Entry information : CrubPrx36 ( Carubv10019275m [1.0])
Entry ID 7639
Creation 2010-10-21 (Marcel Zamocky)
Last sequence changes 2015-10-27 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-02 (Achraf Jemmat)
Peroxidase information: CrubPrx36 ( Carubv10019275m [1.0])
Name (synonym) CrubPrx36 ( Carubv10019275m [1.0])
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Capsella
Organism Capsella rubella    [TaxId: 81985 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CrubPrx36
start..stop
S start..stop
CagraPrx19 689 0 1..332 5..336
CsativPrx36 630 0 1..331 8..337
AlyPrx36 627 0 1..332 10..341
AtPrx36 605 0 1..331 12..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..222 222 N° 2 326..517 192 N° 3 602..767 166 N° 4 990..1408 419
join(1..222,326..517,602..767,990..1408)


exon

Literature and cross-references CrubPrx36 ( Carubv10019275m [1.0])
Literature Schmutz,J. et al., Genome sequencing of Capsella rubella. Nat. Genet. (2013) In press
Protein ref. GenBank:   EOA25896.1 UniProtKB:   R0FTS4
DNA ref. GenBank:   NW_006238919.1 (9034072..9035479)
mRNA ref. GenBank:   XM_006292936.1
Protein sequence: CrubPrx36 ( Carubv10019275m [1.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (315)
PWM (Da):   %s   37163.01 (35183.0)  
PI (pH):   %s   4.74 (4.73) Peptide Signal:   %s   cut: 18 range:18-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVLARISLAALFPLCMCYRTHQSTGAGSLSPWFYDNSCPNAQAIVQSFVAKAYAIDPRMAASMLRLHFHDCFVNGCDASLLLDSSGTIESEKRSISNRDSARGFEVIDEIKFALENECPETVSCADILALVARDSIVICGGPTWEVYLGRRDAREASLSGSMENIPTPDSTLQTLVNMFNVQGLDLTDLVALLGSHTIGNSRCLNFRQRLYNHSGNNDPDQTLNQNYAYMLQQGCPISGEDQNLFNLDYVTPNKFDNYYFKNLVNFRGLLNSDEILFTQSSETMEMVKFYAENEEAFFEQFARSIVKMGNISPLTGTSGEIRRICRRVNHDF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTCTCGCTCGAATCTCACTTGCTGCGCTGTTTCCTCTTTGTATGTGTTATCGAACACATCAAAGCACGGGCGCGGGATCTCTCTCCCCTTGGTTTTACGACAACTCCTGTCCGAAC
GCACAAGCCATCGTTCAATCTTTCGTCGCCAAAGCATACGCCATTGACCCTCGCATGGCTGCCTCAATGCTTAGGCTCCATTTCCATGACTGTTTCGTCAAT
GTTTGACAAAATCTAAAC
TCTCTATTCTTCGAATATACAATGTTTGACATAAAGTTTAGGAGAAATGTTAAGTCCTAACATATACATACTTTGGTTGGCGCAGGGATGTGATGCTTCCCTCCTTTTGGACAGTAGTGG
AACCATAGAAAGCGAGAAACGATCAATTTCGAATCGAGACTCTGCTAGAGGTTTCGAAGTCATTGACGAGATCAAGTTTGCTTTGGAAAACGAATGTCCTGAAACAGTTTCTTGCGCTGA
TATCTTGGCTCTCGTTGCTAGAGACTCCATTGTAATT
GTAAGCCAGTCCTCCTAACATAGTCATTACAATTGTGCGTAATTAATTGTAACAAACACTCGGTAATATTGTAATTATATACA
GTGTGGTGGACCGACTTGGGAAGTATATCTTGGAAGAAGAGATGCAAGAGAAGCAAGCTTGAGTGGTTCCATGGAGAACATTCCTACTCCCGACTCCACGTTACAGACACTTGTTAACAT
GTTCAACGTTCAAGGACTCGATCTCACCGATCTTGTTGCCCTCTTAG
GTATATCATATTAAGTTTACATTTGTTCTTGAAGCCATTCATTTTAATAATTAAAGGAACGAATAAACGTTTT
AAACAACGATGTGTGATTGTGATTGGATGTTCAAGAAGTTAACTTAATTATCTCTAATAATTCTTCTTAAGATATAAAGTTTTAAGCTAATACATTAATAAAATTTACCTATCAATTCTA
AAACTAATAAGCATGGTTTCAAATGTAAGGGAGTCACACGATAGGAAATTCGAGGTGCTTAAATTTCCGACAAAGGTTATACAACCATTCTGGAAACAACGATCCCGACCAGACTTTGAA
CCAAAACTACGCATACATGTTGCAGCAGGGATGTCCGATTTCGGGCGAGGACCAAAACCTCTTTAATCTTGACTACGTGACGCCGAATAAGTTTGACAATTACTACTTCAAGAACTTGGT
GAACTTTAGAGGACTCTTAAACTCTGATGAGATTTTGTTCACGCAAAGCAGTGAAACCATGGAGATGGTCAAGTTCTACGCGGAGAATGAGGAAGCCTTCTTTGAGCAGTTCGCGAGGTC
GATTGTGAAGATGGGAAACATCTCACCGTTGACGGGGACTAGTGGTGAGATCCGGAGAATCTGCCGGAGGGTTAATCATGATTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTCTCGCTCGAATCTCACTTGCTGCGCTGTTTCCTCTTTGTATGTGTTATCGAACACATCAAAGCACGGGCGCGGGATCTCTCTCCCCTTGGTTTTACGACAACTCCTGTCCGAAC
GCACAAGCCATCGTTCAATCTTTCGTCGCCAAAGCATACGCCATTGACCCTCGCATGGCTGCCTCAATGCTTAGGCTCCATTTCCATGACTGTTTCGTCAAT
GGATGTGATGCTTCCCTC
CTTTTGGACAGTAGTGGAACCATAGAAAGCGAGAAACGATCAATTTCGAATCGAGACTCTGCTAGAGGTTTCGAAGTCATTGACGAGATCAAGTTTGCTTTGGAAAACGAATGTCCTGAA
ACAGTTTCTTGCGCTGATATCTTGGCTCTCGTTGCTAGAGACTCCATTGTAATT
TGTGGTGGACCGACTTGGGAAGTATATCTTGGAAGAAGAGATGCAAGAGAAGCAAGCTTGAGTGGT
TCCATGGAGAACATTCCTACTCCCGACTCCACGTTACAGACACTTGTTAACATGTTCAACGTTCAAGGACTCGATCTCACCGATCTTGTTGCCCTCTTAG
GGAGTCACACGATAGGAAAT
TCGAGGTGCTTAAATTTCCGACAAAGGTTATACAACCATTCTGGAAACAACGATCCCGACCAGACTTTGAACCAAAACTACGCATACATGTTGCAGCAGGGATGTCCGATTTCGGGCGAG
GACCAAAACCTCTTTAATCTTGACTACGTGACGCCGAATAAGTTTGACAATTACTACTTCAAGAACTTGGTGAACTTTAGAGGACTCTTAAACTCTGATGAGATTTTGTTCACGCAAAGC
AGTGAAACCATGGAGATGGTCAAGTTCTACGCGGAGAATGAGGAAGCCTTCTTTGAGCAGTTCGCGAGGTCGATTGTGAAGATGGGAAACATCTCACCGTTGACGGGGACTAGTGGTGAG
ATCCGGAGAATCTGCCGGAGGGTTAATCATGATTTTTGA

Retrieve as FASTA