Entry information : BfPOX01 ( TPO-like)
Entry ID 7614
Creation 2010-09-22 (Marcel Zamocky)
Last sequence changes 2016-02-09 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-09 (Achraf Jemmat)
Peroxidase information: BfPOX01 ( TPO-like)
Name (synonym) BfPOX01 ( TPO-like)
Class Non mammalian vertebrate peroxidase    [Orthogroup: POX001]
Taxonomy Eukaryota Metazoa Chordata Branchiostomidae Branchiostoma
Organism Branchiostoma floridae (Florida lancelet) (Amphioxus)     [TaxId: 7739 ]
Cellular localisation N/D
Tissue type Testis
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BfPOX01
start..stop
S start..stop
BbePOX01 1111 0 9..644 124..761
CintPOX 694 0 30..786 114..879
HrPOX 673 0 33..745 131..838
SpurPxd01 642 0 18..643 690..1314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1172002..1172077 76 N° 2 1167217..1167518 302 N° 3 1166493..1166617 125 N° 4 1166202..1166304 103
N° 5 1165840..1165994 155 N° 6 1164794..1164905 112 N° 7 1164207..1164453 247 N° 8 1163285..1163415 131
N° 9 1162386..1162526 141 N° 10 1161797..1161944 148 N° 11 1161478..1161673 196 N° 12 1161037..1161239 203
N° 13 1160392..1160562 171 N° 14 1159792..1159917 126 N° 15 1158189..1158288 100 N° 16 1157462..1157618 157
N° 17 1156343..1156378 36  
complement(join(1156343..1156378,1157462..1157618,1158189..1158288,1159792..1159 917,1160392..1160562,1161037..1161239,1161478..1161673,1161797..1161944,1162386. .1162526,1163285..1163415,1164207..1164453,1164794..1164905,1165840..1165994,116 6202..1166304,1166493..1166617,1167217..1167518,1172002..1172077))


exon

Literature and cross-references BfPOX01 ( TPO-like)
Literature Putnam N.H., et al. (2008) The amphioxus genome and the evolution of the chordate karyotype. Nature 453:1064-1071
Protein ref. UniProtKB:   C3YBC9
DNA ref. GenBank:   GG666497.1 (1172077..1156343)
mRNA ref. GenBank:   XM_002606230
EST ref. GenBank:   BW706337 [5' end]
Protein sequence: BfPOX01 ( TPO-like)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   842 (823)
PWM (Da):   %s   92917.9 (91047.8) Transmb domain:   %s   o754-776i (o735-757i)
PI (pH):   %s   4.55 (4.53) Peptide Signal:   %s   cut: 20 range:20-842
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPTAILVLLASLVVVAHAHSDVLTNLPAISALISQQQLSTIASLSGCARSVTRVNCSSNCLSSKYRTIDGSCNNRENPLWGSSMTPFKRFLPPIYENQWNEPVGWNKTREYNGFTLPSVRHVSNLMTTPTNVADPDYTHMLTQFGQFLDHDTDLTATAVGRTMFTPMGTVTCGMTCDNIMPCFPIPIPDDDPRIDNERDACMPFTRSSAVCGTGETSTLFNTVIAREQINQITSFIDASNVYGSKFAFAQSLRDFSTDDGLLRVQEGEDISSGMASPFQNEAVTSCNDPNGGDIVPCFLAGDGRVNEVNTLIASHTIWVREHNRLARELKRINPHWDGEQIYQEARKIVGSEMQHITFTEYLPKILGQRGMDQMGEYAGYNPNVNPSTRNEFATAAFRFGHAAIGAFVRRFDNYQEAAIGNVALSDAFFSPWRVFRESGIDPVVRGLIGGFAKLVTPTDVLHEELSQNLFKLRNQIALDLASLNTQRGRDHGIPFYNDWRVFCNLTRAASFDDLSGEISNQDVRDTLADVYGDVNNIDLWPAAQLEDHEDGARVGPTFRCMLAEQFKALRDGDRFWFESDGVLTASQRTEIRQVTYARVICDTTGITRLPPDVFRLTDVADMVACEDIPGINLQFWEEIPDEPCGEPAEVEDAYVQKCGANFSDTHIYTCDPGYAMSGAAEIRCLGGRVDNPPPTCSDIDECARGDLNNCQEMCVNSVGSFMCACPDGFMLNDDGVSCSIDTSLSLGWIIAILFIVLFCLAMCAMVFVLVKGWHTHHQNQEIQRIKQLNAKPLDRNGVHNQSFISDKHDKKSLTGTSSGDSGVLEDLDSLPGVVS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (16 introns) and 1 EST. Strain="S238N-H82"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCCACGGCTATACTCGTTCTCCTGGCATCGCTGGTCGTCGTCGCGCATGCACATTCAGACGTCCTCACCAGTGAGTCTGATTCCTGTTTTATATGCAATGGATGTGATCTATAG
TTTGAAGCGTACTGCTGTGCTACGTACTGGTACGTTGGACTGTGAATAATGTAGGCATAGATCGCAAACACTTGTTCAAATGCTAATAAGCACTAATTCAAAACAAACTTTGATAAAAAC
ACGCCAATTACCATAGGAAAAGTACAAATTGAGGACAAATGTTTTATGCTGATAGTGATACGCTGTTTGATGATTTGGTAGTATGACTGTCTAAAAGGGTTAGTTGTGTGTATCGTTTGT
GACTTCTTCCCAAATGCCAAAACGCGCGCGTACGGTTCCAGCTGAAAATGTTAGAACACTTTTTTTGGTTTGGACGTTTTTCAATCGTGTTCTTGTTTTTCCTAACGAAAGTTGCGTTTT
TCAGGCCTAACCACAAAACTGAGTATGTTTTACTAGTCTGTTTTCGGCGTCGTTGAGACAGGAAATCCTATTCTTTATCAGATTTACAAGATTGGTCCTAATTGAAAAGGGCTACATATT
GTGTGATAAGACAGTCTGTATTTTTGCGACCCTGCATTATGAAAGGCCCTTTCTGTACTTAGATTCGACAATTTTCAATATCCAATGCATTTCTAAAACTTTTAATACTTCGTATTTTTA
AAACAAGTTAGCACTGCTCACCACCGGGCCTTGCCGGACAATATTTACGCCAAACCTGACATCATTTTTTAATGTACTTAAAAGTTCCGAAGAGCGAATGGTAAACGAAGCAGGAGCATT
CAATAAAGAGTGCAGAAAATTTTACGAAACAATTGGAGTACTGCAATGCGCCAGCCATTTTACGTTTAAACGAAAAAAATAGCAAATTGGCAACCCTGCTAAAAGTTGAAATCATTGTAT
GAAAGTTCAAACATAGCCAACACTAGTAGTTTAAGTATTGCCGATGAGTACATGAAACCAGCAAAACATTCTTTGACATGTAAATATGTGACTACCCCGATCCTTGCTATAAAAAGTCTT
CTTCTTCTCAAACAACTCACTGAAGGAGAAAAATCTCAAAATGATGTAGAGGCCACTCTAATCTTGTGGAAAAACTCAAGCACGTACCCTTTTGATAGAAAACTATCAAGATTTCGACAA
GAAAAAACAAGAACATATTTTTGTTCACGATACATGAATGTCTCTTTGACTCACGGTGACGATGCAGTTCCCAAGCGTTGATCATAATTTGCATAACCGTAGTGCAGTGACGCTAAAATT
TGCAACATCATGGTGAAATGGCAGTCTTACAATTGTCATAGCCTTGAACTGTGGTGATTTTGCACTTTTGCTAAAATCTCGAGCCATTGATGAGAAATCGCTATTTACATATTGGCATTT
TTCACCTTTTTTCATGGCCGTTCTTGTGGCTGATGAAGGAAGTAAACTTTTTGATCATTATGAAATCACGTCGATGAAGTTTAGACACCCAGCAAATAAGATTTATACATGCAAGCTTCT
CTCCCCCTCCGGCACTTTCCTTTCATTTTAAATTTTCTTTACTTGATTGTTGTTGTGCTTTATGTGCGAGATAAATAAACAAACAAGATACGCCAAATAGCAATTACTCCGGCATCTGCA
TATGATTTTGGAAAATGTCAATCAATGCGACTGACGAAAAATACTGGATGCTATCTGAAACGTCTTATCGTTTGCAAAATCATATCCAATCGCCTTTAGTACCTGCTATTTGGTGCACTA
AAAATGTTTTCAAAATTGTTTCCAAAACGTTTTATTTCAACATTTCCAATGTTTTGAACTTCAGAGTGGCAAGTTGCGGTTACTGTTTGAGCTTTGAAATTTCGAAATTCTGTCAGAATT
GTTCCCCAAAAAGTTTTATTCTAACATGTCCAAATTTGTATGTTTTCAACTTAAGAATAGCAAAAATTCGTTTCTGTTTGAGCGGACGATTAGATTTTGCAGAGGGTGTTACTGTGGTTT
TGAGATCGGCTATCTTGAAAAGAAGAAAAAAAGCTTTCCGTTTTTCAAAAACTTTTTTTCTACAATACCGTGACTCATCTTGCCTTTGATAACAACTTGCATCTCTTAACTGGTCTTCCA
AAATGATTTCTTCTAAAAAAAGTTCCAATCCCTAGACGGAGGCTATCCGAATTTTCTCGAAGGAGATCGCCATTGTTCTTGCTCACTGGTGCAAGACGAAGGCAGAAAAAACACATAGCG
CACTTGGACCCGCCTGAGTGAACGCGGCACTTCAACATGAATGTGCTCTCTGGACAGTATCCCTCTCTAGGTGTCTGTCAAACCATCAAAAAACACTTTCTCCGCGTCTGAAAGAAAAGT
TGTTTTTGAATGTCAGAAGAAAGTTTTCATTGCGTGGCACTTGGAGAGAAAGAAAGTCTCTAGTGGGGGACTTTTGAGGCGCTTCTGTGTTATGGAAGAGGTTTAAATAAAGATTTTAAT
CCTCCTTGGTGTTATGAGCTGCGGTTGCAGTATTTCATCGCAAGTGGGGCGTGAAGTGGGCTGGTAGGATGTGTCACTACTGGTGACGACCTGTGACGGGCTGACGCACGGTGATGCTCT
TGGGAAGAACAATAAACACAACAGCCTTACAATGAAGTCAAGATATGCAATCAATGTAAAATACTTTTATATCTATCAGTGTTAGATCGTCAATACTGTTCAAATGTTTGCATGCATACA
TGTTAAAGGAATCTTTTCACAATTTGTTTTGTTGTCTTTTCAGTCATAATTGTACGTTTGAAGTCAACATATGTAATAAATGTAAAATATCTATCACTGTTTGATGGTGATCACTGCTCC
AATGCTTGCATATATACTTCTTCTGTACCCCTTCCATACTGCAATTCTCTTGGCTTCTTGTTTACAAATAACGTCTTGGCAGGACAGTGATTTGGTGGGTGAAGAAGAATATAACCACCG
GTTCATTAATTCATTGATATACAATGTTTAGAATTACTCCAATTTCCTTCAATCAATGACTGTTTTGTAAAGGTATGGTACATACCTCCGAAATTTTAGATGTCTACCAGCACATCTTCG
TCACGGGGAATGACCTAGTCTCAATTCTCACGATAGAACACGAGAACCGGAATGAGGATTGGGAGCTGCCCGAGTTCTACCTACCCCTTCTCCTCAAGGAGGCGGGGGGAGGGGGCAGAT
GATCCACGCAAGCCTGACCTCGTCTCGTGTTCTCTCGCGAGAATTGAGACTAGCTCATTCCCCGTGACGAAGATTTGCTGGTAGACATCGAAAATTAAGTGTATTCATGCATGACTGATG
AACCTCTTTATCGATATACAATGTTTAATTTTCAATTTTCTCAGTGTCAGAAGAATCCCGGAATGACCCGGAAGAGCTTTACCCCGGGGACGCCTACGTCACTGCCTCCCTGCTTGAAGC
TGTGAACCGTGTAGACAGGGTCATCAACCACACCAAGAAGCTCCACGAGGATCCAGACAGGTTAACATTCCACGTCAAAATTACACATCAAAATGGCGACACACCTTCCCATAATACACC
ACTCCCTTGGGAAACAAAATGGCGGCGCCCGTGGATGGAAGTGAAACCAATATAAGTTTTGCTATTGCAAACCTTTGATGAATATCATCAAGCTGACCTAGGCGTCTATCAAGCTGAAAA
GCGGAAAGGGGGGCAAAGCGAATGCGCAAGTTGTAGAGTAATACAGTACCCGTATCCCATGACTTTGACTATATCGACAGGTGCTATCATTACCGTGGTCCTTAGTTACTATGATAAGAG
ACAGAGTGGCAGCATCCCAACAATCATACCTTGGATAGATTTCATACATATCCAGAATACAGAAGTGAAAGGAAATCCATGTCTACTCAAATACTGTTCTGTCGCGTTGTGCAAACATTT
GTTTTACGTTTTGGCGGATCAATAGATTTTGTTGTCTTTGAACGTGGAGTGTCTAGTGGTATACTTAGCGTTTCAACTTTAGTTTTTTATTTCAAGATTATATTTATTTGTTTTTGTTGT
GGTTATTTTCAGGGAGATGACGCCGTTTGACTTCTTGGACCTGTTTCGGCACATGCACCCGGATGCACAGCGCGAGGCCCGGGCAGCAGAGATTGTGGAGAATACCATTCAGCTGGTGGC
CGAGAAAGTCAAGGCTCATCATAGGAGCAAGAGGATGATCGAAGGCGAGATTCTCCTTACATATCCCGTACTTACATAACCAAATCATCAATATTTCTGAAAATGAAGAACGTTTTAAAT
TGGGCACAGTCGACATGCCTGGAAAATAGACGAAGGTAAAGTGTGAAAATAGAAAACAAAAGTATTGATACAGGGGTTCAAATAGAATCGTAGATGGGGTAAGATGCATATTCAATCATG
CAAAACCCTTCTTACATCTTGGCCCGTTTCTGTAACTATATCTGTCTGTGAAAAGGCGAAGTGGATAGACTGAAACTATGACAGAACATGACTTGTAACTTATTTCTTTTACCACACAGA
TCTTCCTGCCATCAGCGCACTGATCTCTCAGCAGCAGCTCAGCACCATCGCCTCCCTCTCCGGCTGCGCACGCTCCGTGACCCGGGTCAACTGTTCCTCCAACTGCCTCTCCAGCAAGTA
CCGCACCATCGACGGATCCTGCAATAATAGGGAGAATCCGCTGTGGGGCTCTTCAATGACGCCCTTTAAGCGTTTCCTGCCGCCGATCTACGAGAATCAGTGGAACGAGCCCGTGGGCTG
GAACAAGACTCGGGAGTATAACGGATTCACCCTGCCAAGCGTCCGCCATGTTTCCAACCAG
GTAGGTCTGAAACTTCACCAGTTATAGTCAACTTCATTCAGGTTGCTGAGTCATTTAAT
GCCGTTTTCGGTGAAGTCAATGATGAAAGGAGGCGAGGAAGTTCTAGACACGTTTGGAACTTCATTCATATTGCTGTAACGCCACCATGCGGAAAGGAGTAATGATGACAAGGTCATAAC
TAGCGAATGAAAGCAGGCTAAAGATCAGAAAGGAAATTGACTGCGGTTGCGTAAGAGCTTGTAAACTTACTTGTAAATTCTGACTATCTCGTTGAAGAAGACGTACAAGATCTAGACCTT
CTTTTGCCACGAATTCGAAAACTTCACCCAAAACAAAGCATCAGCCATTTTATCTAAGCAAAGCATCCGATTTTTTTTGCCACTATCCCTTGGGACATGATATTTGTACAACCTGGTGCA
ACGGTAGGAATACGAAATCACGTTTCTAGGCGGTCATTGATTGAATGGCAGCATAACATATGTGACAGAGATGCTCCAATACAAAAATTAGGTGTTATATCGTTTCGGTGTTGCAAAACG
CTGGTTGGCTGTCAGTTTGTCGTTATTGTTGTTCAACCGAAATTTTTGTTCTTCGTCCAGCTGATGACCACGCCGACAAATGTGGCAGATCCTGATTACACCCACATGTTGACTCAATTT
GGACAGTTCCTGGATCACGATACAGATCTAACCGCAACCGCTGTGGGGCGCACAATGTTCACACC
GTCAGTACAGTCCATCTGTCTACATTTTCAATATCTTTAGAATATCAAAACATTT
CATGATATGAACGGGTTCAGGATTTAGCTACAGAGGATAAACATCATTAGCACTGTAAAATCCAGACCCGTTATTTTCTTTTGGGTGTTGGTGAGTTGTAACCTACACCATGTTCGTCTC
TTCTTTTGTCTAGGATGGGGACGGTCACGTGTGGAATGACCTGTGACAACATCATGCCGTGTTTCCCCATCCCCATTCCTGATGACGACCCCCGCATAGACAACGAACGGGACAGGGTAT
GGGTTTCAATTTATCCAATTTGATTTGGTTTAAACAGTGTCGACAAGTGTCCATTGCCTATTAGAATATGACTACACGTCCGAGATAAGTTCGGAACTATATTCAGTCGGACAAAGTTGC
TTTGGAAAAAAGTTCATGTCTTCGATCTATCCTCTCCCAGTGATTTAGAGTATAGCATGTATTGATTTTCCTACCTTGTACAGGCCTGCATGCCGTTTACCCGCTCCAGTGCCGTGTGCG
GGACAGGAGAGACGTCCACTCTCTTCAACACCGTCATCGCCCGCGAACAGATCAACCAGATTACAAGTTTCATCGACGCCTCTAACGTCTACGGGTCAAAATTCGCTTTTGCACAGTC
GT
GAGTTTCCTTTTGTCTTACATCTTCAAAGAAACCACTGGCAAAGCAAACACTGTCAAAGTAACCAAAGCAAACACTGTCAAAGCAACCAAAGAAACCACTGTCGAATCAACCAAAACAAC
CACTGTCAAATTAAACAAAGCAACTACTGTCAAAGCAACTACTGTCAAAGCAACCAAAGCAACTACTGTTAAAGCAACTACTGTCAAAGCAGCCAAAGATACCACTGTCAAAGCAACCAA
AGCAAACACTGTCAAAGAAACCAAAGAAACCAATGTCAAAGCAACCAAAGAAACCAATGTCAAAGCAACCAAAACAACCACTATCAAAGCTTCGAGCGAGCCTTTGCAGGCTCTCCTTTT
TTCTGAGCGTTGAACGTTCGCTAGGGTGCCGACATTCTTCCAAAAACAAATCAAATCGTCTATAAGAATAACAATGATCCGTCTTCTTTGTCGTTTTAGCCCTCCCTGGTTCGAGGAGCT
CATACGTTTATTCTTTGTAGAGGTTATTACTTGTACCCAGTACTAATTATTTTTACACAGACTGCGAGACGTCACAGTGATGATACCTTCCATTTACAGGCTTGATTCCAAACGTCAACA
GTTTTTTGCGTCATTCCCGTCTTGCTAATTCCATGTCGCGGGTGTGCTTTTTTAAAGACCACTCTTGCTTTTTTTTACCAGACTGGTAGACTTTGCAGTTAAAACACAATGATAATAGCT
TCCATTTACAGTCATGATTTCAAACGTCAACGATCCTTACGACATCAAGATTATTTCCACTCCATTACTGTTAAACACACCTACTACAATGCAGCTGGACTTAAGACTACTGTATCTTTT
TAAATGTCAAAGTCCAAGACTTACCCGTCTTACTAAACTTACTTCGCCAGTGTGTTTTTTACAAACCATTCTTGTTTCTTTTGCTTCACCAGACTGCGAGATTTCAGCACCGACGACGGT
CTGCTGCGCGTTCAGGAAGGTGAAGACATCAGCTCAGGAATGGCCTCTCCTTTCCAGAACGAGGCGGTGACCTCCTGCAATCAG
GTCAGTGGGGACCAATCACAGTGTCCGGTGCATAAC
TTTCATCGTGGTCGTTCACTGTGATTTGATATTAGCAACCTTTGAAAAGGGACCACACATCGTAGTGATCTCGTACATATATTTTCCCCCAACACTGTTGTTACCTGGTAGATTACAAGC
CAATCACGTTGAGCTTTTGACTGTATAGGCAACGTGATTTGCCGGTAACATTCTTTCGAACAACAGCCGGGCGAGTATGATTGGCTGGGTTGTCGTTTCTTGTGTTATACAGAAGCAGTG
TATCCTGGCGACGATGGTCATACCCTGCAGTTTCTGATTGATACAAGTTTATCTTTTTCTAAAGGATCCAAACGGAGGGGATATCGTTCCATGCTTCCTTGCGGGCGACGGTCGGGTCAA
TGAGGTCAACACGCTGATCGCATCACACACCATCTGGGTCCGCGAGCACAACCGACTCGCCCGGGAGCTGAAGCGTATCAATCCGCACTGGGACGGAGAACAGATCTACCAGGAGGCCCG
TAAGATCGTCGGCTCGGAGATGCAGCACATCACCTTCACAGAGTATCTCCCTAAGATCCTTGGTCAAAGAG
GTAACACCGTTTTCAAAAATTGTTACCATAGAGTTGCCGTACGGAGTAA
GTATTACTGTCGTCCAGTGGCAGTTTAGCTGAAAGGACAGCATAACAGAATGCGTATGGATTTGAATAAGCAACTATTCATTCACCTGCACTATCATTTCGTACGCCTTATCTATTATAA
AGAGTTGATTAGATGTCACCTTATACCTTAATGAAATTGATGTTCCTCTTTTCTTATCTTCTTCTCACAATTCCACCTTCTGAACACTTGTGCTACAGCCGGTATCTTTCTTCCACAACC
AGGTGTCTTTGGACAACTGCGTTGTGGCCCTTAGCCTTGCATTGGCTTCGATAGAAAGTCTTAGATTGGATGAGCCAGAGGTAGGTCATCCTTCTTGCTCTTCCTTCTTGTCTCAAGCTT
ATTCTTTCTATTTTATAAAGCACACAAAGACCCTTAAATTTACCCCCGGGATGAATGCAATTTTGTTTACTTGCCCGGGGGGTTCTGAACTGGCAAGGTCTGCATAGGTAGCGCCGAGGC
GGGCCACACTATTGGTTATTTTATAAGCAAAAGTCGATGCATACTGAGCCTGGAAATTTATGGTATTGTAAACTTTTCAATGCATATATTGGCACTTCAAGGGTCCGAGTATGTCGTACT
TTAAAAGAGGAAAAGAACACACGTTGTCCTACAGTAACTAGGTGTTGCAATTGGTACTATTTGTGTATATGAATAGTTACAGTTGTCCAGATGTGCACTCAAAGACGCGCGTGGTACATT
TTTTTTTTAAAATCCGACTCAGGAATGGACCAGATGGGAGAATACGCCGGATACAACCCAAACGTGAACCCCTCTACCCGGAACGAGTTCGCGACTGCCGCCTTCAGGTTCGGCCACGCC
GCCATTGGCGCATTTGTCAGGCGTTTTGATGAG
GTAGGAATGACGTCATCACTATGAATTGAACGGTATTTTGACCGACCGACGGATTAGACAGATCAACTGACAAACAGCGACACAAAC
TCCGACTCTGCCATCTGCCAACGGACAGAAACGACGCCATCAATATGACGTCATCAATATGACTTGAACGGTATCTTGACCGACTGACAGACAGAATAGACAGTACAAATTAACTGAAAA
CAGCGACAACGAAATAAAACTCTGCTATCTGCCAATGAGACGGCAGCGAACGACAAACGGACGGAAATGACGTCACATTTGACCAGAACGGATGCTGTTTGTGCAAAGGTACCAAAGATC
AACAGGTGGTATCTAATGATCTTCAGGTAAGAAACGTACGCTAATGCAAATATTACTATCGTGGTCAAGAACAGAGACAAGTGACAGAAACAAGACTTATATTAATGCGAAATATGAGTT
ATTGTATGTTTCTTACTTGTGTCATTGAACACAATGTGCGAGGTGCGACTGAGAGAACGCCTAATTCCACTTATCAATTAAAACAATATGAGTTTTACAGAACGATACTCCTTTTGTTCG
CGTTTCAACTATCTTCAGACCAGATCCATCCACGCAATGTCTATATATACCGTCACTATAGCCCCTTTAAAGGAGTCACCCAACAACTTATCGAGATAAAACGAGACCCTTCAGAAGATA
TAGAAGATAAGACAATAAGAATTTCCGGTCCTTACTGTTGTTGATATTCAACTTGTTTTTTCTGCACCTAGAATTACCAAGAGGCCGCGATCGGGAACGTCGCCTTGAGTGACGCCTTCT
TCTCCCCATGGCGCGTCTTCCGGGAGAGCGGCATAGACCCTGTGGTCAGGGGGCTCATCGGGGGGTTTGCCAAACTGGTCACTCCTACAGAC
GTAATACCTTATTGTCTTCTTTTTACCC
CTCTGTGTACGCAAAACATTATTGTAGATGGGCGTTGTGGTGACATGAACCCAGAGCAACAAAGTTGTTCATTCTAGCAGCCACCCCGAAATAGAGGTCCCGAATATCTCTTTTCACTCA
CACAAGCTGTTAAGTGGAATGGAATACTATGTAGATACATTAGAAATGGAAATTGCTAAAAAAAATGCTTGCCATTTCAAACAATATGTTTGACGAATGTTCGGTCGTGTCCACTGACTT
CAGACAACTGTGAACTCATCTTGTATCATAGTTTTGTCTTGTCGCGAGAACCTATTGCTATGCCCTGAAGGCATTACTGACTGGAGCTTTACACGTAAACAACAAACATCAGTATATGGG
CATTGCTGTGAAGGTGAACGCGACATTTAGATTAAAGCCTGATTCCTTTGTAGGTATTGCACGAGGAACTGTCCCAGAACCTGTTCAAGCTGAGGAACCAGATTGCGCTGGATCTGGCCT
CTCTGAACACTCAGCGCGGCCGTGACCACGGCATCCCCTTCTACAACGACTGGAGAGTCTTCTGCAACCTCACTCGGGCAG
GTGAGCGACAGAGATGAACAATCTTGAGCATGAGCATGG
ATGTCTATGTAGTTCTGGTAGATTCTTTTCAGTTTCATTAACAGAGTGAGTACTAATCTTCTTTAAATCCAATGTCTGTTACAGCTTCCTTTGACGACCTGTCCGGTGAGATCTCCAACC
AGGACGTACGTGACACACTGGCTGACGTATATGGTGACGTCAACAACATTGACCTTTGGCCTGCGGCCCAGCTGGAGGATCACGAGGACGGCGCGAGAGTTGGGCCGACCTTCAGGTGCA
TGCTGGCGGAACAGTTCAAGGCACTCCGCGATGGGGACAG
GTAATGCAAATACAAACGTTCTATCATAGAGAATCTTATGTACGTGATAGCAGAACAAGGAGATGATATTAGAGACATGG
CACTGAGGTGTGACTGACCATAGGGTGGTTTCTTGTAGAAAATTTTCAATCTAAAGACAAATTTATAACATAAAATTTGAACTGTTTTTGTACCAAGCAACAGTCCAGGAAGAAATATGT
GAGACTTTGCATCTCGGACAATGATGCTGCATTTCTAGGTTTTGGTTCGAGAGTGATGGTGTCCTCACGGCGTCGCAGCGTACAGAAATCAGACAGGTGACGTACGCACGCGTCATCTGC
GACACCACCGGGATCACGCGGCTGCCGCCTGACGTGTTCCGGCTGACTGACGTGGCTGACATGGTGGCGTGTGAGGACATCCCCGGGATCAACCTGCAGTTCTGGGAGGAGATCCCTGCA
G
GTATGCGTTGATATAGTAAAAATGAACTAAAACTTTCAAAAATAACGTACGTTAACACTTTCTCTTTTGTGTATGTCAAATTAAGCTGTTATAGTTACCATAAAACCACCCCTGAGACG
TTGAAAGGCAAAAAAAGTGTTTTTTTACGAGATTGCCCAGAGCAAAGACGTCATTAGACCACTTCAAGGCGATGAACGAAGAAGTTGGAAATAATTGTACACGGAGATAGCGGGGGATAT
TTGTATTGAAGTCTGATAAGTTGTTAACAGGAGGGAAACAGTTGTCGTCGAGAGGGAAACATGTATAATGCTATTGGTCCTAAAGGCACTAGTATTCGGTTGCGCGGATTTACATAGTGC
TTATTGAATTGACGAATAACTAAGTGCATTCTAAGAAGTATAATTGCCAACCATTCGTATAGAAAGAATTGTATCGTTGTATCTAATGATTATACACAAATTGTTGACGTTGCAGACGAG
CCTTGTGGCGAGCCAGCGGAGGTAGAAGACGCGTACGTGCAGAAATGCGGCGCCAACTTCTCCGACACTCACATCTACACGTGCGACCCCGGGTACGCCATGTCTGGGGCTGCCGAGATC
CGCTGCCTCGGGGGAAGGGTGGACAACCCACCGCCAACATGCTCAG
GTAAGCCCAATGATGGTTTGTGATCTTTATCTATACTTATATTGTCATTGCGTTGCCATTTATTCCACCTGGCA
TTGAATCTTTCATGGCAACGACATGATGTGACATTATGTACTATCATGTATATATCTATGGCGAAGTGCCTCATTGTTCTGGAATTTGTATGTCATCGTCTGTTTTCTTTAATTGCAAGG
TGTCTATGGTATGTAATTAGCGCAGATGAACTGCCGTGCTATGCTTTACATTCATGTATCATTGGAATTTTATTTTTTATCTATAGGGGAAATGGAAACATATTCAATCTGTTTTTGCTC
TTCACCTGTTAGCTTGGTCTTGGATCTAGCTCAACCAGTATCTTTAATGCCATGTTGGTTCCATTAGGTCATCCCCATCGCTGATGCCATCCATAAAATCGAAACAACATCTGGCCAGAG
TTTTTTTTATGAATCTGTGATTTTGCAACCCTTCATCCAGATATCGACGAGTGCGCAAGGGGAGACTTGAACAACTGCCAAGAAATGTGCGTCAACTCAGTCGGGTCCTTCATGTGCGCA
TGCCCAGATGGCTTCATGCTGAATGACGATGGAGTGAGCTGTTCAA
GTAAGTGCTTACACACAAGAATGGAAGACTACAATATGTTTAACAATTCTCTTATTCGGTAAAGTCTCCTTATA
CTTTTCTTTTCACTGATTAAAGACAGCGGATGCTGTCTGAAACGTATCTTAATTTCCAGCAGTAAAGACTGATTTAACCTCTATCATAATATACGTCTCTTATAGGGGGCTATATGCAAT
ACCGGTGTGACAGCGATCTCGCCCCCCCAGCGATCTCGCCCCCCCGGGGGGCGAGATCACTAGCGTTTTCGCCCCCCCCCCCCGAACATTACTAGTATTCCTCGGAGGGGTCTTAAGAGC
AGCTGGTTACTACATATTAGGTGCGCTACCTGGCACTATACTGCACCTGGGAGTAACATAGTTGGTGTGTTACCTGGTACCTATATGGCACCTTATTACCGTAAGATGCATATGTCATAC
CTTGTTCGGTGCAAACACTACATTGAAAAGACAATTATTTTTGCAGCTGACATGGCAGAGGTGGCATAGAAAACAATGCTATTGTGAACGTATAAATCAACACCGTCTATGGTACGGAAT
ACGTCAGCTATATGTTTTCAATTTGTCACAGTATTTTCTTTCTTGTGCAGAAAACATTTCCAAAGCACTAAGAAAAACACAATTGAATAATAGTTTCTCATTATTAACACTATCTACGCA
CAAGTTCATATACCTGTTGCTAAATGCTACAAAAAACTGTTAAAGTACCAGTCTTAACAAACACGGGTAAAACACCAGTTCATAAATACTAGAAAAACAGTCATATTGGAGGTGAAGATA
TCCATAGGGTAGGTGCATATAACAAAATGTACCAGTTTCTATATACTAGAAAAACAGTCATATTGAAGGTGAAGATACACCTTGGCCAGGTGCATACACCAAAATGTGCATTATTCTAAT
GAATACATTATTTGCATAATCAATAAAGACATGACATAGTTCTTTTGTGGTCAATTCATAATAGAGACTTCATATTGAAGATATATAGGTTGCTTGAGGACAGGTGAATACAATTAAATA
TATCTCATGTCTAGACTCAGGTACATGCAATAAAGGGAATACAAGGGACCAAACCTCCTTGTCTGAAACAAGTTCAACTATCTTATTGCCATGTACATGTACTTACATTAATATTGATAC
TATGGATGGAGTTATGTATCAAACTCGTGTACTTATATCATTCTGAAACTGCATTGTGTGATTTATACCAATCAACTTCTAAAATATCATGTAAACCCGTTTTTTTGGGGGGGGGGGCGA
AATCGCTAAAGGGGGGCGAGGTAGGGGGGCGAGATCACTAGCCGGGGAGGGCGAGATCGCTAGTGATTTCGCCCCGGGGGGGCGAGATCGCTAGTGATTTCGCCCCCGGGGGGGCGAGAT
CACGGGGGGGCGAGAACGCAGTCACACCGGCATCTTCAGCGTTTTGCTTTCCATATTTTGTGAAAAGTTTTTCACAGTTTCTGATATCATAACGTGATGTTTCCAATAGTTGACACCTCC
CTGAGCCTGGGCTGGATCATCGCGATCCTGTTCATCGTGCTGTTCTGTCTGGCTATGTGTGCCATGGTGTTCGTCCTGGTCAAGGGATG
GTAAGTGCATTTCTAATCAAACGTTATAGGT
GAAGAATCTAATATTTGCCTAACTGAATTGATTAATTATTTAATACATTCCTTAATTACTCAAGTAAAGAAGATGCAAAAACGAAACTATGAAATTTGAAAAAAGATAGTCAACGAGGAA
AAGTGATTGGCAAAAAGTAATTGAAGATAAATTGACTGCAGCGGAAGGAGGTTGCCATCAATGAAGCTGTGGAACACATTGGTTGGTCATCAGCATATATTGCCATGCAGATTCTAGAAC
TGCAGCCAGCCAAACAGGTCCCGACTGGTGAAAAGGCCGGGATACTGTAAGGGCCCTATACACATAGTTTGAGTAGAGTGACTCCAATCCTGGCTCTGCCAGTAAGGACCAAGGGCAACC
CATTCCGTACTACGAAACATGTGTACCATGGAGTAGGGGCTCAAACTTAAAAGAACCACAAAGTGCTTCATTTAATGATCTTTGATTTGGAGATACAGTAGAGTGTCGGAAGACAACGAT
CTAGCCTGGTTATGATGAATTAATGGCTCTGATGTAGAATCCTATTATTCTGCCCACAGGCACACTCACCACCAGAACCAGGAGATCCAGCGCATCAAGCAGCTGAACGCCAAGCCTTTG
GACCGCAACGGCGTCCACAACCAGTCCTTCATCTCCGACAAGCACGACAAGAAGTCTCTGACCGGAACTTCCTCTGGAGACTCCGGCGTGTTGGAG
GTCAGTCTTTTTATCATTTTTCTT
TATTTCTGTCCTTTTTATCCAGGGTTGCCCTTCCAGTGCTTACCACTGCTTTACAGTGGGGCCATGCGTTACACAAACAAGTACTTTACATACAGTGACATACAAACAGAAAATTGATAT
ACGATAAGTAGAATGAATGAATGAATGAATAATAATGGTAATGAAAATATTGAAAACGATAACAATAATGATAACAAAATAAATGATTACAATGTTAGCAATTATAACAAAGCCTGATCC
ATGTCGTCATTGAGGGGTAAGAGGTCAAGCCATTTTTTGCATTTCATTTTATAAATAGACATGGACGTGCAAGTCTTTACAGACTGTGGTCAAACAAATATTGGTGACCCTTTACCATAC
CACCCCCACCCCCCTCGCCTACAAGTGACAACGTTAAACAACCACGCAGCCTTCGTCTAGAGCGTTCTTGACACTCTATAAAGTTCCAATATGGCTGAAGTCTGGTTTTTCAACATGGCA
AAACGGCAACAAACCTTACCTAGTACATATTTCCAAAGAAAAGACTATGTGTCTGATTTTTCTATCATGCTTGGTTATATCAATCTTATCGATAGTTTGTGTAATACAATACAAAATTTT
TTCATTCTTCACTTCATTTCTTTCTCACATGATATCATCTGCCGATGAAAAGTGCGTGAATGGACGACCCCCCGGAGTCCTGTTTCTACATGTAGTAGGTTGCCGTTGCTTTGGTGTTTT
CGTGGTGGTTGTTAACTGGTGCCTTAGTGTTGTCGTTGTTTGTTTAACAATCCTTGGGCACCCACACTGGAAGAAGGAAATAAATTCGTAATGTTGAGCTCAACACTACCCACCAACAAT
GCTCGTAAAAGTCCACATCAATGTACACAGCTACGGCCTCGGATCTCGGAAGTTAAGCAACGCGCGGTCCGGACAGTTCTTGGATGGGGTCCCGTGCTCGAGGAGGTGCATCGATCACGT
TAAACAGCCTCATTGCTCAACACATTGGGTACCTACTGGCTGGCAAAATACACCAGATGATAAATTTTTTTTTAATTTGAAAATTCTTTTCTTCTTCAGGAGGATCTGGACTCCCTGCCA
GGAGTCGTGAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCCACGGCTATACTCGTTCTCCTGGCATCGCTGGTCGTCGTCGCGCATGCACATTCAGACGTCCTCACCAATCTTCCTGCCATCAGCGCACTGATCTCTCAGCAGCAGCTCAGC
ACCATCGCCTCCCTCTCCGGCTGCGCACGCTCCGTGACCCGGGTCAACTGTTCCTCCAACTGCCTCTCCAGCAAGTACCGCACCATCGACGGATCCTGCAATAATAGGGAGAATCCGCTG
TGGGGCTCTTCAATGACGCCCTTTAAGCGTTTCCTGCCGCCGATCTACGAGAATCAGTGGAACGAGCCCGTGGGCTGGAACAAGACTCGGGAGTATAACGGATTCACCCTGCCAAGCGTC
CGCCATGTTTCCAACCAG
CTGATGACCACGCCGACAAATGTGGCAGATCCTGATTACACCCACATGTTGACTCAATTTGGACAGTTCCTGGATCACGATACAGATCTAACCGCAACCGCT
GTGGGGCGCACAATGTTCACACC
GATGGGGACGGTCACGTGTGGAATGACCTGTGACAACATCATGCCGTGTTTCCCCATCCCCATTCCTGATGACGACCCCCGCATAGACAACGAACGG
GACAGG
GCCTGCATGCCGTTTACCCGCTCCAGTGCCGTGTGCGGGACAGGAGAGACGTCCACTCTCTTCAACACCGTCATCGCCCGCGAACAGATCAACCAGATTACAAGTTTCATCGAC
GCCTCTAACGTCTACGGGTCAAAATTCGCTTTTGCACAGTC
ACTGCGAGATTTCAGCACCGACGACGGTCTGCTGCGCGTTCAGGAAGGTGAAGACATCAGCTCAGGAATGGCCTCTCCT
TTCCAGAACGAGGCGGTGACCTCCTGCAATCAG
GATCCAAACGGAGGGGATATCGTTCCATGCTTCCTTGCGGGCGACGGTCGGGTCAATGAGGTCAACACGCTGATCGCATCACACACC
ATCTGGGTCCGCGAGCACAACCGACTCGCCCGGGAGCTGAAGCGTATCAATCCGCACTGGGACGGAGAACAGATCTACCAGGAGGCCCGTAAGATCGTCGGCTCGGAGATGCAGCACATC
ACCTTCACAGAGTATCTCCCTAAGATCCTTGGTCAAAGAG
GAATGGACCAGATGGGAGAATACGCCGGATACAACCCAAACGTGAACCCCTCTACCCGGAACGAGTTCGCGACTGCCGCC
TTCAGGTTCGGCCACGCCGCCATTGGCGCATTTGTCAGGCGTTTTGATGAG
AATTACCAAGAGGCCGCGATCGGGAACGTCGCCTTGAGTGACGCCTTCTTCTCCCCATGGCGCGTCTTC
CGGGAGAGCGGCATAGACCCTGTGGTCAGGGGGCTCATCGGGGGGTTTGCCAAACTGGTCACTCCTACAGAC
GTATTGCACGAGGAACTGTCCCAGAACCTGTTCAAGCTGAGGAACCAG
ATTGCGCTGGATCTGGCCTCTCTGAACACTCAGCGCGGCCGTGACCACGGCATCCCCTTCTACAACGACTGGAGAGTCTTCTGCAACCTCACTCGGGCAG
CTTCCTTTGACGACCTGTCC
GGTGAGATCTCCAACCAGGACGTACGTGACACACTGGCTGACGTATATGGTGACGTCAACAACATTGACCTTTGGCCTGCGGCCCAGCTGGAGGATCACGAGGACGGCGCGAGAGTTGGG
CCGACCTTCAGGTGCATGCTGGCGGAACAGTTCAAGGCACTCCGCGATGGGGACAG
GTTTTGGTTCGAGAGTGATGGTGTCCTCACGGCGTCGCAGCGTACAGAAATCAGACAGGTGACG
TACGCACGCGTCATCTGCGACACCACCGGGATCACGCGGCTGCCGCCTGACGTGTTCCGGCTGACTGACGTGGCTGACATGGTGGCGTGTGAGGACATCCCCGGGATCAACCTGCAGTTC
TGGGAGGAGATCCCTGCAG
ACGAGCCTTGTGGCGAGCCAGCGGAGGTAGAAGACGCGTACGTGCAGAAATGCGGCGCCAACTTCTCCGACACTCACATCTACACGTGCGACCCCGGGTAC
GCCATGTCTGGGGCTGCCGAGATCCGCTGCCTCGGGGGAAGGGTGGACAACCCACCGCCAACATGCTCAG
ATATCGACGAGTGCGCAAGGGGAGACTTGAACAACTGCCAAGAAATGTGC
GTCAACTCAGTCGGGTCCTTCATGTGCGCATGCCCAGATGGCTTCATGCTGAATGACGATGGAGTGAGCTGTTCAA
TTGACACCTCCCTGAGCCTGGGCTGGATCATCGCGATCCTGTTC
ATCGTGCTGTTCTGTCTGGCTATGTGTGCCATGGTGTTCGTCCTGGTCAAGGGATG
GCACACTCACCACCAGAACCAGGAGATCCAGCGCATCAAGCAGCTGAACGCCAAGCCTTTGGAC
CGCAACGGCGTCCACAACCAGTCCTTCATCTCCGACAAGCACGACAAGAAGTCTCTGACCGGAACTTCCTCTGGAGACTCCGGCGTGTTGGAG
GAGGATCTGGACTCCCTGCCAGGAGTC
GTGAGCTAG

Retrieve as FASTA