGCAGCCCAGAG
GTATGCAGCGCCGGTGCCTCCCGGCGGAC
GGACTGCTTCGTGCAGACCTGCCTCCGGGACAGGCGGGCCGTGCGCAGCCCGAGCTCAGCGCTCTGGACAGGAGCTGGTGAGGGCTTGTGGTCTGCTCTTGAGAAACGGCCCCTCATGGG
GAGGGCGGGCCACCGGCAGACCATCCCCCCTTCTCTCCAGCCCCCCTGCTCTGTGCAGACAGAGCTCTGTGATGCCGGCCAAGAGTGCCCCGGCCTGCCATGGCTGAGGACACGGGGCCT
GTGCTCCCAGGAAGCTTTTCGGATGAATGACAAGTGTCCCGGGTTCCCCACCTTTGTCAGCTGGGTGTCCTTGCCTTGCAGTCACGCCGGTGTTCGCCAGCATCCCAAGCGACATGACGG
TGGAGGTGGGCACCAACGTGCAGCTCCCCTGCAGCTCCCAGGGGGAGCCCGAGCCCGTCATCACCTGGAACAAG
GTACCACAGGCAGGCACACGGGCGTGGCAGCCGCCCCCAGCTCGTG
GCTTCTCCGCACCGTCCGTAGCCCGAGCTAAACCACGCTGTGGGCCCCTTACTAACAAAACCAGGCAGAAGCAAACCCGACGTTCTCCTTTTCACGTTCTTCTCAGTGACAATAGCAAAG
AGAACCTTGCGGTTAGATCCACGGCCCCGTCATCAGTGGAGGTTTTTTGTTGTTACTCCATTTTTCTGTGTTGCTTTTGTGAGGCCCAACACAAAATTGCATTCCGGTGTTTAGCCATTA
TGAACGAGGGTTTCGAAAGGACAGGTCCCTGGAGGACAGGGTGACCACGGGCAGGGGGCCCCCACAGGTGGGTTTGAGTTCTGGGGGCCACCCCGTCCCTCACCCACGTCCCAGAACTAC
TTGCCAGCCCTCAGCTGCCCTCTGCCGGGACCACGCATGGCCATCTCGCGGTCCTTGTGGGCTTATTCTCGCCCTTTCTCGGCCGGGCCCATCCACTGCCCTTCTCGGGTGTCCTGTCTC
CCAGAAGACCTTGCCCAGGGCCCTCCTCGTCACTGGGTGCCCATGCGCTGTGCCTTCCCCACCGTCGTGTGCGCCCCACGGGGGTTTCCTTTTGTGCACCCCCAGCCCCCGATCCTGGAG
AATCCAGGAGACTCTGTCTCTGTCTTAATCTTTTGTGGATCTTTCAAAGGAGTTTAAGAAACGTTTCTCTCAGTAAATTGGACTAAATCGCCTTTTCTCTCCAGTTTTGGATTCCTCTGA
GCATAGCCTCTCGCCATGCCCATCGGTGAGGTCCTGGCAGCAGTCCCTCCACCCCATGTAAAACCACTTCTTCTTGATCTCAGTCTTAGTATCATTTCTGTTCGCTTTGCTCCAGGATGG
GGTTCAGGTGACGGAAAGTGGGAAATTTCACATTAGCCCCGAGGGGTTCCTGACCATCCATGACGTTGGGACTGCGGACGCAGGCCGCTACGAGTGTGTGGCCCGGAACACTATCGGGCA
GGCCTCGGTCAGCATGGTGCTCAGCGTGAGCG
GTGAGTCCCTGTGGCCGGTGTGGACTTCCCTGGCGTGGGCTCTCAGGCGGAAGGGGGTGCGCGGCCCGTTGCACTTGCAGACTCAGCG
TCTGACTATTGGGACGCAGCGTGTCCCTGGTTGGCGGGGGTGGGGGTGTGGACACGCCAGGGCCCCGGCATCACACACTCTGGCAGCCGCCGCGCCTTGCTGCGGCCCCAAGGCCGCAGG
CCGCTGTGGTCACACGCCCTGTGATCAAGGCTCTCCGTGAGCGGGTTTTAGTGGTTGGCATGGCAGTGACCCAAACCCACTCACATTCAAAGGGTGTAATTTACAGTCCCCGTTTGGCAG
GAGTGTGGATGCGGCTGTGGCTTTGAACGAGCCGGTGCCCCATTGCTGTGCTTACTCTAGCTCTGGGTGGGGCCACACATCTTCCCGGGATGAGCGTCTTTAATCAGGGTCAGCTCCCTG
CCCTGGACCCTGACAGCCGCCCTGGTCCAGCCTCTGCGTTTGCCCCTCACCTGCCTCCCTCACCTGTCCCGTCTGCACACGGCCGCGGTCTTCTGGAAAGGGCCGGTCCTGTGACGTGTC
GCCAATGCTCCCTGCGAGCTGTGGTGCCAGGGTGAAACCCGCAGCCTCAGATGTGACCCCCACACATCCCACGCAGTCCCATCCAGCAACCCCTGAGCCACCCTGGGTGGCCCCTTCTGA
GTGTCCGCGGCCCTTTACTTGGGTCTGTGCTGCTGCCTTTCCCACAGCTCACCCGCCCGCTTTCTCCACGTTGTGGGCACCCCGGGTGGTAACGCGGTCTGGTGGGTCTGCGCACCCAGC
ACCCCCGTGCCCGAAGCCTGCAGGTGCTTACCAGGTGCGAACCGTAAGGGAATAACTGGGAGCCTGGTTTGGGGTTTCTTTAGGGAAATATGTATTTTCCCATGATATATTGTGTGTGGA
ATGAATGTAAAAGTCAATTGATGAATTCTATGATTTTTTGTTTTTTGAATAACATTTTTTCTATCTAAAATATAATGTTACTTTGATGTGAATTAGTTATATATATGAGATTAAAAAATA
ATCTTCTGTGCATGATCCCACCTCCGTGAAATAACCGCTATTAACATTTTGGTGAATTTCCTTTATTTCTTCTAAGGGTAGGTAAATGTTTTCAATTCATTTTTGTGATCGTTGTTTAGA
AAACAACAAATCCAAGTCATGCGTAATAATGAAATAATTGGAGTCATAGAACTGTGTAAAATTATCTGACTCATTTGTCTACCACATGGCATAAAAATATTAGGTTCTAAAAATTAGTAC
ATTTGGGTCCGTTTGAGACACATTGAAGTGGGTGTTGTGCCTGGGGAAAGGCTGTTGGGCCACGTTTCAGGCGTGGGGAGTGGCTCACCGACAGTGGTGAGTGGGCCGGGTTTGCGGAGC
ACGCAGGGGTGGCTGCACCGGGCTCTGTGCAGGGCTGGGCGTCAGGCGCTGTCGGGGGCCCGAGAGGTGAGTCGGGTGGTGCCTTCTGGCTCAGCGCAGAGATGCTGGTGGCGGACCAGG
GTGAGAAAAGACTGGAATAGTGATCGACCATGAGAGTGGGGGTCGGGGGAGGCTGTCGGAGAGACCACCCGAGCAAGCGAATTCTGAGCAGAGCCGCGTGGAATGGCCAGTGTGAAGCCT
GAGGTTGGGATGAGCCGAAAGCCCGGAGGCCAGTGGTGGAATCGGGGAGGGCAGGCTGGTCCGGGGCCTTATTGGCCACGCTGTGGCTTGGTTTTTATTCCACGTATGTGGGAAGCCTCC
GGATTCTGAGCAGGGGGTCTGTGAGCCGTCTCCTGTCCTCAGCGGTGACACTGGCCATGAGGGACAGTGAGGTGTGGAGGAGGAAGTGAGGACGGTGGTGGCTGCCATCATCACAGCTGG
TGATGCCGCTGTAGATCGGACGGGCCAGTCGATGGTGGACGTGGGTGGGGCCTGGCAACATGGGCACCAGTCACCGACATGGTGGACAGAGCAGGGTGGGGGCAGGGCAGGCCAGGCAAG
AGGCGTACTAAGAGTTCCGTGTCCACAGGTCGAAAAGCCGTGGGTGATGTTCAGGGAGAGGTCAGGGCTGGTGCTGTGGGTTTGCGAGTATCTAAACCGTGGCGCCCACGAGATCACCCA
AGGGCAGCCTTAGGCAGACAGGCGACTGCAGCTACACTGGCCGCTCTCACGGGAGGCATCTGGCGGGGAAGGAGGAAGCAGCCAGACGCCCCAGAAAGGACCAAGGAAGAGTGGGCGTCG
GGAACGAAGAGCAGTGATTTGTCAGATCTGGGTGCCTGTCTGTCAGACAAGGACAGAGAATGAGCCTGACCCTGGAAAGGAGTCCTTGTTAGTTATGAGGAATCGGGAAGAGGTATATCC
CAGGTAGGAGAAAGCATATCCCAGGTGGGAAAAACTATAAACTGTGCGGGAGGAACTATATCCCAGGCTGGAGGAAGTATATCCCAGTCTGCAGAAAGTATATCCCAGCCTGGAGGAAGT
ATATCCCAGGTGGGAGGACGTATATCCCAGGCGGGAGGAAGTATATCCCAGGCGGGAGGAAGTATATCCCAGGCGGGAGGAAGTATACCCCAGCCTGGAGGAAGTATACCCCAGCCTGGG
GGAAGTATACCCCAGCCTGGGGGAAGTATACCCCAGCCTGGGGGAAGTATACCCCAGCCTGGGGGAAGTATACCCCAGCCTGGGGGAAGTATACCCCAGCCTGGGGGAAGTATACCCCAG
CCTGGGGGAAGTATACCCCAGCCTGGGGGAAGTATACCCCAGCCTGGGGGAAGTATACCCCAGCCTGGGGGAAGTATACCCCAGCCTGGGGGAAGTATACCCCAGCCTGGGGGAAGTATA
CCCCAGCCTGGGGGAAGTATACCCCAGCCTGGGGGAAGTATATCCCAGCCTGGAGGAAGTATACCCCAGCCTGGAGGAAGTATACCCCAGCCTGGAGGAAGTATACCCCAGCCTGGAGGA
AGTATACCCCAGCCTGGAGGACGTATACCCCAGCCTGGAGGACGTATACCCCAGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCT
GGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCC
CGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGT
ATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGA
GGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGG
CCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATA
CCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGACGTATACCCCGGCCTGGAGGA
CGTGTACCCAAGACCAAGTGAAAGCAGCGCTGTGTGAAGGTCATTTCATCTGTGCCAGATTCTGTGGAAAGGCTGAGTATGTCGAGGGGAAAACGCACCACTTGCTTCGGAAGCTGCGTG
TCTTGCCGAGCTGGGCACCGGCAGCGTCCGGGGACAAGGGTAGAAGGTTGGTGGGTCAGCGTGACTCTGTCAGCAAACTCTGGTATTTAGTGAGAAGAAAGGAGAAGAGGGAAGTATAAG
GTGAGGAGCTGGGGCCCCTGGGTGGGTCGGTCGGTGAAGCCGACCCTTTGGCTCAGGTTATGATGTCAGGGTCCTCCCCCGACGCCGGGCTCTGTGCTCAGCGGGGCATCTGCTTCTCCC
TCTGCCCCTCCCCCCACACGTGCATTCTCTCTCAATAAATAAAATCATTTTTAAAAAAGGAAGAAAAGAACGTCAGGCACAGCTTGAGAGGGTCGCAAGCTCAGCCGTGTGCGTGGGTGC
ACACACGTGTGTGTGCGGCTGCGTGTGTTGGTCTGCCCACAGCTGTGACAGGAATCCGTCCAGAGGAGACGGGAAAGGCAGGGAGCAGAGTCTTTGAAGGGAAGAGCGGCTGGAGGCCCA
GGAGTCCAGCAGGGTTTGGCTGTTGATGGGAAGAACAGAATCCACTAGGAACCGAACGCCGCCCCGTTCCCGCACGGCCGTGCTTTGCTAGAACTTCCCTGTTTCCCGTTGGAAGTACTT
TTCCCGTGTTCTTGTGGGGTGTCATGTGGTTTCAGAAATTAAGGTCTACACTTTGCATACTGCTTGAAAATGGCTTCTGGTGTCATTGAAGCTTCAGTGTGAGAGAACACCTGGGGGAAG
CGTGCCTTACGTCTGAACGATGTCGCGTCCAGACGCCATCGCATGAGTAACGTAGCGAGGCCTTTTCTTGGTCACGAATGACTTCATGTTTTCCCAGTTCCTGACGTCAGTCGAAATGGG
GACCCGTTTGTGGCCACGTCGATCGTCGAAGCGATTGCGACCGTGGACAGAGCCATCAACTCGACACGCACACACCTGTTCGACAG
GTATCGTGGGGGCGGAGGCAGGTGTAGACCTCCG
CTGGCTGGGGTAGAAAAGAGCTGTGACCTGTTTCACCCGAGGGAAAACCTTTGAATTTAAAAGTCATAATCGATTTTGGCTTCAAGTTTTGTGGGGTTCAGATAACAAAAAGATACATCC
TTTCTCGATAGAAGTGGAACTAGGATTCACAAATGAGACATTTTTAGAAAATCTCAACTCATTCCATTGGCTTGTTAATGCGTGATTCGTTCGCATAGCTAATTCCAAAGTGTTTTATTC
TGCGTGTTGTAACTAGAACAGATTATCTGTGTTTCCTCTATTGACTTAATTATTTGTTTTTAGTGTCTTTGTTTTTGTTTGTGTTTGATGCCTTCCACTTGGGACGAGTAAGGTACGATC
CATCACGTCTCTAGAAAAGGAGCTACAGAAATATTAGTGGCAGTAGTTACATTCTTGGACGTGAGTGATTTTTGTCTTCCTGAGGTGGTTCTGTTCTTCCCTGTCTGCTTTCAACCCGAC
AGCCGTCCCCGTTCTCCCAACGACCTGCTGGCCTTGTTCCGGTACCCGCGGGACCCCTACACCGTGGAGCAGGCGCGCGCAGGAGAGATATTTGAGCGGACCTTGCAGCTGATACAGGAG
CACGTGCAGCACGGCCTGATGGTCGACCTCAACGGAACAA
GTCAGTGCCCCCCAACCCGAGGGCTGGGCGTTAGCCTCACGGCTCTGGGGCCTTCCTGGGAGCCGTTCCCGCATCCCCGT
GTCTGCGTGAGGACAGGGTTTGGGCTGCCTGGGACCCCGCCGCGGCTGCCTCAGGTCCCCTGCAAAGCCACACGCAGCTGGACGTGCACTGCCCTGATCGCCGGGCCGGGCCGGTCGGGC
TCCTGTGACCTGGGGCCCAGCCGCTAACCACTGAGGCTGTGCGCCTGGGACACAGTGTCGCGGGTTGTCAGGAAGGAGGCTCCTGGTGCCTGGGCGTTTGTGAGGGGGCGGCCGCGGCCG
CCTGGGTGCTCTGTGGACGGCGGGAGCCTGACCCCCTCCCATGGGCTGGGCCGTGCTGAGCAGCTGGGAGCAGCGCTCGCAGATGCTAAAGGGCCGGGGTCTCTAGTGTGTGAAAGCATC
CCGTCAAGCTTTCCGTGAGCGCCTGTGCCCTGTCCGCTCACGGGGGTCATGCTCCGAGGCGCCCAGGGTTTTCCGAGTCGTCTTCAGGGACCCATCTTGCCCATCAGGACAGAAATGTCG
CTCAGGGACTGTGTGTTGCTAGATCCGAGCGTGCGGCGTGAGGACGTGGGAACGGGGCCCTCTCTGCTTCTTGGGAGGAGAGGAGGTGCCTGAGCCAGTCCTCAGTCCTGCCCCAGCTTG
GTTCGGGCTCAGCTTCCCGGTGCTGGCGTGTAGACGTGCACACCGTGGTGCCTCCTCCTCCTGGAGGCACGGGCCTTGGGTGGGGGTCGGGGGCCGTCGAGGACGATTCCACTGATTCAC
GGATGGGCCAGCCTGGCCTCGCGGGTGCTCCCTGGGGAGAAATGTGGGGGCCGCGCCTTCTCTCCACTTGCCTGTGTTATGCACTTTCTACCCCTTGGCCCAGGGATGGGGACAGGGACA
CGTGGGACATGTGGCCCTGACCCCGTGGCGCCTCCCCATGCTCCCCGCCATCGGTCGTAAAGGACCACGCCCTGCCACGTGTGGAGGGTGCGTGGGGTTGCACGGTGCTCCTTCTTCCTG
CTGTGGCCTCCCTTCCTTCGTTGGGTTCATCGTTCACGTGTTAAATGTGGCCGTGGCAGCTTCAGCAGGCGGCCCGTAGACCTCATGCAGCCATTTAGAGAAAGAGAGCCCCTCTGCCAA
CGTCCCTCGGGCGGGACGGTGTGCTTGCCTCCTGTCAACACGTGCTGCTTACAGAACAAGGCAGAACCCGAGACAGAGGAGAAACTAAAATCACTCAGCGCCCCAGCAGCGGTGTGCACG
GCTCGGGGTGCGGTTGGGGTATTTGTGGGTGAGTGGGCCGCTGGCACGGCTGGAGGAGGCGGACGCGCTGGAAGGGGTATGAGGGCAGTTATGGGTGCTCGGCCAGAAGGGGCTCCTGGG
GCGAGTGGATGGTCTTGGCTTGGTCTGTGTGACATGGGAGCCACAGGGCTTCTTGATCTCCTGGATCAGGTCATCGGGGGGCCCTGACACAAAGGGGGAAGGGCAGTGCAGAAAACCAAG
CAGGTGTCTGTTAGGGGCACTGAGGGAATGGCAGATATCCCTGAAATGGCCCAGGAGAGTTTGGAGTGGCAGGTATTCGTGGGGTTGCCCAGGAGGGGCCGGGGTGGCAGGTATTCATGG
GGTGGCCCAAGAGAGAGGAAAGTGTGGGCACCAGGGTGACCGGTGAGTGGGGTGGATCCAGGCGCCCAGAAGGCAGAGGTGAGACACTCACTTGTGGCTTGAATGTGGAGGGGTCAGGTG
ATGAGGGGCCAGAAGGCCAGAGGTGACACTTAGTGAAGTGGGGACATTGATGGAGGACCAGGTGAGGGGCTGGGGAGGGGCTGTCTCACCTCCAGAGGCTCCAGGCATGCACAGGAGACG
GGGGTCTCCAGGGGCCCCTGGGTCCTGGTCCCACAAACCCTGGTGTCCTAACTCACCGTGGAGGAAAGCATTTGAGCTTCCGCAAACAGTCCTCCTGGCATCTTTCTGTGTCAGGAAGTG
GTCTCGTCGGCTCCCTTATTCTCAGGTGCATACTCGCCCTCACGTTTCAGTACCCGCACTGGCAGTTCGTTGGAGATAGTTCTCATTTCTAAAGCAAACCACAGTGGACGAGTGTGGTCG
GAAGTGGTCAGGGCAGTTTGCAGAATTCCCGGAGAACAGCTCATAATCCAGAACTTACGGATGCGCCGCAGTGACCGGCCCACCCGGTTTTGTAGGAAGGCGAGATTGGCCGCATCGCAT
CAGTGATGTTTGGGCAGCTCTCAAAGTACCCTGAGCACGTCTGAGCTCACCAGGCGGCCTGTCGTGTCCAGCCTGGGCTGGGGGCTGGCGCCGGCCGCCGCATGAAGAGAGGGACAGGGC
GGGAGGACGCCTCCCCACTGGGCTTGTCCGAGAGCCCCTGGCCACTGGGGGTTCTAGGACTTGCGAGCTCACTGTGAACAGAGCCAGACATCCCCGTCTCCCTTCCCCCCATCCGGAGGG
GCTGCTGCCGGAGTTCTCAGGTCTAATCGAACCCTCTCGCACAGTCTGCCAGTGCCCACTTCTGATTGTGACACCTCCCCACCTCCAGCTCCCTCGGGGGTCGCTCAGACGCCGCCCCCA
CAAATCGGGACCGGCTCGCTTCCTTTAAACCTCCGCAGAGTCCATCCTGATTGGCTCTGAGCAGGGAAATAAGTAGTGGTGAGAGGGGCGTGAGGGTGCGTGTGTGCACACGTGTGCCTC
TGTGTGTGAGCATGTGGGCGCAAGGGTGCGTCTGTGAGCCTGCGTGCCCCTGCGTGTGAGCATGTGGGCGCAAGGGTGCGTCTGTGAGCCTGCGTGCCCCTGCGTGTGAGCATGTGGGTG
CGAGTGTGTGCCCCTGCGTGTGAGCATGTGGGTGTGAGCGTGTCTGCACACGCGTGCCCCTGCGTGTGAGCATGTGGGTGCATGGTGCGTGTGTGCACACATGTGCGCCTGCGTGAGTGC
GAGGCTCTTCGGGCAGCCCCCAGAGTCGGCCCTGGGGCAGGTGAGGTCCTTCCCAGCTGTTCCTGCCGGGACCCCTTGCCCTTGCTGAGTGGACCCCGGGTTGTTCCCGCCCATCACATA
CTGGTCCCCTCCCTTGGCTCCCCCCACCGTCCCCCTGCACTGCCCAAAGTCCAGGGAGTAAGCCGCGTCCCCTCTCCCCTGCAGGTTACCACTACAATGACCTCGTGTCTCCCCAGTACC
TGAGCGTCATCGCCAACCTGTCGGGCTGCACGGCACACCGGCGCGTGAACAACTGCTCGGACATGTGCTTCCACCAGAAGTACCGCACTCACGACGGCACCTGCAACAACCTGCAGCACC
CCATGTGGGGCGCCTCGCTGACCGCCTTCGAGCGCTTGCTGAAAGCCGTGTATGAGAACGGGTTCAACACCCCGCGGGGCATCGACGCCGGCCGGCTGTACCACGGGCACGCGCTCCCCA
TGCCCCGGCTGGTGTCCACCTCCCTGATCGGCACGGAGACCATCACGCCCGACGCGCAGTTCACCCACATGCTGATGCAGTGGGGCCAGTTCCTGGACCACGACCTGGACTCCACGGTGG
TGGCCCTGAGCCAGGCCCGCTTCTCCGACGGCCAGCACTGCAGCTCCGTGTGCAGCAGCGACCCCCCGTGCTTCTCGGTGGCCGTGCCGCCCAACGACCCCCGGGTCCGGAGCGGGGCAC
GTTGCATGTTCTTCGTGCGCTCCAGCCCCGTGTGCGGCAGCGGCATGACGTCCCTCCTCATGAACTCCGTGTACCCGCGGGAGCAGATCAATCAGCTCACCTCCTACATCGACGCCTCCA
ACGTCTATGGGAGCACGGAGCACGAGGCGCGTGCCATCCGGGACCTGGCCAGCCACCGGGGGCTTCTGCGCCAGGGCATCGTGCAGCGGTCGGGGAAGCCGCTGCTGCCCTTCGCCGCTG
GACCGCCCACGGAGTGCATGCGGGACGAGAACGAGAGCCCCATCCCCTGTTTCCTGGCGGGGGACCACCGCGCCAATGAGCAGCTGGGCCTTACGAGCATGCACACGCTCTGGTTCCGCG
AGCACAACCGCGTGGCCACCGAGCTGCTGGCGCTGAACCCACACTGGGACGGCGACACCATCTACCACGAGGCGAGGAAGCTCGTGGGCGCGCAGATGCAGCACATCACCTACCAGCACT
GGCTGCCCAAGGTGCTGGGCGAGGTCGGCATGAAGGCGCTGGGCGAGTACCGCGGCTACGACCCGGGCGTCAACGCCGGCATCGTCAACGCCTTCGCCACGGCCGCCTTCAGGTTTGGCC
ACACGCTGATCAACCCCGTGCTCTACCGGCTGGATGAGAACTTCGAGCCCATCGCGCAGGGACACGTCCCCCTGCACAAAGCCTTCTTCTCTCCCTTCCGCATTGTGAACGAGGGTGGCA
TCGACCCGCTGCTCAGGGGCCTGTTCGGCGTGGCGGGGAAGATGCGCGTGCCCTCCCAGCTGCTCAACACGGAGCTCACGGAGCGGCTCTTCTCCATGGCGCACACGGTGGCCCTGGACC
TGGCCGCCATCAACATCCAGCGTGGCCGGGACCACGGCATCCCGCCCTACCACGAATACCGCGTCTACTGCAACCTGTCGTCTGCCCACACCTTCGAGGACCTCAAGAATGAGATCAAGA
ACCCCGAGATCCGGGAGAAGCTGAGGCG
GTGAGTTGGGCGTCTCCTGTTTGTAAAGGTCAGGAGAGCCGAGAGTCGTGGCCCCAAGCGTGCGCAGCTGTTGTTCTTTATGTTGGAGTGTG
TGTGCACCCACGCAGTCCGAGGAGACGAGCCCCAGAGGGTGGAGCCTGCGGAGGGGCCACCTTTGGTGGCCATAGCCACGCGAGTGTCCAGTGTGCCTGTCTGGCGCAGCCTGACGGGGG
AGGGGTGGGCCCAGCTGGGGTATAATGGGCTTTGGGGAGAGCTCCTGCGCTCCTATCAGGCAGAGGGCACCCGCGCATGCCCGGTACAACGGGGCAGGAGTTGCCAGCCCCTCCTCTTCG
TGTCTGGAGACGACAGCTGGCGGCCTCAGCGATCGTGCGGGCTTCTAAGCAGGTGCGGGGGGCTGCAGTGGCAGGACCGCGAGGGTGTGCCGGGTCCATGGAGACCCCGGGCAGCAGGGA
GGTTAGGGGCCTTGATCCAGGAGGATCGGGGCTGCCGTCTGACACCAGCCCTCCCGTGGCCCTCTGTGGCTCCGCGCGGGATGGCCCCTTCGACCTGCAGTTTCTGCACGCTCAGCCCCG
GCCTTTCTCTGCGGTCGCTGCTGCCCTTCTCGTGGTGACTTTTATCACGTTCATTATTCCAGTTCCTTTAATGGAAACAGCCGCTCGTTGGAGTGTCTCCGTCATGGTCCCTCTTCGTCC
TGGGACCTGTGAATTCAGTGCACAGGTCACTGTGTATTTCGGTTGTGTTCATTCGCATTGGGAGGAATTGTCAGAAAAAGGAAAGCCCCTCCCGAGGACTCAGTCTGCTTGTTCCGGACT
GTCCCATCCACCGCGGAGTAAATCACTTACTCTCAGCGCCGGAGGGGAGGCTTTCGCTAGCTGGGAGCCAACGTGCCTCCTGCAGAAAGGTGACATTTTATGCGTGGTGTCAGTCGTGAG
CTGAGTCGTGAGCACATCACGTGCTCCTGAGGTCAGCGTGTCGGGCGCTCGCCAGACTCAGCTCCGGGCTGCTGGCGCGTGTGGCTGGTCCTCCCCGGTACAGGGCGGACCTTGTCCCCA
TGTCGCTTGATTACGATTTATGTGAACGGTCTATTTTCCATGTGCTTAAAGAGTCTCCTTTGCTCCTGTCCACACGGACACAGATTACTTCCCCGTATTTCTCTCCTTCGCCACAGTCCA
GGGGCACTAGTGCTTCTGCGAGCGTTGTTTGCGGGTGGAGGGGTGCACGCCTTGTGTGCTGGAGACCCTGTGAAAGACATGGCACCTCATTCACCAAACACCCTGTCGCTCATTCACTTT
CCTTTTCGTCCACCGACCAAGCAGGGAAAGGGGACCTGAGGTCGAGGCCATAGGCTCTGGAAACCTCAGGGGCGGAGAGGCCTTCAGAAGACCTTCCTCAGGGCCCGAGGGAGGGGAGGG
AGCAGGGCCTGGCCGGAGTCGGGTGCTGCCTGCTGGCTGTGTCCCGTCCTGCACCCGTGTCAACAGTGGGGTCGTGGGAGGCATGCTGGCGGAGCTGGGGCTCCGGGTTCCCGCACCGGC
TCCCAGCCCGGCTCCCCAGGAACCATGCCGCACGGCTGTTTCCATGCACGGTCCTGCTGAGGGCGTGGAGTGGGAGGGAGCGCCCAGCCTCCCTTCCCGAGGGACCAGCGCTGCTCAGTA
GCTACCCTGTGTCTTCCACGGTTTGTGGGCCTGAGGACCGAGCCGCGGGGCCTCTCAGCCGGCGGTGCGCGCTGAGAACGCCCAGCCAAGCTGCGAGTCCACGTTGAAGGCAAGCGGACG
CGTGTGTCTGCAGAGCCGCCTGGGTGGCTGTGACATGGCACTGTCAGCCCTGCCCTGCTGGCGTTTCCCCGGAATCGCGAGAATTCCATGAGCGAGCTCGTTCTGGGGCACGTACACCTT
GCTGTCTCAGGCTGGGTATCAGTCCTGCTGAGTAACTAGCTCCTTGCTGCGCACGTCTTTTCAATAAGTAATCGGATTTCAGAGTTAGGACTTTTTTTGAACGTCTGCCTTTAACTATGT
GAAGTTTGTTCATTTGTATTTATGAAAAGAACCTGGAGTGGTGTACATTGTACTCTCGTGTGATTATTTCTGAATAGAAAAGGTGTGAGTTTAATTTTCTTCCTATATTAACTTGGTTTT
TCTAAACTCATAATAGACGTGCACATGTGTGTTTTATACGTGCGTATATACACAGGAAGTACAGAAAAATTTAAAAATACAATGGATAGATGCTTTAAATAAATAAAAGTGAATTTTCTT
TGTTAACTAAAGGTCTAAAAGATGCTAAATAAGAACAGAAAGTGAGGACTTTGTCTCATATTTGCTCTATTTACGATCTACTGCTTTCTTGAGCAGATGTAAGGTTTCACTTGTTTGTTT
GGTTTTTGTAGGTTGTACGGATCCCCACTCAACATCGACTTGTTCCCCGCCCTCATGGTGGAAGACCTGGTCCCCGGCAGCCGACTGGGGCCCACGCTCATGTGCCTGCTGAGCACGCAG
TTCAAACGCTTGAGAGATGGGGACAG
GTAAACACAGGTGCCACGGGACAGGTGAAGGCGGGTGCCACGGGACAGGTGAGGGCAGGTGCCACGGGACAGGTGAGGGCAGGTGCCGCGGGAC
AGGTGAGGGCGGGTGTCACAGGGGACAGGTGAAGGTGGGTCCGTGAGCAGCTCCCTGGTATGGGGACTTCCCTCCCACTGCGGCCGAGAATTACATGGCCGCCCTGCTCACGGATGCTTT
CGTGGCCTTCCACTTAGGATGTGTCTGTTCCTAGGAACAGACAGTTCGCAGGGTTCAACCACTGCGGGAGTTCTGAGAATTGGAACTCCTGGCAACGTCGAAGTTTCAGGTGTGATGCGG
TGTCGTTAGTGTTGAGTGTGGTAGGGAAGGGTGGCCCGCGGTGAGTCCGCCGGGGCTGTGAGCCACGCTGTGGTTTCCAGCAGTGGCCTGTGCTGGCTTCTCGGAGCGGCTGAGCCTCTG
CCGATGTTAGTCCAGATTTTCTATTTTGTTTCTTGAGTGGGGACGCTGAGTCATGTCCGAGTCCCTCCGTGAGTGATACCCAGTGGACGCGGGCGGTGTCCGTGTTGTCGGCGGAGCTGA
CTGGGGAACGTTTTAGTTCACCTCCTTGCATCTGCTCTTCTCTCCCTCCGCGGAAGCACAGGTTGTGGTATGAAAACCCGGGGGTGTTCTCCCCGGCGCAGCTGACACAGATCAAGCAGA
CGTCCCTGGCCAGAATCCTGTGTGACAACGCCGACAACATCACGCGTGTGCAGAGGGACGTGTTCCGTGTGGTGGAGTTCCCCCACGGGTATGGCAGCTGTGACGAAGTCCCCAGGGTGG
ACCTGCGCGTGTGGCAGGACTGCTGTGAAG
GTGCGCGTCTCGGGGTCCTGCCGCGTGTGCGGGGGTGCGCATCCCGGCCTCCCATGTGCCACGGCTCTGGGGGTGGCCGCGCGGGGATGC
TCCGATCGTGAGGAGCTGGTCCCGATATGGTGCTGTTGGCTGTGGGAACTCAGTGGCGAGCTCTGCGCACCGGAGGCAGGAGTAAGCGTAATCAGGCAGGCTTCTGCTGTTTCCTTAAAA
CCTAACGTGTGTCTAATACGAGTGCTTGCGTGTGGGATGAGTGTCGTGTGTCGGCACCTTCAGAGGACACGTGACTGGACTGCCCAGGAAGCGTGGCGCTCACTAGACTCCGTGCGCTGC
GTGTCCCAGACACCTGTGATGATGCACGTCGCCCGACTATGTTGTGAAAGGTCACAGCGTGGACCTGCTGTCCGCGCCGAGGCCTGGGGACGCGTGCGGAGGGGCTGGCAGGTCCCTGGT
GCCGGGGCGCCCCCTTCACCCCGCAGCACCCTTGCGTTCACAAATCCCACTGTGGCTCACCACGATTTTCATTTCCTGCTCTGAACGTAATTGTGGCTTGATTCAAACTGCAATCAGAGA
CCAGGCGTCGATGAAGCTGGGGCGTGTTTGGAGCCTCCCGTGGGACTCTGCTGTTCTGCGGCTGGGAAGCGGTTGACCCGCAGGGCCCGACGCCGTGGGGACAGCTCCTCCCACCTCCAC
GCGGCACGCACGGGAAGCACAGAGCAGATCTGCCTCTCTCCCACCTCCTTTTCCCGGGGGAGTCGTTCTGGTCAGGCTCCCGTCCTCACTGGTAGTTGCTTTTAATCGGCCGTGGTGTCC
GTGAGCATCGGAATCTGGCCTGGTAGGTTCGCGCTGCTGCTCCTCGGCCACGTCCGCGTGTGGGTGGCTGCGCTGGTCCGGCTGTCTGTCTGCCTCCGTCTGGCTGTCCTCTCAGGTGAA
TGTGCAATGCGCGTGTACGGGTGGCTGCCGAGCTCGGGTGTGTGGCACGCGCAGTGTGTAATACAAGGATTTGCACGAAGATGAGCGCGGAGTTTACTGCACGCCCCACGTCCCTAAACA
TCTACATTCTCACGATTGCATCTAAGGAAAACTTGTTTCTGGGTTTGCTTTTTTTTTTTTTTTTTACCTTTTTAAAGAAATATCCTCACTGGTTTGTCAGCTCAACTTGCGTTTCCGTGC
GTACAGCAGAGTTTGGTCCTTGCACCTGCAGGAAACTACTGTTTGAAAGCCCTGGGAAAGGCCAGTTCTTCTGGGATACAAAGCTTCATGTCCTGATAGCGCCACCAGGCCCCCCAGCTG
CTTAGATGGGGGCTGAGCTGGGTTTTCTGTGGTTTCTCTCGGAAAAGCCAGAGTCCTGGGAGAGACGGGGACTCAGAGCTGGACGTCATTGGGGCCGCTCTCCCCTCGTGCGCCTGCTGA
GGCCTTTCTGACCTCCCTTCCCCTGGACGTGTTTCCTCCAGGTCCGAGCTGCCCGGGTTCAAGGGAGCTCCGTAAGCTTTGTCTTGTAGCTCAAAAGTCATGTCTAAAATACAGCAGAAG
GAAGAATTAAGGTTTGACAGGACCGACTGTCGGCCGATACTTACTTTCCAGTCCACTTGAGCAGAGCAGCTCGCTTGCGCTCACCACAGGGTCCCATCAGTGCATTTGAAGACCCAGGCG
TGAGGCTCACCCACAGGAGAACCCTGAGAAATGACGCCCGGGTGGGCAGTTTCTTTGTCTTTTATCAAAGTTACAAATTACCCCTTTGTGGGGATCGATGGGGCACACACACCCACACGA
ACACACAAAGGCACACATACGGTTTTGAAGTAATTGTGTTAATTTTAAAATACCACAAAGAATTCCTGTATTTCATCAGATTCATCCATTGTTGAAGTTTTATTCTATTACTGTTCTCTC
TTCCCAGGATATGGGTGTCTGTGTACGAGCACACGTGTGCATGCGTGTGTCCGTGTGTGCATGCGTGTGTGCGTGTGTAAGGGGATACACATTTTCTCTAAATAGCCGAGGAAGTTGCAG
ACAGCATACCGCTCTCCTCCTGAATAGCTCGTGTGTGTGGGCAAGATTGGGGACGTGATCGTGGACGCACACTGTGTCCTTCCCGCAGCGGGGATCTCATGCTGAGCCCCTTGGCCCCCA
CTTTGCACAGCAGGCGCTGGGCCCGCCTTCTTCTGGACCCGCCGGCGACTCCCGGGGCAGCTTCAGGAGGTGTGCCAGGCGGCTTGTCCCACCACTGGCGACCCGGACGCGGGTTATCCA
GCCGGAACGCGAATTCCACATTTGTTCAGTGGGGGCAGGTGTGAGAACGGGAATGTTTCTGGGCGTGGAAGGCAAAGGCCCTTCGTCTTTGAAGTGAGCTCCTACTGCACCCCCAAGGGG
CGCGTGGGCTGCGACCCACGAACCCCGCTGGGCTGGAGAGTGCTTTGGCGTCAGCGCGCATGTCTCCTCCCGCACAGTGTGGCCCCGGGGTCTCTGGGGTCTGGTGCATTGATGCGGTGA
ACCCACGTCAGCGTTGGAATGTCAGGGGTTGGGTCCAGGTTCGGGTGGGAAGCTGAATGCTTAGCTGCTGAATTAAATCCCAGAACGCTTGGAGGGGTTGTCTGTGGGCTCTGCCCTGTG
CGCGGGTGTGGGGGGCTTCAGGTCCCTGCCTTTGCTTTACGGCGGCGGTCATGGGCCGCTAGACCGGGCGAAAGGGTGAAGAGGGGGCAGGGGAGGAGACCAGCCGCACAGCTGCCGGTG
TCAGCCTGTTCTCCAGTACTTTCTCTTCCTGGGGATTTCCGCCACGGCTATGCACACTCCAGCGTTGGGGAAGGGCCACATGTGGCCTTTGCCACGTTCCCGGCCAGGCCCGTCCTGGGC
GGATGGGGCTCGGAGCGAAAGTGGGTGTTTGTGGGATGGTGTAGTCATGGCCGGGCGGGAGGGAGCCGAGGTGGAGCAGGGCCTGGAGGCGGGACGAGGGAGCACGGTGTGTGTGCCCAC
TGCACCCCGGCCGCAGAGGAAGGTGACGGGGTTGAGAGGACGGGGTGTGGCACGTCCATGGAGCCAGAGGCTGTCCTGCTGTCGGTGGGGAGCCCAGGCGAGGTTGGGGGGCTCCTGGGA
CAGGAAGATGCAGTCCCGAGGCCGTCTTGCCCGTGGAGGAAGGAGGGACGCGCAGGCGGCCCCTCAGACACTGCCCACTACGAGGCCACAGCTTGCATCATAGACGTGCTGTGAAGGCTC
AGTGACGTCGGCAAGGATGTGCTTGATGTCTCTCGAACTAGAGCCTAACACCCCAAACGCTCATTTCAGACTGCAGGACCAGGGGACAGTTCAACATGTTTTCACACCACTTCCGAGGCA
GGCGGTCTCTGGGGTTCAGCTACCAGGAGGACGAGCACGCCGGGGAAGTGGGCTCCGGGGGGACACCGAG
GTATGGCCGTCTCCAAGACAGGGTCCTGGGTGCTGGGCGGGGGCTTCTGT
GGCCACCTATGACGTGCTGAGGTCTGTTGGTGGCTTCTCCTTCTCCCCGAGCAGCATCGGGAAACACAGAAAGCATCCGGGCAATGCCACGGCCCCCTCCCGTGAGCGCCCACAAGTGCC
AGGGACAAGTGACTTCAAGGACTTCGTTCTGGAAATGCAGAAGACCATCACAGACCTCAGAGAACAG
GTAAGCGTCCCTGCACATCCCGCGTCACAGACGGCGTTCTTGCTCCCGAGACC
CTGCAGGGGGGAAATCTGCTCCAGCTCCCTGGAGCCGTCTGTCTGGGTGGCTCTTCTCTGGTGGCCTGTCCCTGGCCCGGCCACATGGGGCTGTTCTCCGGTTTCCCAGTGGCTGGGAAG
CTCACTGTGGGCTGCAGGTGCCATTGTGGAGGGCACGGGGTCCCCGGAGTGGCCGCAGAGATCATAGGTCTGGAGGGGGCTCAGCATTAAGGTCATGAAGAATTCAGACCTTGGGTCCTG
TTCCAAAGCCACTTCCTCAGGAATGTCGGTCTAATCCTTGTCCCCACGGAGGGGCCTGCTGGTCCAGTCCCCCTGGATGTGGGGAAGGGTACCCACCGAGGGTCTCCACAGTGGGCTCTT
CTCCGAGGACCTGTCGGGTCTTGCAGAAAATGACTGGTCTGCCCTCCCCGGCCCAGAGAGCTTTCTCCTGTTCGCATGTCTGCGTCGGGTCCTCAGTGAGCTTTATGTACACACGAGTGG
AGACTGAGGTCCCAGGTTAAGAATCAGTGTGCGGATCAGACGGTCCTGTTGGCACAGATGCCCGATGCTGTGGAAACCTGGAGACGGCCTGTGAGTGGTGGTCTGGTAGCAGGACCCCAT
TGCTAGTGTGGGGTCCTCAGTGCTTGGGCCTGGAGGACGTGGGGTCGTCTGTTCCAGCCATGTGCAGAGGTGCTCTGCTGTGACAGGCTCCAGGGGTGTGACATCAGGGGGAGGGGACAC
CTGGTACTGGGCGGAGGGCAGGGTTTGTGGCACTGACCTCACCTGCAGCCAGAGAGACACAGCCAGGCTGTGACAGGCACAGGGCGTCCCGGGGGCTCAGCCAGGCAGGCAGGTGCTGTG
AGTCCTAGAGATGGTCACTCCGGGCTGGCCAGCTGGACCAGTGACCGACCACGCAGTGTGCACAGGTGAGGGGCACGCAGAAGGGAGAGGTCGCACTCTGCAGATGGCTCAGTGTGAGCA
GAGGCTGGAGGGAGGACAGGTTGGCCCTGAGGCCAGTCGGCTGCCCCGTTTCCGCCAGTGCCCCCCGAGCCCGCCAGCCTCCGAGTCCACCAGCCTCTGAGCCCACNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCAGCCTCTGAGCCCACCAGCTCCCAGAGCCCGCGAGTGCCCCCC
GAGCCCGCCAGCCTCTGAGCCCACCAGCTCCCAGAGCCCGCCAGTGCCCCCTGAGCTCGCCAGCCTCCGAGCCCGCCAGCCCCCAGAGCCCGCCAGCACCTGGGACTCGTCTGTGGCTTC
TTCCACCTGCAGGACGAAATAACACTGGTGCACGTGCCCTTCCCTCCAGGGCCCCCACATCTCAGGGCAAGGCAGCTGGTGGAGCACCTGCTGTGACTGCCGCCCGGGAGCTGCTGGGAA
GTTGGCGGGCGTCTCTTAATGTGCATGGCTGGGCCTGGTTCACGCAGCAATGGTTGTACCCTAATCGCCGCCCAGGGAGACGGCGAGGTTTGTCTTCGCATCTTCCAGCTTTATGCTGAA
ATTTGGTTAGCAGCCACTGAGGAGAGACCCCCCCCTTTCCCCAGCAGCCCTGCCCAGCCCGTGGCTGCCGCTCCTGTGGCCGCAGGGACCCTCCTTGCCCTCATGATTTGGAAGACAGTT
CTGAGGTCTGGGGACGTCAGGATCAGTGATGCTAACGAGAGCCTGCGTGTAAGAGGCGCTGCCTTCAGAGCTGCACCTGAGACCTGAAGGCGCCCGTGCCCTGGGCTGCTGCTCAGGTCG
CCGTGCAGCGGGTGGGGCAGATGCCGAATGCGCAGGGCGAGGTGACCCGGACCACGAACACCATGTGGTCCTGTGCAGCTTGGAGGCCGTGCGGTGATCGGCGCAGTGTCACACGGAGTA
GATGGAGGACGTTTAACCGCCAGGAGCACGCGGGAGGTCCGCGTGTTAATCCGTTCTTGGCGCTCCGTCCTTGATGGGAACAGATGCCCCACCTGCAGACACTTGGTTAGGCGGTTGCAC
CTGATTGTTTCCGTTCTCCTTCGTGGGGGTCGGGACTGAAGCCCCACCGGAGGACTCATAGATGAGGTGGGGGTTTTGCGGGGCTGCCGGACCCTCCACGGTGCAGAGACAAGCACGTCC
GGCCACCGTCAGCGTCGGCAGCCAGCAGCAGGGACGGGGGAGGGGCGCCCCTGGGAGGTCCGCGGCTGGGGTTGGTGGCCCGTCACGGCCGCCCACGTTCGGGAGTCTCCGTGCAGGACG
TTCTCGTCTGGGTGGTTCCTGCTTACGGTCCCGTGGGAGCCTGTCCTCCGGTCCCCTCTGGGCTCTTCTTTCCCTGCAGCAGCCATATGCTGCAGCCTGTGTCCCCCGTGACGCCGGGGT
GCAGTGCTCCCACCGGGCTGTCCTGGAGGTTTCTGCAGCGTCCCTGACGAGCCGGAGGCACAGGTGCGCCCAGAGCTGACACCTTCGCCTCCCGTGAGCAGGCACATTCTGCTTTGCTGC
AGATAAAGAGGCTGGAGTCCCGGCTCAGCACCGGGGACTGCACGGACGCCGACGGGGAGCCTCACGCCAACGGCGCCAAGTGGAAGCGAGACGCCTGCTCAGTCTGCGAGTGCCGCGTGA
GTATGTGGCTCTGCCGGGGGACCCGGGGGCGTGGACTTCACTCCAAGGCAGGTGGCCCTGCTCGGAAGTGGGGGGCTCTTCCCCCAGGGCTCCGTTCAAGGTGGGCCTGCGCACCACTGC
CCCAGGGAGCCACACGGTGTTTGCACCCGCGAGGAGGGTGGGCCTGCCACTGGTGGGGAAAGTAGACGGAGGTGCCATGGTGGCCGCGGTGTCCAGGCCGGAGCTTCAGGGAAAGGGATG
TGTTTCCTGGTCCGGGGATGGGAAGGGGGCTCCAGGGTCCCTGGTGGTTGACCGGTTTGGGGATGGCAGAGCAGAGTGGGGACTGCGTGGTTCCCTGTGGTCTCTCCTACTTTGTCCTCC
TCCTGGTGGACATCTGGGACGTGATCCTAGGGTCCCAGGTGTGGGACCAGGGGGCTGTGCTGAGCCTTTGGTCCTGAGCTGTCTTCAGGGTGGGAGGACAGTTGGGGGGAGGGGTGGGAA
CCTTCTGGAAGAAGTGCAGGGTGTCTGCAGCAATTATCAGGGGGAGAATCAGCCGTCGATTGCAAACTGCACCAAAGACCGGCACACGGTGGGAAGGGCAGACAGGCAGGGGGGTGATGT
ATGGGCCGTGTACCCCAGGAACTGATGGGTCTTGGCGCCTCTCTCCTCCAGGACGGGCAGGTCACCTGCTTCGTGGAGGCCTGCCAGCCTGCCAATTGCCCAGCGCCCGTGAGAGCCCGT
GGGGCCTGCTGCCCGGTCTGCCCGAAAGATGGCACGGGGAAGAAGCCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTGTTCCTCGTCAAGCCCCTCGTCCTCTGCCCTCCGCCACGGGCACTGCTGTCCACGCTCACCGAGCAGCTCCGAGCTCTCGCCCCTTCTGTCCCCAAGCTGACCCTGGGCAAG
CTGGAGCAGGTCCGCAGCCTGTCTGCCATCTACCTGGAGAA
GGATCTTCGCTTTAACAGAATCAGAGAGATCCAGCCTGGAGCATTCAGGAAGCTGAGAAACTTGAACACGTTACTTCTC
AACAATAACCAGATCAAGAGCATACCCGGCGGAGCGTTTGAAGACCTGGAGAACTTAAAATATCT
CTATCTGTACAAGAATGAGATCCAGGCAATTGACAGGCAAGCATTTAAGGGACTT
GCCTCTCTAGAGCAACT
GTATCTGCACTTTAATCAGATAGAAACTCTGGACCCAGAGTCATTCCAACATTTGCCAAAGCTGGAAAGACTATTTTTACATAACAACCGAATCACACATTTG
GTTCCAGGAACATTCGATCACTTGGAATCCATGAAAAGACT
GCGACTGGACTCCAACGCACTTCACTGTGACTGTGAAATCCTGTGGCTGGCGGATCTGCTGAAAACCTACGCCCAGTCG
GGGAACGCGCAGGCGGCGGCCACCTGTGAATACCCGCGACACATCCAGGGACGCTCGGTGGCCACGATCAGCCCCGAAGAGCTGGACTGTG
AAAGGCCCCGGATCACCTCAGAGCCCCAG
GATGCGGACGTCACCTTGGGGAACACTGTGTTCTTCACGTGCAGAGCAGAAGGCAACCCCAAGCCCGAGATCATCTGGCTGCGAAATAA
CAATGAGCTGAGCATGAAGACAGATTCCCGC
CTCAACTTGCTGGATGACGGGACCTTGATGATCCAAAACACGCAGGAGACGGACCAGGGGATTTACCAGTGCATGGCCAAAAACGTGGCTGGGCAGGTGAAGACACAGGAGGTCACCCTC
AGGTACTTTGGGTCTCCAG
CTCGACCCGCTTTTGTAATCCAGCCACAGAACACGGAGGTGCTGGTCGGGGAGAGTGTCACGCTGGAGTGCAGCGCCACGGGCCACCCCCCGCCGCGGATC
ACCTGGACCAGAGGGGACCGCACGCCCCTGCCCGAGGACCCTCGCGTGAGCATCACCCCGTCTGGCGGCCTCTACATCCAGAACGTCCTGCAGGGCGACAGCGGAGAGTACACGTGCTTC
GCGTCCAACAGTGTGGAGAGCATCCACGCCACGGCCCTGATCATTGTCCAGG
CTCTTCCCCAATTCACCGTGACCCCTGCAGACAGAGCTGTTATCGAGGGTCAGACAGTCGATTTCCAG
TGTGAGGCCAAGGGCTACCCACAGCCGGTCATCGCGTGGACGAAAGGAG
GAAGCCAGCTGTCTGTGGACAGGCGGCACCTCGTGCTCTCGTCAGGAACGCTCCGGATCTCAGCTGTCGCG
CTGCACGACCAGGGCCAGTACGAGTGCCAGGCCGTCAACATCATCGGCTCCCAGAGGGCCGTGGCCCACCTGACCGTGCAGCCCAGAG
TCACGCCGGTGTTCGCCAGCATCCCAAGCGAC
ATGACGGTGGAGGTGGGCACCAACGTGCAGCTCCCCTGCAGCTCCCAGGGGGAGCCCGAGCCCGTCATCACCTGGAACAAG
GATGGGGTTCAGGTGACGGAAAGTGGGAAATTTCACATT
AGCCCCGAGGGGTTCCTGACCATCCATGACGTTGGGACTGCGGACGCAGGCCGCTACGAGTGTGTGGCCCGGAACACTATCGGGCAGGCCTCGGTCAGCATGGTGCTCAGCGTGAGCG
TT
CCTGACGTCAGTCGAAATGGGGACCCGTTTGTGGCCACGTCGATCGTCGAAGCGATTGCGACCGTGGACAGAGCCATCAACTCGACACGCACACACCTGTTCGACAG
CCGTCCCCGTTCT
CCCAACGACCTGCTGGCCTTGTTCCGGTACCCGCGGGACCCCTACACCGTGGAGCAGGCGCGCGCAGGAGAGATATTTGAGCGGACCTTGCAGCTGATACAGGAGCACGTGCAGCACGGC
CTGATGGTCGACCTCAACGGAACAA
GTTACCACTACAATGACCTCGTGTCTCCCCAGTACCTGAGCGTCATCGCCAACCTGTCGGGCTGCACGGCACACCGGCGCGTGAACAACTGCTCG
GACATGTGCTTCCACCAGAAGTACCGCACTCACGACGGCACCTGCAACAACCTGCAGCACCCCATGTGGGGCGCCTCGCTGACCGCCTTCGAGCGCTTGCTGAAAGCCGTGTATGAGAAC
GGGTTCAACACCCCGCGGGGCATCGACGCCGGCCGGCTGTACCACGGGCACGCGCTCCCCATGCCCCGGCTGGTGTCCACCTCCCTGATCGGCACGGAGACCATCACGCCCGACGCGCAG
TTCACCCACATGCTGATGCAGTGGGGCCAGTTCCTGGACCACGACCTGGACTCCACGGTGGTGGCCCTGAGCCAGGCCCGCTTCTCCGACGGCCAGCACTGCAGCTCCGTGTGCAGCAGC
GACCCCCCGTGCTTCTCGGTGGCCGTGCCGCCCAACGACCCCCGGGTCCGGAGCGGGGCACGTTGCATGTTCTTCGTGCGCTCCAGCCCCGTGTGCGGCAGCGGCATGACGTCCCTCCTC
ATGAACTCCGTGTACCCGCGGGAGCAGATCAATCAGCTCACCTCCTACATCGACGCCTCCAACGTCTATGGGAGCACGGAGCACGAGGCGCGTGCCATCCGGGACCTGGCCAGCCACCGG
GGGCTTCTGCGCCAGGGCATCGTGCAGCGGTCGGGGAAGCCGCTGCTGCCCTTCGCCGCTGGACCGCCCACGGAGTGCATGCGGGACGAGAACGAGAGCCCCATCCCCTGTTTCCTGGCG
GGGGACCACCGCGCCAATGAGCAGCTGGGCCTTACGAGCATGCACACGCTCTGGTTCCGCGAGCACAACCGCGTGGCCACCGAGCTGCTGGCGCTGAACCCACACTGGGACGGCGACACC
ATCTACCACGAGGCGAGGAAGCTCGTGGGCGCGCAGATGCAGCACATCACCTACCAGCACTGGCTGCCCAAGGTGCTGGGCGAGGTCGGCATGAAGGCGCTGGGCGAGTACCGCGGCTAC
GACCCGGGCGTCAACGCCGGCATCGTCAACGCCTTCGCCACGGCCGCCTTCAGGTTTGGCCACACGCTGATCAACCCCGTGCTCTACCGGCTGGATGAGAACTTCGAGCCCATCGCGCAG
GGACACGTCCCCCTGCACAAAGCCTTCTTCTCTCCCTTCCGCATTGTGAACGAGGGTGGCATCGACCCGCTGCTCAGGGGCCTGTTCGGCGTGGCGGGGAAGATGCGCGTGCCCTCCCAG
CTGCTCAACACGGAGCTCACGGAGCGGCTCTTCTCCATGGCGCACACGGTGGCCCTGGACCTGGCCGCCATCAACATCCAGCGTGGCCGGGACCACGGCATCCCGCCCTACCACGAATAC
CGCGTCTACTGCAACCTGTCGTCTGCCCACACCTTCGAGGACCTCAAGAATGAGATCAAGAACCCCGAGATCCGGGAGAAGCTGAGGCG
GTTGTACGGATCCCCACTCAACATCGACTTG
TTCCCCGCCCTCATGGTGGAAGACCTGGTCCCCGGCAGCCGACTGGGGCCCACGCTCATGTGCCTGCTGAGCACGCAGTTCAAACGCTTGAGAGATGGGGACAG
GTTGTGGTATGAAAAC
CCGGGGGTGTTCTCCCCGGCGCAGCTGACACAGATCAAGCAGACGTCCCTGGCCAGAATCCTGTGTGACAACGCCGACAACATCACGCGTGTGCAGAGGGACGTGTTCCGTGTGGTGGAG
TTCCCCCACGGGTATGGCAGCTGTGACGAAGTCCCCAGGGTGGACCTGCGCGTGTGGCAGGACTGCTGTGAAG
ACTGCAGGACCAGGGGACAGTTCAACATGTTTTCACACCACTTCCGA
GGCAGGCGGTCTCTGGGGTTCAGCTACCAGGAGGACGAGCACGCCGGGGAAGTGGGCTCCGGGGGGACACCGAG
CATCGGGAAACACAGAAAGCATCCGGGCAATGCCACGGCCCCCTCC
CGTGAGCGCCCACAAGTGCCAGGGACAAGTGACTTCAAGGACTTCGTTCTGGAAATGCAGAAGACCATCACAGACCTCAGAGAACAG
ATAAAGAGGCTGGAGTCCCGGCTCAGCACCGGG
GACTGCACGGACGCCGACGGGGAGCCTCACGCCAACGGCGCCAAGTGGAAGCGAGACGCCTGCTCAGTCTGCGAGTGCCGC
GACGGGCAGGTCACCTGCTTCGTGGAGGCCTGCCAGCCT
GCCAATTGCCCAGCGCCCGTGAGAGCCCGTGGGGCCTGCTGCCCGGTCTGCCCGAAAGATGGCACGGGGAAGAAGCCTTAG

Retrieve as FASTA