Entry information : CflPxd01
Entry ID 7646
Creation 2010-10-21 (Marcel Zamocky)
Last sequence changes 2016-02-18 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-18 (Achraf Jemmat)
Peroxidase information: CflPxd01
Name CflPxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Arthropoda Insecta Formicidae Camponotus
Organism Camponotus floridanus (ant)    [TaxId: 104421 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CflPxd01
start..stop
S start..stop
AecPxd01 2258 0 7..1303 9..1305
AmelPxd01-1 1965 0 27..1301 28..1288
NviPxd01 1682 0 30..1245 27..1239
TcasPxd01 1139 0 252..1294 353..1385
TcasPxd01 377 4e-110 9..523 6..514
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13607..13788 182 N° 2 4614..5131 518 N° 3 2637..3444 808 N° 4 2133..2484 352
N° 5 1..2052 2052  
complement(join(1..2052,2133..2484,2637..3444,4614..5131,13607..13788))


exon

Literature and cross-references CflPxd01
Literature Bonasio R., Zhang G., Ye C., Mutti N.S., Fang X., Qin N., Donahue G. et al. (2010) Genomic comparison of the ants Camponotus floridanus and Harpegnathos saltator. Science 329:1068-1071.
Protein ref. UniProtKB:   Q9VZZ4
DNA ref. GenBank:   GL439108.1 (467313..481100)
Protein sequence: CflPxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1303 (1284)
PWM (Da):   %s   148204.1 (146091.8)  
PI (pH):   %s   7.56 (7.56) Peptide Signal:   %s   cut: 20 range:20-1303
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRPLVEVWVLLVPLLLVAADPSARTTNAECPPRCVCFTMHVRCMFQKLSQMPRVPANTTVLDLRFNSITEVRPGTFRGLDKLHTLLLNDNHIRRLVAGTFEGAPNLRVLYLYKNRIEHIAPGAFAGLPRLEQLYLHHNHLREIRPGTFNNLPALERLFLHSNKLHRLPADAFVNVGPMTRLRLDSNALVCDCNLVWLVERTRERPTEMAAICQSPHKMKGRSLTTMLPEDFHTKPRIVEGPEDTVVRFGETMTLTCRVTGDPTPKIKWMKNKWYSEADDDNSDKYEIHEDGEKYVIREDGSLVITDMTEQDSGVYECMASSDMGSTKSRKARAVITAASRLVFAEKPESQNVTVGTNVTFSCRVLNNGFSVKPNIRWLRDDLPILFGDRIFLENDDTKLRILAAKESDAGRYQCHLKSVDRSVVLFADLHVINFIAPRLVFKPQDMEAEPDAIVEVPCRAEGRPKPVIQWKKDGSALEGNRIKITRGGSLLIFNVTPQDTGRYECSAINDYGRATADALVRVRQSGATDTIIVRAFQSATEEIDRAINKTLSSLFNGDSSNHVHPFRLIRFPNAISRAAARPAELFERTLVNIRRMVDAGAKANITGEFRYEEILTREVKEIEQLSGCTGHRHRQNCTNRCFHRKYRTIDGSCNNLRHPTWGSSHTGFHRVLQPIYENGFSTPVGWEKERRYYGYPKPAARLVSTTLISTHDITSDHQITHMVMQWGQFLDHDLDHALPSVSSESWDGIDCKKSCDNAAPCFPMEVPPDDPRVNNRRCIDFIRTSAVCGSGSTSILWGERLTRREQLNQLTSYLDASQVYGYNDEVARDLRDLTTDHGLLREGPTIPGHKPLLPYASGQFVDCRRDPLESSINCFVAGDIRANEQVGLLAMHTIWLREHNRIARVLREMNPHWNGEKLYQEARRIVGAEMQHITYQHWLPRIFGSTIDDFLLSYRGYDSSIDASISNVFATAALRFGHSLIQPRLQRLNASFQSIPQGALNLRDAFFAPWRLVEEGGVDPLIRGMYATAAKLKRPEQNLNVELTEQLFRSAHAVALDLAAMNIQRGRDHGLPGYLEWRDYCNMSHVETFEHLAADISSARVRQKLRELYGHPGNIDVWVGGILEDQLPDAKVGPLFKCLLLEQFRRTRDGDRFWYQNPGLFRAEQLAQIQQVSLARILCDNGDNITRVQPDVFLLPEGRNDFVSCDEIPYVDLSAWSDCCDNCEDHDNTISRVRREAKKYLAPDHDYTKKVESLSRNEKVKYLENMLEKSDREATRLREQADDLLHRVKKLKSLLEDVKTR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGACCGCTCGTGGAGGTCTGGGTGCTGCTGGTCCCGCTGCTCCTGGTGGCGGCGGACCCCTCTGCGCGGACGACGAACGCGGAGTGCCCGCCGAGATGCGTGTGCTTCACGATGCAT
GTGCGATGCATGTTTCAAAAGCTGAGCCAGATGCCGCGGGTGCCTGCCAACACCACCGTTCT
GTGAGTTCTCCCTTTCTTTCCCCCTTTCGTTCTCTTCGCGGATCGATAAGCGTCTCTT
AATCGTCGCGACTCGAGGATCTTTTCATCGTTAGGTGATACCTTGTGCAATCGTGACGCAAGCGTTACACCTGTCACCGTAGCGATGAGATTTTTTTCTTGCGAGACAAAAATTGAAAAT
TGTTCTGTGTATCTTACGTCGAGTTTTTATCCAATGACTCTTGTTTTAGTAACTAATGAAGCGTTTCATTTAATAATCAGATATAATCACAATATTTTATAAATAGTTTTTAGTATGTGA
AAGTTTTATCATTTTACAGAAATTCATGATATGATCGTTGTTTGATAAACAGCGCAATTGTTGATAATATTACGGTAAAAGGTCAAGAGAAAGTATACTATACAGATGCGTATTCGCTTA
TGGGAAAGATACTAATCGAGACGTATAATCATCCCAGTTAAGATCGAGACTGACACAGCGCTTTCAACAGAGAATGCATTCGCTCTCTTCGAAGCATTCAACGAGAAAGATAACGTTGTA
TATTCCAATGGTGTAAACTCGTTTGAAGAATCTATTTGTATTATAAAATAATCGATAAAAGCGATCGATAAAAATAATAATTGTATCAATATCAATCTGTCTCCAACAATTACCTACAAT
TGAGATGCATCGTCAGAATAAAGTTGACTGCATTGATAAAAATGAATTATTATACTCAGATTTAGCTAAGGAAATCAAGTTATTGATTCGAGACGCAGTAGATTTACAAAAGGAAATAGA
AAATCGCGCTATTTAGAACTATATATAAGTTACGACTAGTAATACTAAAGTGGAACTTCGGCGAAAGGAATAAACGAGAATACAGTAAAGCATCTCGGGATCTCAATGCAAAACTAGAAA
TTTATTTAATCTGACATTCTTTAAGACTTGTAATTATAAGTAATAGTATATACCAAATTATTTTATGTATGTATAATATATATAAGCGTATATATAAGTACGTGTAATCCCATGATCGAT
TTTTCTCAATCAAAAAAATAATTTAAATATATATTATTTATATAATAAATAATATATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATGTTTACATATATTATATATTATATTATATATCGAAAAATATTGTTA
ATATTAACATACTTTATTAAATTTAAATGTTACCAATAATTAAAAATACATTACATAAAAATCGAAAGACAAAGTTTAATTGAGAGACCATATAAATGAAAAATGCAACAATTAAATACA
TTTTGAATCATCTATCATCTATCTATATATATAATATATATATCTATTTAGCTTTGCATTGCGAAGGACTGTTTCTTTCGTTTCAAAGAAACACGTACTACCAGCGTTATCAACGAACGT
GTCTTTCCGATGGAAGTAAAAACGATATATCGAACCAGCTTCATCGTGACAATCGTTCTCCTAGTTTGCGTGAAACACGCGAGTAATATTCTGAAAAATATTTAATATTAAATATTCAAT
ATTTAATATTTGAAAGAAAGCAAGATAACACGCGTGCTATCTCGAAACGGCCGACTATTTTATCATTTCACCCCGATTTAGCTCGAACTTCGATATCTGTCATTGATATCGCATCTATAA
ATTTGTTTTCGTTGGAAAAAAAGGAAAATAATACGGACGATAATCTCTACGAAGAATTCTTTATCATTTTTGTTGGAAGTTGTTGCGTAAAATCTCTCAGACAAAGACGGAGTAACATAA
TAAACGTCGGCGAATCAGCAATAAAAACGTGATTAAATCCCGTTTGTCCTAATGTGGTTTCGTAGCAATGCATCATGTCATCGTCATGTATCTGTCTCTTTTTCCTTCGATTTACATAAG
CAATTTAAAAATAGTATTGCTAACGAGCGTTGCTATTTAATTGTCTCAAAAATAAGATTACTTGTTTCTTTTACTTTAACAATTGCTATTATTTATTGCACAATTTTTCTCTTTCTCTTT
CTCTCTCTTTTTTCTCTATATCCTTTTTTCTTTATTTATATATTCTCTTGTTATTTAATTAATTTTAATTGGGTTTTTTTATTTGAATTAGTGTATTTTTTAAAACAAAATTGCACTTAA
TAAAGATTTTAACCATGACCTATTCTGTATTAGATAACACAGATCATTGTAGCCTTGGAACCGCATTGTGGAGTCACAAAGCCACAATGGGGATAAAATTCATTTAGGAATATAATTGCT
TGCATTTAATTTCTTTGTTTAAATAGTGTTTTTCTCTTGTTTTTCTCTTGTTTCGTTATTGTGATAAAAAATAATTTTAATTGCTATTGTAACACACACAATTTTAACTTTATTAATAAT
TCATATATTCGCATATAAAGATCCATTATACTTTTACAATTTTAATTTTTTAAAATAATTGACATAAATCTAAAAATAATAAATTTAAAAAGAATAATTGATACAATAATTTTTTTTAAT
ACGATGACTATCTCGAATTAATTTTTTCTAAAGTTGAATAGTGACAGCAAACATTTTGGATGTATTACTCGGGTTCGAGACGACTCTGATTAATTCTGTGATTATTGCTCGTGCGATGGT
GACGAAATTTTGTTGCAATAAAGAACAAGTAAACATATGACCCGCAGAGAGATTATAATACGTATATATTAAGACATGAGTCACATGCGCGAAAGTTCTCCGGCATAAAATCCTTTCTCC
TTGCATTGCGTTCTATGTTTAAATGCGCTCATAACTTATAATCCTGTCCGCTATTTCCGGTAACGATGAGTTACCCAACTCCAGTTCCCTAGTACACTATCAGGTTTTGTTTGGTAAATG
CGAATAAAGGATTCTCTAATGAACTGGATAAATGAATTTAATCTTGCCTTTGGCAATTTAATACCAAAGAGATTGCGAGAAAAGTTTATAAACTCGTATGATCACTGCTACAAGATACAA
AGAAACGCTGAGCATAGCGATGTCAAACGACGTGAGTCAAGTGTTATCGTAATTATATCTCTCGACAATGTGCAATAATTCTAAATGTAATTTTAATGAAACATCCAACTACAGAGTTTG
ACTTTTCATTCCCTTTATTATTTGTTTCTCCCTGGGAAATTTTATTTAATCCTCTCTTTTTCTATCTCTGATTTGCACAATAGAAAATTATGATTATCATAACAGTGCGTGTTTGATAGG
TTTTTCTAATATATCCGGTTTTACCGTTAAATCCTCGCTACGTGTATCGCGCTTTATGCTATAATTATCTGTTTGCGATTTTTTAAAATTACGGAGAAATAGACGGTCGTCCGTGCTCGG
TCAATAATTGATGGAATATTCATTATGGTCGAGTTGTGTCGAGCATCCTTAAGTATCCCGTCTTTCGGAATGTTAAGCGTCTCTTTGTTAATCATATATACTTGTCCGGTGCACGATATC
TCGATAATCACTGAGAAATCATCATTCGCGTTGCACGTCGCGCCATAATCTTTGATTACATGTTAATTATAGTGTGCATAAAAAATTGCGGCTGGAGGTTCCGTAAAGAAGGTCAGAAAT
TATGCATCTGTTTAAACCCTATCCGCGCTCTAACGTTCCATATTGATATATCACGCTATTGTATATAGTCAACTGAATTCGATTAAATACATAAACGCACAAGACATACGTCAGCGATTC
TCAATATTTTGAAATTTTTTTATTCTGTTAAAAAAATTTATAATAATGTACACGGTTCGTATTTTTGTACATGCTTATTTTGAATGATTCATGTACTTATTTTTATTTTAATAATGCAAA
TGAGTACATCAGTGTTACCTAAAATTTTTATGCTCCTATGAATCTACGAGGAGACTTTTGTAATATGCATGAAATAGAGAGGCGTATACACATCCAAGGATGTAGATTCCAGAATATATC
TGCTCCCTGAGAAAATGAAGAACCTTGAATTCTTAGAGATTTATGTTATACTTGAAAAAATCACGGAATTCTTATCAGGGAATTATATTGGAACTCGGAGGATTTTTTAAAAAACGAGTC
TCTCTTTAATAACTTTGTTCTTATATTATATAAGCAATCGGTAATTCAATTAGCTAAATTAGCCAATTAGTCAAATGATGTTTAATATATTTAAAATATTATATATTAAGAGCCAATTAG
CTAAATTATGTGTATACATTTAAAAAAAACATCAAGAGAATATAGAATATGCAGTATATATATTTTCATTATAATATTTAATGATAAAAAGGATAAAGTATTGTATAAAAGAAGATATTT
ATTTTAAAGCTATTCAGTTATTTTTTAATAATTTTTCAAAATTAGCACTTGAAATGGTCCCTTTGTATAAGTGAAAAGCATTAAAAAAGGAGCACAATAAGAAAATTTATTTTAGAAAAT
TCTTCCAAAAATCTCCAAGAAAATTCTCTTTGCCTTTTGAACAAAAAAACTTGAAAGATCAGGGAATTTTTTTACAAGATTTGAATAGACATCCCGAATTCGCGTCATATAAGGTGTTAG
ATTGTGTCATCGTTATAATTTTAAGTATTCGTGCATCTCGATAAATCGAATGGCGATGATTTCGAAAGGCTTGCGGTTAAGCTGGACGTGACCAAAAGAAGAAAAGAGAAACTGAATGCT
CTTTCCGAAACGTATTACATTTTCCACCCGCTATTAACGTCACTTAATTTGCACTTGCACGATTTGCCGTTATTAATACGAGCCTTTGATCGTACCGCATTAAATGAATGAATCGCTGAT
ATTTGTATGCATCAACACACACAAATCTCTATGGACAAAGAAAAATCGAAGTGGCAACACGCGATAGTTGGCTCTATAAATAGCAAAATACAGAAATGTATGTACATGTGAGAGATAGAA
AGACATAAACTGAACATTTCAATCTTTTTAGGACAAACTAGAGAGGGATGTATTTTTGTAATTCAGGAATTAATGGAGATACATTAATTTTTAATTACTGTATCTTATACATTAATATTC
TCCCTTTTAAAACAATAATTAAATATGTCTCTTGATATAAATATGTTTGTCGATAATTTTAGATTTTTCTATTTCCTTTTGGATAAAGATATATACACGGTCCGACAATTTTCCATCCAG
ACTTTAAATCTCCCGCCTAAATGCGTGGCACTATCTGTCGGAACTATATATCGTTAGAAAGGTGGAAATGTCTTCTGTATGTTAAGCGAAGTTTGAACGCTGTGTCATGTAAGATGATTG
AATTATGACATTTCACGTGACAGCCCAAAAAAATTGTGTCGGAAAATTATAATGGAACAACGCAGTGTCATAAAATTCCATGCTAAATCAGGCATAAATGCCACAAAAACATTCGAATCG
ATGAAAAAAGTCTACGGCGATGAGTGTTTATCCCGAACAACAGTTTTCGATTGGCATAAACGTTTTCGCGAAGGTCGCGAATCACTCGAAGACGATGAACGAGAGCCGAGGTTTCGCAAC
GCCGATACAATCAAAAAAGTTGCCGATTACCTAGCCGACGATGAGAATGCAAGTATCAGGATGATTTCTGAGGACTTGCACATCAACCGAGAAACAATCCGCCTAATTATTATGGAGGAT
TTGGGCAAAAGAAAGGTCAGTGCTCGATTTGTTCCACACCATTTAACAGATGATCAAAAATTAAAGTTCGGCTCTCGTTCATCGTCTTCGAGTGATTCGCGACCTTCGCGAAAACGTTTA
TGCCAATCGAAAACTGTTGTTCGGGATAAACACTCATCGCCGTAGACTTTTTTCATCGATTCGAATGTTTTTGTGGCATTTATGCCTGATTTAGCATGGAATTTTATGACACTGCGTTGT
TCCATTATAATTTTCCGACACAATTTTTTTGGGCTGTCACGTGAAATGTCATAATTCAGTCATCTTACATGGCACAGCGTTCAAACTTCGCTTGACATATAAAAGACATTTCCATCTTTC
TAACGATATACAGGGCGTTCCATTTTAAAAGTTCCACCCTCATAACTTTTTTAATTTTGATTGTAGAAAAAATTATTTCATATAAAAGTTATATGGCTTGAAGGGGAACATAAGATGGTG
TCATTAGTTTGACATTGAAGAGTCACACCTGAAAGTCACGTGAAGGTGACATCCAACTTTTGAAATGGGACACCTTATATGCTTTTGCATGTTTTTATAGTTCATCTCGAAAACTTTCCA
AAACACTATAATTAAGTTAGTTTTCATTAAGTATTTTCCGAGTTATGAGACTTGAAATCATTCCTTAATTTTACATACACCATAATATATCTAGTAAAATATTCATTTTTCGATTATCTT
GTCTTAATACTTTTATGTACAAAATAATGAGAGGAATTAATTGGTGTAAAGAAAACTCGTAGTTATTTTTAAGAAAAAATATGTAATTTGCAATTAACAATTACATATTTTTTTCTTCGA
AACAGTTTTAAAGTCTGGGTGGAAAATTGTCGAACCGTGTAGGTAGGAACTTAATACTACAAATTTCTCTGTCAAAATTAATACGACATTTTATTGAAGCTGTTTCTAAGGTGTTTAATT
ACCGTGAGAAGTAATTATGTCATCATGAGGAGTAATTTTTCGTTGAGGAAATGGGGGAACTAAAATTACTTTCTTTGATATGAAACGACGCTACACATTTATTGACGTCGATTGGCACTG
CAATTTGCTAACACGTCTGATAAATGAAGGTTCCATTAAAAATTTAGATAAAACGGAATGTTTACATTAATTGCCATATGATCGACATTAGTTGAACAGTAATGCTTGTGTAATTTGAAT
GAAAAAGCGCAAGAGTATCGCATATGGTGAGCAATTTACGCTAGTTAAACGTCGGGAGCCTCTTCCACTTTTCTCGCGGCACGCGTGCGATTCGCTGGCACGATAAGAAATAGCGAGAAT
TGAAATAGCGGGTCGAGCGCGGGAACTCGAGGCCATAATTTAGAAAAGACGGACCGAATAAAATTGTTAATTAAGAGCCTAATATAACGGACTATCCTTGTTACGGCGAGCCCCCGTAAT
AATTAAGTATCGCGCTCGATGAATTTCCGAATCGTTGATTCATGCGTATCTGAATCTCGCGATCAGATTGACCCGCACTCGATTTCCTTATCGGCATTTTATATCATCTACTCTTATGTT
GAATTATCTTTTCAAGTGCCGTTAATTAGGCATATCTTAATTCAGATTTTAATGACCTTTATCACAAAGCAGGTTCGAGATTTTGAGTTCCGCTAATCTAATCATTTATGACTCGGCTTG
AGTATTCGCCGTAATTAATATACCGTTTATCTATCGAGAAAAATAACGACTGTGCTATTTATCCCCGATCTATACTCGAGAAAAGCATTCACACTGATCGCCCATTCTACTTGTTGGCGG
GTGGGCGGTTAGCGGGTTCACAATTACGGTATTCTCGCCCATGCAAAAAAATTCTATTTGAATCTATCTATATCTCACACTTAACGCAGAATGCGGTCATCTAAGCGAAACCGCCTGATT
CTAAATCCGAGATAATATTGCACACAGTTTTCATATGTAATTGTACAATGTAATCTAATCATTAGAATCGATCGAGTTTATTCTATTTTTATTTCAAATCCTGATAATTCTTCGATAGCA
CACAAAGGCCTTTTTTTCTCTCTTCTAACGTGAAAAACAATATTGTAATAATATTATGTATCATCAATAATATTATAATAATATTACACATTATTTTAGATTATATTAATATAATGTAAA
ATTAATATAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATATATATATATATATATCATTTTTTTGCAAAATACGAGTCGCGTAATCTTTTTTTTCTTATGAA
TCGGAATCTTTTTGCAGAGATCTCCGATTCAACAGCATCACGGAGGTGCGGCCGGGGACGTTTCGCGGTCTCGACAAGCTGCACACCCTGCTGCTGAACGACAACCATATTCGACGGCTG
GTCGCGGGCACGTTCGAGGGCGCGCCAAATCTACGGGTACTCTACTTGTACAAAAATCGAATCGAGCACATCGCCCCGGGCGCGTTCGCGGGGCTGCCGCGGCTCGAGCAGCTGTATCTG
CATCACAACCACCTGCGGGAGATACGCCCCGGCACGTTCAACAATCTGCCGGCGTTGGAGCGTCTATTCCTGCACAGCAACAAGCTGCATCGGCTGCCGGCCGACGCGTTCGTCAACGTC
GGTCCCATGACACGGCTGCGTCTTGACAGTAACGCGCTCGTCTGCGACTGCAATCTGGTCTGGCTGGTGGAGCGCACCCGAGAGAGGCCTACGGAGATGGCGGCGATTTGTCAGTCCCCA
CATAAGATGAAGGGTCGCTCCCTCACGACGATGTTGCCCGAGGACTTTCATTGCA
GTTGAGTAAAATTGTAGGGTATTTATTTCCTGAAAGAACAAGGAAAACTTGGAATTCTCAGGGAT
TTCTTTTGTACCGGAAAAATGAGGGAATTCTCATGGAATTTTATTGAGGAGTTTTATTGAGGATTTTTAAGAACAAATTTTCGCTGATCATTTTACTCTCATATAGTAAACAGTCGACAA
TATATCGTAATTTTTAGTACTAAAAAAATTAAAATTTTATGCAAATGACAAATGCTTATCTTACGAAAGTTATAACTTTCACTACATTTATAAATCTAGTACTTAAAACTTAAAAGGTTC
TGTATTTTCCCTACGAATAAAAAAATAGTAATAAATGCAATAAAAAAATTTATTTTAAAAAGCACTAAAAAGTCTAAATATTCTTTTTACTGGAATTTTGAACAAAAATATCTGGGAAGA
TCAGAGAATTTTCATAAGATTTGAGTAGACATAGAATGAGGCTCTCTTCCTACTGCTAGTTTTCACTTACAAATTTTCTGTATTATGCCTTACCATACACGTCTCATAGGATTTCAATAT
TACCGCTGCTGTAAGCTGTTAGCTTAACGATTATGTTGTCACGGTCATTGACATCATTGTGATCGCATGCTGATGATGCAGGGATAACATCGCGTGATCAACGCTAGGATGATTCGCGGT
GTCTGTCACGTGATCCTTCATCGAAAAATTAAATCGATACTTCTATTCAAATTCAGTTATCGCCGACTAATTTTAAAACTAGACTTCATTTTCATCAAATCGATGGATGGCCGCACGAGT
CCGAAACTACATTAGCATATATTTTTTGTAGGTTTCTTACAAAAAGAAATAATTATATGTGTAGCTGCTACATATTATGTAAGAATTGAAGGATAATTTTCTCGCGTGTATCTTGTAATT
TTTTCAGAGAATATTTGTTATAACAGTAATTATAATAATCATACATTTATCTTTAAAATATTAGAGATTCGGATTTTATTTATCTGTATCTTTTTCTAATTATTTTTTGAGTTTTTTCAC
GATGACGTGGATAATATTAACTAATATTAAGAATAACAGCGAATAAAGAAACGAAAATATTACGAATAAAATATCAATATCACGTTAATTTATCTATTTAACCCATTTTTAATTGTCAAC
AATAAGAAAGAATTCTTTTTATAGCAAAACCACGTATAGTAGAAGGACCCGAAGATACCGTGGTGCGATTTGGCGAGACGATGACATTGACGTGCCGAGTAACGGGCGATCCGACGCCGA
AAATCAAATGGATGAAGAATAAATGGTACTCGGAAGCGGACGATGATAACAGCGACAAGTACGAAATCCACGAAGACGGCGAGAAGTACGTAATTCGCGAGGATGGCAGTCTGGTGATCA
CCGACATGACTGAGCAGGACAGCGGGGTATACGAATGCATGGCCAGTAGTGATATGGGCTCGACCAAGTCCAGGAAGGCGAGGGCGGTGATCACGGCAGCGTCCCGTTTGGTATTCGCCG
AGAAGCCAGAATCGCAAAACGTGACCGTTGGCACCAACGTGACCTTCTCTTGTCGAGTACTGAACAATGGGTTCAGTGTCAAGCCCAATATTCGTTGGCTTCGAGACGACCTACCGATCT
TGTTCGGTGACAGAATCTTCCTCGAGAACGATGATACCAAGTTGCGTATCCTCGCGGCTAAGGAATCTGACGCTGGCAGATATCAGTGTCATCTTAAAAGCGTCGACAGAAGCGTAGTCC
TCTTCGCGGATCTGCACGTCATCAACTTCATCGCGCCCCGATTGGTCTTCAAGCCGCAGGACATGGAAGCGGAACCGGATGCTATAGTCGAGGTACCATGCCGGGCCGAGGGCAGACCAA
AGCCGGTGATACAATGGAAAAAGGATGGTAGTGCTCTTGAGGGCAATAGAATTAAGATCACTCGTGGCGGGAGTCTCCTCATTTTCAACGTGACTCCACAGGACACCGGCAG
GTAAGACT
GGAGTAATGTAAGCTTGATTAATAATTCCTAGTAATCAGTCTCAGAAGCCTGACTTGCAAATCTACATAAATGATAAAAATGGATATTAGATCGCATTCCTTCATTAAAAGTCTTCTGTA
TAATAATTATACAATTTTTTACAGATATGAGTGTTCAGCAATAAACGATTATGGCCGCGCAACCGCCGATGCTCTAGTACGCGTTCGGCAATCAGGTGCAACGGATACAATTATCGTACG
AGCTTTTCAAAGTGCCACCGAGGAGATCGATCGTGCCATCAATAAGACGCTATCATCCTTATTCAATGGTGACTCATCTAACCATGTTCATCCATTCCGGTTAATACGATTCCCGAATGC
CATCAGTCGCGCGGCTGCCAGACCTGCTGAACTTTTCGAGAGGACTCTCGTCAATATTCGACGTATGGTGGACGCCGGCGCTAAAGCGAACATAACCGGTGAATTTCGTTACGAGGAGAT
CCTGACGCGCGAACAG
GTAAAAACAAATAGATAAGATCTTGTGCATCAAATCACAGTCTTTAATCAGGAATCTAAGATTTCATTCCCATTGTCAAGGTCAAAGAAATTGAACAGTTATCC
GGATGCACCGGTCATAGACATCGGCAAAATTGCACCAACAGGTGCTTTCACCGCAAATACCGCACCATAGACGGCAGTTGCAACAATCTGCGTCATCCTACTTGGGGCTCATCGCATACA
GGATTCCATCGAGTATTGCAGCCCATCTATGAGAACGGTTTCTCGACGCCGGTCGGTTGGGAGAAGGAACGACGATACTACGGTTATCCGAAACCAGCTGCGCGTCTCGTGTCGACCACG
TTGATATCTACGCATGACATTACATCCGATCATCAGATTACCCACATGGTGATGCAGTGGGGCCAATTCCTGGATCATGATCTCGACCACGCGTTGCCATCAGTATCGAGTGAATCCTGG
GACGGAATTGATTGTAAGAAGTCATGCGATAACGCAGCACCTTGTTTCCCGATGGAGGTACCGCCGGATGATCCGCGGGTTAACAATAGACGGTGCATCGACTTCATAAGAACCAGCGCC
GTGTGCGGATCAGGCTCGACCAGCATCTTATGGGGTGAGAGACTGACACGGCGAGAACAGTTAAATCAGTTGACTAGCTACCTCGACGCATCGCAAGTCTACGGTTACAATGATGAAGTG
GCGCGCGACCTACGTGATCTCACAACGGATCACGGATTGCTACGGGAGGGTCCTACGATCCCTGGTCATAAGCCTTTACTGCCGTACGCGTCCGGACAATTCGTCGATTGTCGTAGAGAT
CCGCTGGAGAGCTCGATCAATTGCTTCGTCGCTGGTGATATTCGCGCAAACGAGCAAGTTGGCCTGTTAGCTATGCATACCATATGGTTGCGCGAGCACAACCGCATCGCTCGCGTGTTA
CGCGAAATGAATCCGCATTGGAACGGCGAGAAACTGTACCAGGAGGCCAGACGTATCGTTGGCGCCGAGATGCAGCATATTACTTATCAGCACTGGTTACCGCGGATATTCGGTTCAACA
ATTGACGATTTTTTATTATCTTACCGCGGTTATGATTCCAGTATCGACGCTAGTATATCCAACGTCTTCGCTACCGCCGCTCTACGTTTCGGTCATTCGCTTATTCAGCCGCGCCTACAG
CGTCTAAACGCCTCGTTCCAATCGATTCCTCAAGGTGCTCTCAATCTACGTGATGCCTTCTTCGCGCCCTGGCGGCTAGTGGAGGAAGGTGGGGTCGATCCCCTAATCCGCGGTATGTAT
GCTACCGCAGCGAAGTTGAAGCGGCCCGAACAAAATCTCAACGTCGAGCTCACCGAGCAGCTGTTCCGTAGCGCGCACGCGGTCGCATTGGACCTGGCAGCGATGAATATTCAGCGGGGA
CGGGATCATGGACTACCCGGTTACCTGGAGTGGCGCGATTACTGCAACATGTCGCATGTGGAGACGTTCGAGCATCTGGCCGCCGACATTAGCAGCGCTCGAGTGCGGCAAAAGCTGCGC
GAATTGTACGGCCATCCGGGTAATATAGACGTCTGGGTCGGTGGTATTCTAGAGGATCAATTGCCAGATGCGAAAGTCGGACCGTTATTTAAGTGTCTTTTGCTGGAACAATTCAGACGT
ACTCGAGATGGCGATCGGTTCTGGTACCAGAATCCCGGACTCTTCCGCGCGGAGCAACTTGCGCAGATCCAGCAAGTGTCGCTCGCCAGAATCCTATGCGACAACGGCGATAACATCACT
CGCGTGCAACCCGACGTGTTCCTGCTGCCCGAGGGCCGCAATGACTTCGTCAGCTGCGACGAGATTCCCTACGTGGATCTAAGCGCATGGTCCGATTGCTGCGACAACTGCGAGGATCAC
GACAATACTATTTCTCGCGTACGCAGAGAGGCTAAAAAATATCTTGCGCCTGATCACGACTATACAAAAAAAGTAGAATCGTTGAGCCGTAATGAAAAGGTGAAATACCTGGAGAACATG
TTGGAAAAAAGCGATCGAGAGGCTACGAGATTACGAGAGCAGGCCGATGACTTATTGCACAGAGTAAAAAAGCTTAAGTCATTATTAGAAGACGTCAAAACACGATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGACCGCTCGTGGAGGTCTGGGTGCTGCTGGTCCCGCTGCTCCTGGTGGCGGCGGACCCCTCTGCGCGGACGACGAACGCGGAGTGCCCGCCGAGATGCGTGTGCTTCACGATGCAT
GTGCGATGCATGTTTCAAAAGCTGAGCCAGATGCCGCGGGTGCCTGCCAACACCACCGTTCT
AGATCTCCGATTCAACAGCATCACGGAGGTGCGGCCGGGGACGTTTCGCGGTCTCGAC
AAGCTGCACACCCTGCTGCTGAACGACAACCATATTCGACGGCTGGTCGCGGGCACGTTCGAGGGCGCGCCAAATCTACGGGTACTCTACTTGTACAAAAATCGAATCGAGCACATCGCC
CCGGGCGCGTTCGCGGGGCTGCCGCGGCTCGAGCAGCTGTATCTGCATCACAACCACCTGCGGGAGATACGCCCCGGCACGTTCAACAATCTGCCGGCGTTGGAGCGTCTATTCCTGCAC
AGCAACAAGCTGCATCGGCTGCCGGCCGACGCGTTCGTCAACGTCGGTCCCATGACACGGCTGCGTCTTGACAGTAACGCGCTCGTCTGCGACTGCAATCTGGTCTGGCTGGTGGAGCGC
ACCCGAGAGAGGCCTACGGAGATGGCGGCGATTTGTCAGTCCCCACATAAGATGAAGGGTCGCTCCCTCACGACGATGTTGCCCGAGGACTTTCATTGCA
CAAAACCACGTATAGTAGAA
GGACCCGAAGATACCGTGGTGCGATTTGGCGAGACGATGACATTGACGTGCCGAGTAACGGGCGATCCGACGCCGAAAATCAAATGGATGAAGAATAAATGGTACTCGGAAGCGGACGAT
GATAACAGCGACAAGTACGAAATCCACGAAGACGGCGAGAAGTACGTAATTCGCGAGGATGGCAGTCTGGTGATCACCGACATGACTGAGCAGGACAGCGGGGTATACGAATGCATGGCC
AGTAGTGATATGGGCTCGACCAAGTCCAGGAAGGCGAGGGCGGTGATCACGGCAGCGTCCCGTTTGGTATTCGCCGAGAAGCCAGAATCGCAAAACGTGACCGTTGGCACCAACGTGACC
TTCTCTTGTCGAGTACTGAACAATGGGTTCAGTGTCAAGCCCAATATTCGTTGGCTTCGAGACGACCTACCGATCTTGTTCGGTGACAGAATCTTCCTCGAGAACGATGATACCAAGTTG
CGTATCCTCGCGGCTAAGGAATCTGACGCTGGCAGATATCAGTGTCATCTTAAAAGCGTCGACAGAAGCGTAGTCCTCTTCGCGGATCTGCACGTCATCAACTTCATCGCGCCCCGATTG
GTCTTCAAGCCGCAGGACATGGAAGCGGAACCGGATGCTATAGTCGAGGTACCATGCCGGGCCGAGGGCAGACCAAAGCCGGTGATACAATGGAAAAAGGATGGTAGTGCTCTTGAGGGC
AATAGAATTAAGATCACTCGTGGCGGGAGTCTCCTCATTTTCAACGTGACTCCACAGGACACCGGCAG
ATATGAGTGTTCAGCAATAAACGATTATGGCCGCGCAACCGCCGATGCTCTA
GTACGCGTTCGGCAATCAGGTGCAACGGATACAATTATCGTACGAGCTTTTCAAAGTGCCACCGAGGAGATCGATCGTGCCATCAATAAGACGCTATCATCCTTATTCAATGGTGACTCA
TCTAACCATGTTCATCCATTCCGGTTAATACGATTCCCGAATGCCATCAGTCGCGCGGCTGCCAGACCTGCTGAACTTTTCGAGAGGACTCTCGTCAATATTCGACGTATGGTGGACGCC
GGCGCTAAAGCGAACATAACCGGTGAATTTCGTTACGAGGAGATCCTGACGCGCGAACAG
GTCAAAGAAATTGAACAGTTATCCGGATGCACCGGTCATAGACATCGGCAAAATTGCACC
AACAGGTGCTTTCACCGCAAATACCGCACCATAGACGGCAGTTGCAACAATCTGCGTCATCCTACTTGGGGCTCATCGCATACAGGATTCCATCGAGTATTGCAGCCCATCTATGAGAAC
GGTTTCTCGACGCCGGTCGGTTGGGAGAAGGAACGACGATACTACGGTTATCCGAAACCAGCTGCGCGTCTCGTGTCGACCACGTTGATATCTACGCATGACATTACATCCGATCATCAG
ATTACCCACATGGTGATGCAGTGGGGCCAATTCCTGGATCATGATCTCGACCACGCGTTGCCATCAGTATCGAGTGAATCCTGGGACGGAATTGATTGTAAGAAGTCATGCGATAACGCA
GCACCTTGTTTCCCGATGGAGGTACCGCCGGATGATCCGCGGGTTAACAATAGACGGTGCATCGACTTCATAAGAACCAGCGCCGTGTGCGGATCAGGCTCGACCAGCATCTTATGGGGT
GAGAGACTGACACGGCGAGAACAGTTAAATCAGTTGACTAGCTACCTCGACGCATCGCAAGTCTACGGTTACAATGATGAAGTGGCGCGCGACCTACGTGATCTCACAACGGATCACGGA
TTGCTACGGGAGGGTCCTACGATCCCTGGTCATAAGCCTTTACTGCCGTACGCGTCCGGACAATTCGTCGATTGTCGTAGAGATCCGCTGGAGAGCTCGATCAATTGCTTCGTCGCTGGT
GATATTCGCGCAAACGAGCAAGTTGGCCTGTTAGCTATGCATACCATATGGTTGCGCGAGCACAACCGCATCGCTCGCGTGTTACGCGAAATGAATCCGCATTGGAACGGCGAGAAACTG
TACCAGGAGGCCAGACGTATCGTTGGCGCCGAGATGCAGCATATTACTTATCAGCACTGGTTACCGCGGATATTCGGTTCAACAATTGACGATTTTTTATTATCTTACCGCGGTTATGAT
TCCAGTATCGACGCTAGTATATCCAACGTCTTCGCTACCGCCGCTCTACGTTTCGGTCATTCGCTTATTCAGCCGCGCCTACAGCGTCTAAACGCCTCGTTCCAATCGATTCCTCAAGGT
GCTCTCAATCTACGTGATGCCTTCTTCGCGCCCTGGCGGCTAGTGGAGGAAGGTGGGGTCGATCCCCTAATCCGCGGTATGTATGCTACCGCAGCGAAGTTGAAGCGGCCCGAACAAAAT
CTCAACGTCGAGCTCACCGAGCAGCTGTTCCGTAGCGCGCACGCGGTCGCATTGGACCTGGCAGCGATGAATATTCAGCGGGGACGGGATCATGGACTACCCGGTTACCTGGAGTGGCGC
GATTACTGCAACATGTCGCATGTGGAGACGTTCGAGCATCTGGCCGCCGACATTAGCAGCGCTCGAGTGCGGCAAAAGCTGCGCGAATTGTACGGCCATCCGGGTAATATAGACGTCTGG
GTCGGTGGTATTCTAGAGGATCAATTGCCAGATGCGAAAGTCGGACCGTTATTTAAGTGTCTTTTGCTGGAACAATTCAGACGTACTCGAGATGGCGATCGGTTCTGGTACCAGAATCCC
GGACTCTTCCGCGCGGAGCAACTTGCGCAGATCCAGCAAGTGTCGCTCGCCAGAATCCTATGCGACAACGGCGATAACATCACTCGCGTGCAACCCGACGTGTTCCTGCTGCCCGAGGGC
CGCAATGACTTCGTCAGCTGCGACGAGATTCCCTACGTGGATCTAAGCGCATGGTCCGATTGCTGCGACAACTGCGAGGATCACGACAATACTATTTCTCGCGTACGCAGAGAGGCTAAA
AAATATCTTGCGCCTGATCACGACTATACAAAAAAAGTAGAATCGTTGAGCCGTAATGAAAAGGTGAAATACCTGGAGAACATGTTGGAAAAAAGCGATCGAGAGGCTACGAGATTACGA
GAGCAGGCCGATGACTTATTGCACAGAGTAAAAAAGCTTAAGTCATTATTAGAAGACGTCAAAACACGATAA

Retrieve as FASTA