Entry information : CintPxd01
Entry ID 7647
Creation 2010-10-21 (Marcel Zamocky)
Last sequence changes 2016-02-02 (Achraf Jemmat)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-02 (Christophe Dunand)
Peroxidase information: CintPxd01
Name CintPxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Chordata Ascidiacea Cionidae Ciona
Organism Ciona intestinalis    [TaxId: 7719 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CintPxd01
start..stop
S start..stop
SpurPxd01 1043 0 65..1635 20..1411
PretPxd01 986 0 117..1638 7..1434
PretPxd01 466 2e-138 65..709 3..640
MdoPxd02 949 0 343..1639 310..1470
MdoPxd02 421 1e-122 32..609 99..674
AaePxd 939 0 32..1637 33..1432
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 151..341 191 N° 2 8095..8166 72 N° 3 9751..9822 72 N° 4 10865..10936 72
N° 5 12136..12207 72 N° 6 13519..13587 69 N° 7 13945..14135 191 N° 8 14590..14707 118
N° 9 14891..14973 83 N° 10 15550..15668 119 N° 11 15844..15964 121 N° 12 16136..16243 108
N° 13 16549..16710 162 N° 14 17068..17175 108 N° 15 17313..17429 117 N° 16 17798..17975 178
N° 17 18261..18394 134 N° 18 18666..18782 117 N° 19 19147..19257 111 N° 20 19542..19646 105
N° 21 19988..20081 94 N° 22 20252..20436 185 N° 23 20805..20955 151 N° 24 21120..21257 138
N° 25 21544..21779 236 N° 26 22022..22203 182 N° 27 22637..22802 166 N° 28 23236..23351 116
N° 29 23594..23746 153 N° 30 24155..24303 149 N° 31 24650..24782 133 N° 32 25232..25438 207
N° 33 25783..25943 161 N° 34 26501..26736 236 N° 35 27079..27380 302  
join(151..341,8095..8166,9751..9822,10865..10936,12136..12207,13519..13587,13945 ..14135,14590..14707,14891..14973,15550..15668,15844..15964,16136..16243,16549.. 16710,17068..17175,17313..17429,17798..17975,18261..18394,18666..18782,19147..19 257,19542..19646,19988..20081,20252..20436,20805..20955,21120..21257,21544..2177 9,22022..22203,22637..22802,23236..23351,23594..23746,24155..24303,24650..24782, 25232..25438,25783..25943,26501..26736,27079..27380)


exon

Literature and cross-references CintPxd01
DNA ref. GenBank:   NC_020172.2 (2420264..2448155)
mRNA ref. GenBank:   XM_002121514
EST ref. GenBank:   BW430040.1
Cluster/Prediction ref. Genebank:   100185463
Protein sequence: CintPxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1642 (1617)
PWM (Da):   %s   184165.42 (181403.9)  
PI (pH):   %s   8.09 (8.02) Peptide Signal:   %s   cut: 26 range:26-1642
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWIKRTLTLCVAFAILVNLDGTCKAQSPEHRACPSGCLCFVTTVRCMHRRRDTIPQVAPETRVLDMRFNRIRSIPASTFRRMRNLNSLLLNNNEIQSISENAFRGLSSLKYLYLYKNKIRTIHKRAFNGLVSLEQLYLHDNKIVTVPSGTFATLPKLERLLLHSNLIETLPNRLFDDLTLKRLRLDGNRLRCDCDLAWLATYLQGPGRSVLATAVCYQPRSLSGRHIPTIQPSEFQCSDTNNSTYIAPIFYEMPEDVEVQQGESVIFRCGVRGSPRPLITWHHDGTPVRLDTRVRKSTDGSLVIQTSRQSDGIYKCTADNTVGHRSSSVARLTYRGAQGPPVFTTVPSNKVILNGRVTFQCRSTGTPEPVTRWYHNHERLPVTPNFIVMPGTLHIRSASIENNGTYTCMAANSEGFINSSATLIVRNPPKFTVKPQDQTAIQGRSVTLDCHAEGIPEPTLSWLRNGHTLNRDQRYLVMTSGSLLIRGVNPGDEGTYTCKAESNAGVSTSDAFVTIMVPPRFTVRPQNQRVRQGLTVDFQCQVAGRPQPQIVWTINGRAVPDDPRYSLLPSGTLRLLRAQPEHAGNYRCEAANAVGAQHAQVSLTVIPPTPLSFVRTPEDQTVDAGTDVTIRCHVTGGGVDDETAPNIYWTKDNVRLTTGRFSISRSSLSELLIRQVARDDTGRYECVARSGSDFISASMTLVVNLRNTVKDIVVKLAQILPADCLLHGCPDELDQSSHSSHDEEQSPLSLDELLNQHFLASASRQKRQSVVHLSELYDTIQSATNEVNRGINNSIQHFNNGRNRQSPGDLLALVRFPSTRAGVDLARAAEVFDVALRMIECCVRRGMRPRDFDVRHTKDRQGDGPASLDGDEEMDVMSLIGSEAVELVANLSGCSAHRPNIDCSRDICFHRKYRSPDGTCNNLHHPMWGASLTPFHRLLQPIYENGFNAPISWNNNKKYNNNTLPSPRSVSVGVLMSAGSRPPRKDPDFTHMVMQWGQFLDHDLDFTTMAPSVQRFSDGLACKDTCEHEAPCFPIVDNDSRHSRFHHHPPSPRRHGRQHPHGSGRCMTFTRSSAVCGSGITSVFFSAISRREQINITSYLDASNVYSSNDKEMRNLRDFSSDLGLLKEGQSLELGQKPLLPYNVYSDLESGSNSIQLVAPLDCFRGEGETARQRSVPCFLAGDLRANEVSLTTMHTLWMREHNRIARYIKQVNQHWDGDTIFHETRKIIGAQMQHITYTHWLPKLLGPFTSLIGEYRGYDPNLPSSIVNVFATAAYRFGHTMINPIMYRLNETWHESRYGNLNLHEAFFAPFRIVHEGGIDPLIRGLIAKPMARDSDSNMNEELIERLFSMAEEVALDLGALNIQRGRDHALPFYNEWRQFCNLSSATTFDDLATEIKNPEVRNKLRELYKVPANIDPFVGMIVEDVVPGSRLGPTLACLLTEQFKRTRAGDRFWYENPGIFSPTQVNALKQASLARVICDNTDSIKTVPRDVFLNQPQADFVSCDEIPSIDLSAWIDCCSDCSDSGSFETLDHFQRRSRSKRSTNKRHSHRNINNSSNTNQPWDNPLTPSPPLQNEPRLRVGVKKMNKIEPEGIPSASMDKVLSVIEALESKISQLQGQVQTLEQKLQDRD

Retrieve as FASTA  
Remarks Complete from genomic (chromo 7, ) and 15 ESTS.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGATTAAAAGGACACTGACTCTGTGCGTTGCTTTCGCTATATTGGTAAATCTTGATGGTACATGCAAGGCGCAGAGCCCAGAACACCGCGCTTGCCCCTCTGGATGTCTGTGCTTC
GTAACAACTGTCCGATGCATGCATCGAAGGCGAGACACCATCCCACAAGTCGCACCCGAGACCAGAGTCCT
GTGAGTAAAATTCAATGTTACATTTAGGTGCATAAAATATGAATTTTTG
GTCAGTGTGGATACAAACAATACGCAGCCTATGTTTGATACGATTACCGCAATGGTTATCGCATTTCAAAGTATATCACTGAAATTGATTTAAATTTCTAAACCTCATTTAGAGAATATA
TGTGTCGCGGCATGTATAATTCATGTTTCTACTACTAAGCATTCGATTACAAGTTTCCACGACTTATACACGGATAATCCATCATAAGAAACATCTTCGCTTCGTCTGTTTCACTTGTTT
ACTTAGTCTACAAACATAAACCGGTGGAGTGTTAGGACCTATAATTTTACCAATATACACAAATCGTGTATTCTATTGTATATTTTGAGTCGAGATTACCAAGTTGGACTGGTTGTTTTG
AAGACTTTGTTGACCTTTACAGGCATATAAACTGTTCACAGTAACGTAGATTGCGTGCAAAGTAATATCCTACTGTGAAATATCGTTCTTGTGCGATCTTTACAACTGAAAACATAACTT
GCGTTAAAGTAAACATCACTCGAACTCGCATAACCTATGAAAGCTACGGAGTCTTATTATTATAACAATATATCCATCTTTGCCGAAGACTTTGCCGTTTTATAAGCAGGTTTAATATCG
TGGTTATGGTTTGTTTACTTTTCGTTTGCAGCTTGAATTTAAAGAGCTATGGAACTCTAAAGTTGAATAATATAGTTACACCCAAACCTGGGTTTTGTTGGTTTAGCGAAATTACTAGTT
CTACTCGCGAGTGGTGGTACGGCTTGGTTTACAATGAGTCACAAGCCGAAGAGAGGCCTGGTATTATATTCGAACTTACCTTCAATCTCTCGGCTTTGTTTCTTGAGTGTTGTACAGCCC
TTGGGAAACCATAGATAGCGCTTGGCAAGCGTTAAGTCCGAAGCAGATTTAGTCCCAATGAAGGACCCGAACTAATCAACGTAATGGATTGAAAAGTTTAAAATTAACGATCACACACGA
TAAGCAAATCCGCTGCGGCGCTGTTGTGTCTATCCCTGGTTTAGTTTTGGGTTTAGGTCAATTAGACCTGTATTTTCTTGTTAGGTGTGTTGGAGCGTGAGTAAACGGTATAAACTATAT
ATACGAGAGTTGCGGGAATTACCTTATCGTTTAGCAATGCATCACATAGCAACGGACATGTTGCATTTGTTATTTTCGAGCAGCAACAACATAACCGTTTATTCCCAAGAGATTTAGCAT
GGTAATTAAATACTTTACCACGGGGATAGATCCTGGTTACTTTACCACATACTTGAACGTGTATACAATGCGCACAGAACCCCACACGTCGAAAATGCAAAGATAATCATTAATTTGATT
TTTACCTAACCATAGAGTGATAATTTACAAACAGAAAACAGAATAACAGTTATAGTAGGGTTGGGAAGATGGGATACCTTATTCTATTCTGCGTCGCATTTGGTAGTAAACAAAGAACAC
TCAAAGAATGTTTAATACCGTATATCCTATAAACCGTTGATAATTGTTTAAAACACAATCAGGATATTTTGATATTAGGTGCTAAAGGTATCATATATCTTACCCCACAGTACTGTAGTA
TATAGGGTGGGGGAAGATGGGACACCTTTTATTCGATTTTTCGTCCCATTTGGTAGTAAAGAAAAAAACATTTAAAGAATAATAAAACTGTATCCTCACAACTCCCATAGACCGCTGTTA
ACTGTTTAAAACATATTTGGATGCCATGTGCTAAAGGTATCCCGTCTCCCTCCATTCTTCTATATATATATTATATCCACTGCGGTTGCGCGTCACACCGCATTGATATAACGCATGGAA
TTCAATTAATTGGAGTTTTTGCGCCACCGTACATATACTGTGACTATTAGAGACCATGTACAGACTTGAGAGCCGGGGTCTCCTTATTAGACTTCGTGTTTAAAGCCATACATTGTTATA
CAGACCACACCTGTTGAATAATTACGTGGGTTGGCTCCAATAATCCAATGCCAGGAACACGGTTAACTTGGAATAGAAAGCATAGCTTCTATACACCCTCCATGGACCATGTATTAATAC
TTAGGTTACCGAAGAAGCTGGAACGTCTGCCGTATGCATTCAGAGTCAGTCATGTTACAAGGCACGAGTCATTGACATAGTCTCTCGCTACGTCACAGGTCCAGCACTTTATACTGACAT
GGTGGGAACATGTATGTCTCGTGTTTGTGGCAGGCGTAATCTTATCCCTGAGGACCCTTTGTTTGAAAGTTCGTGGGAATATTTCACACTGGGTTGAAATTCCAGCTTCGTTTTGCAAGG
GTTTGACCTATAGACGACTTAATTGGTTACAGGTCAATAATTGAAACATACACTTTCATATAACAAAAGTTCTGTAAGTCGCTAACTATGTTTTAACCACTGTATGCAATGCCTGTTAGT
TCCCAGTTTACATTGGGAAAGCGCTATATTGTCAAACCCCAGGCACCTTACTTTCTCAACGCTGCGTCTTTGTTTGTGTAAAATAAATGCAGTGTGTTCATATTTTTCTGTAGAATGTGT
TACAGCACTGTTTTTCTCCGCGTCACAGCGTTGCATTGGTAAAGTAATTGAATATTAAACAGTGACGCGAAAAAGGAAATTGTTTTATTACAAAAATAATTTATTACAAATTACAAAGTA
TTTCCGAGTTAGTAAAGTTTGAAGTGAAACGTGTAAGGTTTACATTACAATTAGGACAATGTATTTAAGTTATTGGCAGGCTTCATGTATATTCAGTTTAAATTTGTAAACCTTTGCTTG
TGAACTAAACCAACGTTGGTTGAACGGCTAGAGTTCTACCTTGCTGATAACAATCCTTTCCCCACTTAAAAGGTTGTTTCTGACCTACTTTTGATCACAAGAAACAAATTTGAATGTAAA
CACCCCGACACTTGTGAATTACCACAGACGCATTGAGGCCCCCGGCGGTTTTTTTTCGCGACAATTTACTGTCATGGCATTTTGTACCACGTATTACTCGTGGTATAAATCATTATAAAA
CTGCTGTAACAATATTTTCGCCAATCGCGGGCGATTGTATATATATCCTGTTACGTTGTATGAAGTAGAATAAAACACAAACATAGTTTACTTAATAATTTGCTATGCTTATTGTCAAAA
GGGAAATTGCATCTGATATTTCAAGTTTTCGTTTATCGTTTTGCAATTAAAAGTCAAACGGTCATAAAATTCACTTTAATCGATTATTTAAGTGTTTTATAAAAGAAGTGTATATATAAA
TTGTAGAAGTGTCTATGGTTAGTATTTCTTATTTAAAGGAATTATTGTAAAGTTGTTTTAAATTTGTGGGCTAATTAAATTTTCGTCGTTTATAGGTATCTCTTAATTTCTATATTGAAA
TAATAATATATAGTAGGGTAGGGGAAGATGGGATACCTTTAGCACATAATATACAAATATCATGATCGTGTTTTTTTTAAATTAACAACGGTCTATGGGAGTCGTGAGGATAAAGTTTTA
TGATTCTCTGAATGTTCTTTGTTTACTACTAAACGAGACGAGAAAATGGAGTTAAAAGGTGTCCCATCTTCCCCCACCCTATTGTATTTAAAAAGTATAATGAGATTCCTTGTAAAAGAT
TTGTGGATTTCGCTATCTTCTTGATAATTGATTTATAATCCTATATAGTTTATTTAATTTGAAACAAGCATAACCTTATGAACGTGTGATTTATGAATGAATTATATTTTATTAACACTT
ATTTATTCACGAAGTTAGTTTAATTGGTATACCAACACTGGTTTAATGTTGAAATTACGGTAATTCAGTGCTCTTGGTATAGGTTTGTACTTTCATTTTGATGTTTTAAGTGGAACACCC
GTGTTAATTGGAATGTGAAGGAAACGTGAAATTAGTCTGGAATCATTCGAAATATACACTGTAAGTGTATGGGCGATAATTAAATACAACGAGTGATAATTGGTTGAACCGGTTTTAAAG
GTGTGTGACTTATCCATAAGGATAATATTTAGGCTGACATATTTAATCAAAGGATTAATATAAACATCGATTATTAGCAAGTTAAGTGTTTATGTGTTATATGACCACACATTTGATCAA
ACTGTAAAGCATATTTACATGGATCTGCAAAAATGCATTGATAAAAGCAATAACAACGTGTTTCTGCAATGCATGCGCTCGGCCATGGTCGTAAATATATTCAGCAGCAAATCTGCTTAA
AATATCGCTTTTACAACGTTGCACTTACTTCCCAAAGTAAAGCGAGAAGTACGCTTGACAGGTTACGACCTAATTTCGTTTGATTCCACATGGGTGGCTTGATTTTTAGAGCCCAGTGTG
TTTCTAATAAACCGCCATACTTTCAACGGGCTGTCGTGCACCTAGGAAACCGAGATTCTCACTCACACCTTAGGAATGTTAATCATTCGACCATATTCTCTCGGCACGCGACCGCCGATG
TCCCAACTTACTACCGAAAATGGTGAAAAGATATTTTCTCAGCAATATCTTTGGTTTACCATCCCGTGTTATTTGTAGCGGTTAATCGGAAATAAGCGTAACAAGCCGCCCACTGTCATT
ATTTCACCCCGACATGCGCATAAGCTCTTTAAATCTGAACTAACCGCAACCTTTAGCTCTTGCTACTAAAAGCGAGATTTCATGCAAACCAATTAAAAAGTAATTTCCTAGCGCGCTTCC
AGGTAGGCCTGTACTAATTATATCTACAAGGCCCTTAGTGTGCTTTGCAGATTTTCAGATACTTTTTTGGTTCTCCTACCTCGTGCCACGAAAATGCAAACCGAGATAGCACACTGCGTT
GTAATTGATTGCAGAGAATTTTTTTTCGTCTGATATATACCAGTGCTGGTACGAACAAATAAATGCAGATGAATAGCAAATGAAAATCTGTGACGATCGAATTTAATAAATTTTGCACAA
CGTTTTGTAAAATAAGCGTCCATGAAGTGCTACAGCACCAACTGTTGTTGAGAAGCACTGTTCTACATAGGCCTACCCACCAAAGGGTTTGGTTGTTTTCTGATACCCACCAGTGCCACC
ACAACACCTAACAGAGCTCTTCCATCGCCTCCAGGATAAACTTGGCATTTTGCCAGAACCGCAAACTCGCAAACCATAGGGTTGGACATTTAGCTTACAGTAAACACTTCCGTACGTTAA
AAGGTTGCAAAAGTAACTGCAGTTGTATATATAACAAGAATTACGCCTTCGGATACGACAAAGATTAATTAAACAAGCAAAGAGAAGGGAATTTGTAGCAAAACGTTCTTACTTATTGCT
GGTTTTTAATGTTTAATATCCGAGTAAGGTGTTTGCGTTTAAATGGTCTATCGCGCATAATAACGGTACAGCCGTCAAGTTTTTATTATACGGTTGTTTTGTGTAATATTGACTTTTGCT
ACTCTACCCTATCAGCAAGTCATGCCATGGGGCCTAATGTACAAGGCGTAAATGCAAACATGGTTTAATATGAAGCAACACTTTGTTTAAATTGTAGCATGGGACAAGTTAACACTTAAT
ATTCAGATCAATCTGCAAGAAATGAAAACGTACCGATACAACTTATATATATATCTGGTTTTACGATTTTCGTTTTGAAAATTGTGTGATGTTTTGAAAGCCTTTTGGGCAAACCTTTTG
AATGGGTGTTTTTTTATGTTACGTCAGAGTTAGAGACACAACAGGTGATTTATAACCGGCATAAATTTCCCAATGACGCGTCTCAAGTGTGCTTAGAATCTAAAACAACTAAACACGTCA
TATCCAGTCTGTGCATCTTCAGACACAAGTTGAATAATCCACATGTTGCTTAAACCGGCAGCTTCAATGAACTTGTCGTCTGTGGATTTTGGATTTAGATCAAGGCTACGACACTTTTAG
CTCGCGTACAGTTTGCTGTACACACATCCCCCGCCCTTTTAGTAATAGCATTGCTTGAAACTCAATCCAAGGGTTCACTTATCGGTTTGACTTTATAGGCGGTACTTTGTTATGTGTTGG
TTAACGTAAGTATAACATATTATACACCGAACTAAGCACGAACGTTCGCTGCCAGTAGTGCTTAAAATGTTACCTTCTTTAGCGCGAATTTTAAAGACCAATACCTCGAATTTGGTTTGT
GTCATCCTTTTTTTCTGCAACCGTATGTTCTGTTTTTGTAAATTTGTGTATCACACATTGCGAGATAAGAATGTGCTCTTTCGTTTTATGAATCTTTCAATATCACGTCATAATTAGTTA
TCCCCACCGCTAAATGAATGTTGGACCACTTTATTACGTCACAAACATACCGAGATAAGCTTCGGAAGCCACGAAGCGATTTAGGAAGTTTGTCGTCACCGCATTTCCTGTTTGCGGCAG
CTCGTCTCTTATTCGGCGAGATCGTAGCACAGCTTGCGCCATTCATTTAACTTCCACCATAAACATGCTTTCATTCGATATCTATTTATTATTGATTCGTTGTGAAAACATGCCGCACTT
GGCGCCTCGGTTTGTTTGAATAATGTTACCATTTCCTAAGGTCGTTTTGCGGTTTAACTCTACCCGTTGTACTTTGCTCTTCTGTTAAATTGTCTGTTTTAAAACCTATTACACTCATAC
GTATCACTCTTGAGTCATTAAATCTTAACCTCCAAGTTTAAACAGGGCGTATCGTGCTCTTGTATGCTAAACAATCATATACCCTGGTCGTTAAGACGGTACAACAACTTTAACCTTTTA
AAATGTCGCTCAATATATCATCCCGTGCGATTTTATTAACTGCTGCTTCCAATGGCCATAGATTGGTATATAGTACTGTGGGGTAAGATGGAATACTGTTAGCACCTAAATCTACTTTGG
GGTCGTGGGGCTACGGTTATATAACTCTGTAAATAATATTGAAAATAGAATAACAACATATCTCTTCTTATCCCACCCGACTATATAAGAGTGTTTCTAAATGACACTGAACTGTAAATG
CGATGCAGATTGTCACGAAGATACCATCTGTTTTCATTGCTGATGCGAGTAAATTACCACTGTTGTTAATAATCTTTACACTGTAGTTAATAATGGATAGTCCAACACTGGCAATTTGTA
TTTGTCGTGAATAGAAATATATGAGGCACGGTATTAATGAACCGACCGTGAACCAGTTTAAAATGTTTTTTCACCGAGTGTATGAAACAAAACACTGTCGTTTTGCGCCCTCATGCAAGA
ATAAATAACATAAATTCACTCATAATCTAGAGTTTGAGAGACCCGTGTATATTGAGCAGTTCAAAAGACCTGCTGCAATACAATAGTACTTTTTGTGTTCTTACCTTACAAGGAAACTAT
GTTAATTTAAACTCATAAAACGCTTTGCCGATTTAAAAGCATTAATCATATATACCAACATACACCAGTACAACATAAAGATTTGCGCCTGAACGCATGCCGTCCCGATGTACATTTTCC
CGTAACCACTTTGAACACTTGCACAACACTTCAAACCCGATTGCAATAACTTTAATTGCGCTGCTTTCTGTGTTAAACTTAGTTACGCCTTGTTTTTGGAAGTCCAACACGAATGTTATA
TTGTACGGTACGTTTAATAATATGTAAAGTGCAATACTGTGTATTGTAGAGTACATATATAAAATGCTATGGCATAATATAATTTATGTAAGGTATAATATAATACAGGACGTTATATAA
TGTAATGTAAATTTATTTTCCCAGAGACATGAGGTTCAATAGAATTCGTAGCATTCCTGCGTCTACTTTCCGTCGAATGAGGAATCTGAATTCACTGTGAGTATGTATGGACGGTAGCCA
TCTCAAATACTTCTAGTATTAAACACTTCAATGTCAACTTAAGGGTCGAGTGAAACCGTTGAATTCCAAGTTCGAGTACCACTTGAATTCTTGACTGAAATATCACACGAAAGCTCGACC
CTAAACTGCGATGCAGCAACCTCACGTCTGTACCGTGCTTGATCACTTCTAAAAGATTCTCCGATTGTGTAGGCTAGGTTACCTAAGCTTCACGTTTACAGGTGTATTATATTGCCCGTC
TTGGAAGCGCTCGCAGCTCTCAATTGGAATTAAACCCCGCAATAATTCTTAACCGAAATGTAAAACCCTGCGAACGAAATCTAACTGAACTAAAAAGCGTTTCGTCGCTTAAGTTGAGAG
AATTTCAGCGCAAGTTACACCTCGGGGTCGTGTTCACGTCGCATGGGGTCTAACGTTGTAACAACCCATCACACTGACACGTTTACAAAACAAGAAATTTTGTCCATGCAACATCGTTTG
ATTGATGGATACTTAAGCCTTGGGTTTCGCTGCTGATTCGCATGCTGCGCGGCAATGTTTGTTTGGCGTTACAACGTGGTCGGCTATGTGCCAAAAAACGCCGATAAAGTTGCTGATGCT
GCGAAACGAAATCTTTCACATCAGAGACAATTTTGGCATAGGTTTAATAAATACTTGTATCGCATTTTATCAACATAACGCTTTGGTTTAATGTCACCGTTTGAAAGTTGCACCTCGTCC
GTTATAATTTTGCGTTGCTTTTATTGATAGCAAGCAACTTTCTCGTACGTATAAAGCAGAAGGGGATTATGTTCGTTGACATAATGATAAGGTAGACGGTTTGCCGACGACCTGTTTCGT
TTGCACAAGTTAACGGTTCATTTACCACTGGATTAAGGGCACTGGTTTCTCTGAATTCACTTACCGGCTCTCGTTAACAGACAGGCTATCAGCGCCGTAACACGTTTGTTTCAGTGATAC
ATTACCAGCCAACAAATTTAAAGATTTTAAGGCGCATTCCCAGGCTCTGCCTTGTGTATTTACCGAAAGAAAACAAATAAGTCGAGGCCTCTTCAAGGTTGCGGTTTTCCACCAAATTAA
ACTCATTGAAGATGAAAAATTCGTCCAACTTTTGAAGTCTGATCATTTGTCTCGCAATCCAATACTCCTATAGACTTCTATTTGATAAATAGGCTTTTCGCTTTGAAATATGGCACTTTG
TAGATCATGAACATTGTTACTGCTTTGAAATTAACCATCACGTTTGTTATGGGTCAAAAAAAATCACGTCTGTTTTATATTATACTTTTTATTATGCAAACTTATTTTACAATCAGCATA
GTTAAACAAAAGTGTTATGTACCAATGTTTATCATCTAAATATATTTAAAGTAGAAATTAAATCACGTTTAAGTGTTCTACATTTTTTAAATATAAAAACATACCTATGCAAAATCGATT
TTAAGTAGCATATATAAGTGTGGTACCACTCGCGGTGACGTTGACGACGCAGGAGACGTGTACGACTGAAGTTATTGAGCGTTCATATCTGCGTGCTTGAAATTGAACCTTGTTTTTCAG

ATTACTCAACAACAACGAGATCCAATCAATCTCAGAGAACGCATTCCGAGGTCTCTCATCACTCAAGTATTT
GTGAGTATAAGATAACCATAGACGAACCCGCAGAAGCGCCGTGGCAAA
AGTATTAATTCAAACCACTCAAGCCGTCGCTTTGGCATCTAAAGTCTATTTTCCACTTTAATATTGATAGATTTCTTGAAACAGAATGCACAAATTGAACTGATTTTTTGTTTACACTAT
AGTTTAGAGCTAACCCAACTTAAATGAAATTTACGGAGCATTTAAAGATGTTTTTTTGTTACTTTTCACTTCGATGAACACTGCAATGTAAACACCGCTTAAGAGTGATCAAAAACCGCC
ATTTATAGATTAGAATACCCGGGCACGGCTTAGCTGCTTAAGCTTACGCGACAAAACCAATAAACGAACGTCTTGTTACTGCATAGCGTGGATTTGGGCGCAACATTTTTAGTATTTGCT
TGCCTGTGCTTTGAGTAGATACAGCCATAATCACTATCCAGCATGGCGATATAAAATTCTTTATTTTCTGTTTATTTCGCTGTTTAGTTAACACTGGTTCGTATAAAATCGGTATATATA
GATACTAATTTTCATCCAAAACACCTGAAATTCTAGGTTTTTTAAAGGAAGTTTGGCTCTAGAGTCGTTTATATATACCAGAATTTACTCCCTACTGTAGCAAATAGCTTGCGATTTTTT
GTATGAACACAATGCCTTTATTTGCACAAGCCACAAGTTGCGGTTGTTCCCCCAAACCGAACTCGGTCAACTTTTGGCGAACGAGTCGGGTTGTTTTCGAGCTGAAAACCATCAACTGTT
CGACACTGAATTCCACAGGAACTGGTAGTAAACAGCACGCAAGAGGAATTTCTATTCAACCCGTAGTAAACACCTGGTGCTTGCATAATATCTGACGTAAGAATACGTCATGTCATATTA
TGCAAGCAGACTATAGTTTACATTGGTATGAAATTTGGCATTTGCGTTCGAGTGTACGGCTGTACTTTGTTCCGTGTCAACTACAATAACAAACAGCTGTTAAAAACTTCTACTGTTATA
AAACATGGCCTGACACGCTCTTTTATGTTGACAGATACCTATACAAGAACAAAATAAGGACGATACACAAAAGAGCGTTCAATGGCCTAGTTTCTTTAGAGCAATTGTGAGTTATTTCTT
TGTTCATAGTGGTATAATTTTGTCCCCTTATCCACTGCATTAAAGTGGCACTAACCGTGTTAAATCTACTTTGTGTTCAGTGGAGGCCTTAAGGCTGCTTAGCGAATTCCGCATGTAATC
GCTAAGCTTTATAAGAAAAATACTAACTACGTATATTACGCATGAACTAATACACACTGGGTTAACAAACGTATATATGTCAGCTGTGTTGGCCATGGGGCATTCGGTTTTAATATTGTG
TTTACGTTTATTATAAACCTATTAGGTTTAGAATTCCCAAGTAAAGTCAACGAAAACGAACCTAAAACATACTTTTTATTAAGCCTAGACACCGGCGCTTTGGGGCATGATGATGTTTAT
ATTGAACACCAAACTAGAAAACTCATTATGTCTACCTGTGTTTGATTAATCAGTAACTGCACGTTTTTAAAAGATAAAGTGAATTTCTCCCCGTCTCGTATGCTGTAGCATTTAGTGTTT
AAAAGATTAGATAATAATTTACTGCATGTTTTAAATTTCTGAGCTTACTATTTCGACGTAATTGCCCAAAACATGCAACCATTATAATCTGCAAACTGATATTTTCGGGTAAACACACGA
ATCGGTTTTAACTTTATTGAAACATTTACGATCCTGTTTAATCAACACACATGTAGACTATAGTCGATTTCAGTTTGTGTAGTGAAGCCATCACATTGTGCCGTTCAGAAATTTGGATAA
AACAACCGTTTCATTTCTTTTAAACACATTTTCTTCTATAACCTATTTACATATTTCCTGCATGTTACATCAGTAGGACACTGCAATTGTAGAAAAAGTTTTAATAATTATATTATAGTA
GTTTGGGGAAAGACGGGACAATTACCAAAGGTCTATGGGAATCGTGAGGATACGGTTTTAAATTTCTTTAAATGTTCTTTGTTTACCCAACCACATAGAACGGGACAATAGAATAAAAAG
GTGTCCCATCTCCCCCCACTCTACCACATATTAACCGACCCATTTCAATTCATTAAGCTTTAATGATTTTGCGTTTGTAGTAAATTATATTATAGAAAATATTATGCGATAATGGGCCAA
CAACTACTGCATCTTGACTCCTCGGGCATATGAAACTGTATAGTGCCTCATATAGAATCACTTGCATCGTCGTGTGCGTAATAACTTAGTCTTAACCTTTTGCAGATATCTTCACGACAA
TAAAATCGTCACTGTGCCGTCCGGAACATTTGCCACTTTACCGAAGCTCGAACGATT
GTAAGTTGAAAATTATTATCAATGCGTATCCCATCTTAACAAAACACAGGTGTTCCAGTGCAA
CAGCATACGTTGTTAAAACGATGGTTAAGATTATAGCCGCGTTTTTGGCCCAAGCAGCGAATTTGCAGCGTTAAAATGTGGTCGGACAAAGATTACATTTCGTCTTTAGCGTTTGCAATA
ACAAGTTATCAGACACGATTTTTTATGTTTTATAAATAGATGTACTGTTAAATGTATTTCGTAAGGTAGTGTCTTAAAAGCCGTATAAGGTATTTTTAAAAAAGAATTTTAATATTGCAA
TCGTAAAAGAGTTTCTATAGTTTTATGACCACATGAAATACGAATCCTCGTAGTCGAAACAAACGGTTACAAGAAATCGAAACAGATTCTGCTCCAAAGAGTCGTTATTGAAATGTATAA
ATACACACACGGGCGCTATCGTATAACCGTTTGGTATTTAAACCTTTAAAAAAGAAATAATAACCTATAGCTGTAAGTTTACAGTCAACGGCGTTTTCGTGCAAAGTCTCTTCTTTGTTC
CAACTATGGTTTGTTCCTATAAAAACCCCCGTGCTTAACGAGTGTTAAAAAGTAACTACCATTCTCAATACTTTAACAAAGAGATGAAAAACGAAAGGGTAGCCTATTCATGCTAACAAA
CTTTTCTGAATAATTAACCACTTCTCAACACTTTAACAAAGATATGGAAAAGAAAAGATTATTGAGGCCAATAGAATATTGATCGATACGTAAGAGTGTGTGGCTTCAGACGGAAGATGT
CCTTAACCTATTATGCATCACATCTGTCTTATCACGTATTTATCGATGACTGTGCTGCCAACATCATCTCCCTAACCAGAAGATTAAACGCTCACCCAGTAACTTATTTGATTAGCACCA
CTTTGTCTGATGGGTTGGTTTCCGACTGTTATACAGGATAGAAAACGCCTTTGTTCTAATTCTTCTGTCGATTTCAATCGATCGGTTCCGCTCGTGCTAATGAACACAAGTCCCCGCTAC
AACTCGCTTCCACTAATTTGCTCCCTCGTTCGCCACCTAGTGCAATAAGTTTTAGACAGAAGCGCGCGTAAATATATTATCATTTTTTAAAAGCAACATGCTAATTTTGGTAATTTTGTT
GAAAGCAATACAAACACATAAATATGTCGCTGTTTAAAAATTTCTAAAACACAACGCGTGTCTTGAATAATCATTCAAGCTCACAAATTTTGATAAGTATTACAGTATTCTACACGCGTT
AAAATATCTAAATCTTATACAATTCGTTACAGTATTGTTTTTTCACAGGTTACTCCATTCGAATTTGATTGAAACTCTACCAAATCGGCTCTTTGATGATCTGACGCTAAAGCGGCTGTG
AGTAAAAGCAATATTTGGTCTTGGTTACTTTGATCTGAAGTGTGCTGTAACTTGATAGATTATCGGCGTGCGCTCGTCTGTCAATAATAGGGCTCTGCATAGCTTCCGCTTAAGAATTTC
TCGCATTTTTTTGCTGCTTGAATTACCCTGTTGAGTGAAAATGTTGCATAAAATATCGAGTTAAAATACTTTGTTTAAGTGGTGCAAAGAGCTTAGGTCACCCTTACGTGTTCCATTTTT
GTCATAAGATCTGTTTGTAATGCAACTACATTTTATAAGTGGTACACAAGTACACATGTCATTAAATTTTTATACGCCACTGTTTTTAAAAAATATTTTGCGTAATAATCCTAGGAGGTT
AGATGGGAATCGTTTACGCTGTGATTGCGACCTTGCTTGGTTGGCCACTTATTTGCAAGGGCCCGGTCGCTCTGTTCTTGCCACTGCAGTATGTTACCAACCAAGGTCACTGTCTGGTCG
TCACATACCAACTATCCAACCATCCGAGTTTCAATGCAGTGACACTAATAACAGTACGTATACAA
GTGAGTGTGGGCTTTTCTAACACTTCCATTTCCCATATGTTAACATATACTTGTC
GTTGCAGCAATTCATTTTCAAAATATCATTATTACTTATCAACTTCTTACATCAATTTTTCTTTGGCATAAAGCACTTAACAAGTTGCCAAAACACATGCATTATCCTTAAAATGCTATT
ACTCATAGTGTGCTACTACTTATTTTTCTTTATTTTTAGTTCTTTCGTGGATATTTTTATCTTTTTGTAGAATGGTTGCATTGCTTGTTTTCTTACACAAGTTTTCCCTCCTTCCTTTTT
AGTTCCAAGCATGTAGATTTGAGTTAATTTGGACGCCCACACTATGTTTTTAAATTTTTTTCGCAACTCACTCATGTGTAATTGTAAACACACATACATACAGTCCAACATTCATAACTT
TGGTTTTCACACAAATATCACAATTTCTGTCTCACACAGTTGCTCCAATTTTTTATGAGATGCCCGAGGATGTAGAAGTACAGCAGGGTGAATCTGTGATATTTAGATGTGGGGTAAGAG
GGTCACCCAGGCCCTTGATCACTTGGCACCATGATGG
GTATGTGTCTTATATAAAACAATTCCTACCACCTAAGAATAAAATTATTTGCCTAATCATGAAATGATAGGAATATAATTTAG
AAATAAATGTAACGGTATTATAAAATTGCTGTTTTGCTTATCTGTATTATTTTAAACTGTATTATAAACTTATCTTATATTTGTTATTTTTGTATTTCAGGACACCTGTGCGATTAGATA
CCAGAGTTAGGAAATCTACTGATGGATCGTTGGTTATTCAAACCTCCAGGCAATCAGACAGAG
GTGAGTCATATAAACTTATGCTTATCATTAACCTAGATGAAATACTGCCAGATGACA
TACGAAACATTAGTTTAAACAAAATCCCTGTTCCAATTTGTGCAAAAAATCAAGTTTGGGATAATATGTTATGTCTAGTTTAAATAATGGCTGGATGTTTGAGGCTTATGTTTATTGCGT
GATCTAGAATATTGCAATTAAAAAACAGAAATATTGATACAACCTTCCATTCTATATGGTGAGGTCCTACAAGATTTAGTGACCACTGAGCTGGAGCAAGGTCCACTGTGGCTTACATTA
GTGATCACTTGGATTAAGCAATAGCTGTAAAGTGTCTTGTCGAAAGACACATATGTCCATAGTGGAAGGTGTATTGAGCCTTAAATCTGTAACCTCTTGGGTAACCACTTTGTCACTGTG
CTGAGTTCCCAAGATCTCACCTTATTTTGAAGCTGGTCACTTCTCCTTTATTTACTTTTATGTCTTACACAAGGACATACAGGCCTATCAGTGACAAGAAAACCCGGTATCCTCCGGCTA
CATTATAACCTTAGTAAGAACTTTTGTACTTTTATCCAGGTATTTATAAATGCACTGCTGATAATACTGTTGGCCACAGATCTAGTAGTGTTGCAAGATTAACATATAGAGGAGCCCAAG
GTCCTCCTGTCTTTACAACTGTGCCATCCAATAAAGAG
GTAAAAATAACTTTTAATTATATATAATATAACAACAAGTTTTTTATGTATGAGGAATAAATAGAAATGTCCACAAAGACTT
AACAAGCAATGTTTTCCAAATTTATATTTATAAATAGTTTTGTTTTCAATGTTTTGTTTTTTGTTGCATTTTTATTATATACTTATCACTCAGGTAATACTGAATGGTCGAGTTACTTTC
CAATGTAGAAGCACTGGTACCCCAGAACCTGTGACTAGATGGTATCATAACCATGAGAGACTTCCAGTTACACCAAACTTCATTGTAATGCCAG
GTAGTGTATATTGCTGCACCAACATC
TCACAGTTCATAAAAAAATGGTTGTTTAGTTATATTTTAAGCAAGTCTATCTTCTAAACTTTGCTGTATGACATATATTTGTCACCCAGGTGTTTCTTTATATTCTTCAAACATTCATTT
TGTAATTTTCAGCTCTGTATTCCAGGCACACTTCACATAAGATCTGCATCCATTGAAAACAATGGCACTTACACTTGTATGGCAGCTAACAGTGAAGGTTTCATCAACTCCTCTGCTACT
CTGATTGTAAGAA
GTAAGTTTTCAATCAAATTCAAGTTAGTTACTATATGGTTTTATGTAACCTTACAACCTTGTTTCCCGATTGTTTTATTAATGGCACAACAACAATGTTATTATATT
TATTGAAGGCATAGGGGTAATTACATTATTTTATTGATGGCTCAGGGGAGTTTCGTAAACAATCCACTAGATTTACATACTCACAATTTAACAGATACTCCCAAATTAACTGTTATTATT
AGGTCCAGTGCAATAAACCATAAAAGGTTGATGCACAATGCACCAGACTTGTATACTCACAATGCAACTTTCCTACAGACCCACCCAAGTTTACAGTTAAGCCACAAGACCAAACAGCAA
TCCAAGGCAGAAGTGTAACACTTGACTGTCATGCTGAAGGAATTCCGGAACCTACTTTAAGTTGGTTGAGGAATGGACACACTTTAAACAGAGACCAACGTTATCTAGTGATGACTTCCG
GTAAATAATATTAATTTATTGCTGTATTAATAGCCTACTGTATATGATCAATCTCTGGTCAGTTGTGCATGGTAATATGTACTTCAACCCAAAGGAGCAAGTTACCCAAACACCCAATGG
CTAACAATATAGATAACCCTTCAGTGATCACTGAGTTGAGGCAATTAAAGTGTTTTGCCAAAGGACATAAATGCCTACAGTGGAAGCTGTACTGAACCTTGAACCCATAACCTCTGGGTT
ACCCAGTTTGCCACTGCGGTGGGTTTCCCAGACCTCACCAAATTTCAAAGCTTGTCACTTCTTCTTTATTTATATTAATGTCTTTACCTATCTCTTTATATCTAAGTTACATTTCAGGTT
CTTTACTTATTCGTGGTGTAAACCCTGGTGACGAAGGGACTTACACTTGCAAAGCTGAGAGCAACGCTGGAGTTTCAACTTCAGATGCCTTTGTTACCATAATGG
GTAAGCATTTGATGT
CAGAATTTTATTGTGTTGTTATTATGTTTATTGTGATGTCATCATTTTTATTGTTATGACTGATGTCATAATATTTAATGTGTTGTCATAATCTTTATTGTGACGATCACAATGTGTTCT
AGTACCTCCCCGATTTACTGTTCGACCACAGAATCAGAGAGTAAGACAAGGACTTACTGTGGATTTCCAATGTCAAGTTGCTGGGAGACCACAACCACAGATAGTGTGGACTATCAATGG
TAAGTATTGCGCAATCATTTTTATAAGTAATGCTAAGTCATATAGTTTCGTATACAGCTGTGTTTAAGATTTGTAATTCAATTATAAAGTATGTAAGAGGAAAAAGCCATGAAAAAAAAG
GTATTGCAGTGTGGTCTGCTGTTTATATAATTGAAAAAAATGTATAGTTTCGCAACAATGATGTGTTACAGACATTTTAACTCTGGTGGTCAATCAATTTATATTGTACATTGAGCATCC
TATTATAGATGTATGAATGCCTCACGGAAAATTATAGATGCTTTATAACAATTTAACAAGTGACACTCTTTGTACCCTGTTTGTAACACTGTTTAATACTATTTTTACATTCACTGTTTT
ACTCTAGGTCGAGCTGTACCAGATGACCCGCGCTATTCCCTTCTGCCATCTGGTACACTAAGATTACTAAGAGCACAACCGGAACATGCTGGTAATTATCGGTGTGAAGCAGCTAATGCA
GTTGGAGCTCAGCATGCTCAAGTTTCGTTGACAGTTATCCCTCCAACACCTTTAAGTTTTGTGAG
GTAAAATGCAGGTTTTAATCATAGGTCGAAAAATGTGTCACGCCCCCTATTTAAG
CTAAGGTCTGTTTTTATTGCAGTAATATTTTGCATGATCAAGCATGTATTGAAAATGATGCTTTGTGTTTGTGACACTTGAAAATTGAGTTTTATAGGCACCAGTATAATAATAATTTAG
ATGTAGTGTGCCAGGGTAGGAAAAACAACTTTTTATGCATGTGTGGTTTGTATATTTTAATTTTTCACAATTTCACATCTTTTGAAAATTTCTTTTTCAAACCTCACTAGGACACCTGAA
GATCAAACAGTTGATGCTGGAACTGATGTGACAATAAGATGCCATGTTACTGGGGGAGGGGTGGATGATGAAACTGCTCCAAATATATATTGGACCAAAGATAATGTTCGACTAACTACT
TCAG
GTATCAAAAAGTAAATCAATGTCAAGATTAGTAAAAGTGTAGAATATGATATAATAATGGGTATTAGGTACTATTACCAAAAAATGGGAGAGTATCTTGGTTTTCAACAGCTGTTT
ATTAACAAAACGAGTGCATTTGTAGCCATTTAGAAGCAAAAATGTTATGACTAAAGTGTTTTCATAAGATAAAATGTTGAATCACAGAAAAACCACTTGCATTGATAATTTTTACAATAA
GGTTTTGCTACAAAATAATCGTGAATAATGTTCAGGTCGTTTCTCGATCTCCCGATCTTCCTTGAGTGAATTGTTGATCCGACAAGTTGCTCGGGATGACACGGGAAGATATGAATGTGT
TGCAAGAAGTGGATCGGATTTTATATCTGCTT
GTAAGTATTCGCATCAAACCCCCAAAAAATACTTAAAATGGTAAAATTATTACATGATGCGCCATAATAATTGTTTTTGTTTATCCAA
TATGATAACAAAAAACATGAAAAAAATACGAAAATTGAATTAATGAGTGGTATTTGACAATTAGTTTGAATTTAACCTGTTTCTGTCTTAACGTGGAAAAAATGGTCATCAAAACATGGC
CGTTCTGGTTCATACACCTTGTGCTCACAAGTTGTCACATATGAACTTGTGGGAGGTTTATCAGGCGGACAATTCAAACAACCCAAGGACCACTGGGTTGGAGCAGTGAAATGCACGTAT
TTTACAGTTAGATTTAAATTGTTGATGCTTCCACAGCGATGACATTGGTGGTGAACTTAAGGAACACAGTAAAAGATATCGTTGTTAAACTTGCTCAGATTCTTCCAGCTGATTGTCTTC
TACATGGATGTCCTGATGAACTAGACC
GTAAGAATTTTTAATAAAAGTCAATATATAATACTGTGTGGTAAGAGGGATATCAGTAACATATGTTGTATTTCTTAATCTAAAACCAATTTA
ACCTTACTGAGTCACAAAGATATGTTTTTTTAATTGTTTTATAAAAATACAGTTATACGATTCTGTAAATATTCTATTTTTACTACCAAATAGAACGATAAGAAAGAATGAAAACAGCCA
TAGAAATTTACTTATACTGAATTAAATATCGTCTCTTACACTATCCACATTATTGTTCCCCAACCTCTCAGAGTCCTCTCACTCCTCCCATGATGAGGAGCAAAGCCCGTTATCACTCGA
CGAACTTCTTAACCAACATTTTCTTGCGTCAGCCTCAAGACAAAAAAGACAAAGTG
GTAAGGTTTATTTTTTACTTAAACATGAAAATTGGATGAAATAGCCACGCTTTTTAGTTTTTTC
CCCGCTTTTTATCCATAGCGTTTGTTTGTTTTTTTATTTCATTCTCTTCGTTCTTTAAATAACATGATCTTTGCTATAGTTTTGGAAAAGATACAAAATTATATGTTTGTTAAAACCAAC
TCGTGGTTAGTGGCATAAACTGTTACTGTATGGTAAGATTAATAATCTGATCCCCCATTTTCAAGAATAAAAGAGTGTGAATTTATATTTCTGGTTGAACTTGTATTTTGGAACACATAT
TATTTTTTTATATTATAAAGCGTTTTTATGTTTTCAGTTGTTCACTTGTCCGAGTTATACGACACCATACAAAGTGCAACGAATGAAGTCAACCGTGGAATAAACAATTCGATACAACAT
TTTAATAACGG
GTAAAATAATGCCCTTTAGATGAGTTTTGTTTGGAAAATTCAGTTTCTGAATAAAAGTTCTCAAATAAGGAATCAGTTTTTAATTTATCAGCTCATTTTTAGGTTTAAA
ATTTTCTAGCTGAATATTTTTTCACAATTACTTGAAATCCTAATGATTGGAAATTTTACAGGCGTAACCGGCAGAGCCCAGGTGACTTGCTTGCCCTGGTGAGGTTCCCATCCACACGAG
CTGGTGTGGACTTAGCAAGAGCTGCAGAAGTGTTCGATGTTGCGTTGCGCATGATTGAGTGCTGTGTGCGACGAGGCATGAGACCTAGAGATTTTGACGTTCGGCACACAAAGGACAGAC
AAGAAG
GTTGGATTAAACTTAATATCAACATAGCATTGTTGTTTTATTTTGCTTATTTAGTAAACATGTCAATTTTGTATCTGCACCATGTCCTCACATGCTGAATTAGGTCCTCATACA
TGACACAGCATAGCAAGCCGTGAGACCTGCGATTTTGGCCAGAATTGGCATACTACCCCAACACCAAGGGTGTATGTCTGCTAAGTGTTTTGCCTCAGGGAGACATAGGCCTAAGCAAAA
TCGAGCATTCCACCCACTATTATACGGTAGTTATGCAATCTACCAATACTGATCCACCTTACCGCACTTTTTGACACATTTGTTTACACTTCACACACAAAAAAACATTTTTCCACCACC
AAAAATGTTAACAGGTGATGGCCCTGCCTCACTAGATGGCGATGAAGAGATGGATGTTATGTCATTGATTGGTAGCGAGGCCGTTGAGTTGGTTGCAAACTTATCGGGATGTTCAGCACA
TCGACCTAATATAGATTGCTCACGAGATATTTGTTTCCATAGAAA
GTAAGACACAAATTAAATAGCCTAAAAAATAATCACCCACAAAGTAACATACATGGTAACTCGTAAGCTGGCATG
AAGTGTATGGAACAGAACACCAGTGTTTAAAGACTGTCGTTTTCTGGCCACGTGAGGATACAGTAAGTTACATTCATTCATACATTCAGGTACCGCTCCCCAGATGGTACATGCAACAAC
CTCCACCACCCAATGTGGGGAGCTTCACTCACTCCTTTCCATCGCTTGTTACAACCCATCTATGAAAATGGATTCAATGCTCCTATCTCATGGAACAACAACAAAAA
GTGAGACTAACTT
ATTTATTACACTATAAACTGCTACCACAAATTTATGATTTATTTTGAATAAAAAAATGAAAAACTGGAACAACATCTAAATGTATATCTATTAAAGTGCCCTATAACCATCTTAAACTTT
TAGTATCATATTTCTTAGCCATGTTTAGACCCCCATACTAATAACAGATGTTTTCGAAATTTTAGAGATTTCACTCTCTTCCTTGTTTAATGTTTAGTAAAATTTAACATTTTCTTAACT
ATATCAGTAAACTCACTCAAACTTCACCCCCAGATACAACAACAACACTCTACCCTCACCCCGTTCTGTGTCGGTGGGTGTGTTAATGTCAGCAGGATCACGACCCCCAAGAAAAGACCC
CGATTTTACCCACATGGTGATGCAGTGGGGTCAATTCTTAGATCACGACCTTGATTTCACAACCATGGCTCCAAGTGTGCAAAGATTCTCAGATGGTTTGGCGTGCAAAGACACTTGTGA
ACATGAAGCTCCTTGTTTTCCTATTCTAG
GTATACAAACATATTCAAAGGTGTATGAAATATTGTTATATAGAATGTTTTTGCAATTTTTTAGGTTTTCTTTCATTTAAAACCTATACAT
GGATTAAGATTATAATAAAACAAATTTTCTTTAATAGAAAAGTAGAAACTATTTTTCTTTTTTTTTTATAAAAAAAATCCTTTTGAACTAAATCTATATCAGTTAAAAACGGCTGTTATA
TTTTTACTTCCCTTGATTTCCTTTCTTCCAGTTGATAACGACTCCCGCCACTCCCGTTTCCACCACCACCCCCCATCACCAAGGAGACATGGAAGGCAACATCCACACGGATCAGGAAGA
TGCATGACCTTCACAAGATCAAGTGCGGTGTGTGGATCTGGGATTACTTCCGTATTCTTCAGTGCAATATCCAGGAGGGAACAAATAAACCAG
GTGATTTGTAATTTGTACGTTAGTGCA
TAAAACAAGGATTTTTTTGGTCAGTCCTAAAATACAGATAACAACATATGTAAGAGAAGACTTTCATTTCATACTTGTTTAAAAAGCGTATACTGTTTTTAAGAATTTGTACCTTGTTTA
CAAAGTTATATTTAATATGCTTTGGTGCTATGGCTCAGTGGTTAGATACTTGCTTCGGAAACAAATGATACCGGGTTCGATGCTGGTACTGGCAGGGTTCTTGGGGAAAACTACTTTTAG
TGGACAACCCAATAATAACTAAATTAATCATAGCACCCTGTGTGTCGGAAGAATAGGTGTGCAACAGCCAAGCTTTTTTACACACTTTTATCCATAGCAAGTTTTAACCACTGTTGTTTT
GCTGCTTATGGTGTAGTATTAATCATATAACATTTTACATCACCAGATAACATCTTATTTGGATGCGTCAAATGTATACAGTAGCAATGATAAAGAAATGCGGAATCTGCGAGATTTTTC
ATCAGACCTTGGTTTATTGAAGGAAGGCCAGTCACTTGAACTTGGACAGAAACCATTGTTACCTTACAATGTATATAGTGACCTTGAATCTG
GTAAGTATATACAAGCATGATGCTATGA
AAAATGGTGGACAATAATCTTCCTATAGTTTTGTCTTTTTTAAGCTTTAAATATATTTTGACACTAACACTGACAGACAAATGTGTTTTGGGAAAAAAATTAGCAGACATTACTCCTACC
TAATAGTCACTAATCAGTTGTAGCACCCTGGGTGTCAGGATAATAAATAAACTCTAGCCTAGATGATAGGCAAACTCTAGGTCTTATGGTGTATTTAGCTGTAGGACCTTACCTGCGGAA
AACGGATTAAAAAATCTTGTTTCTTGAATGCTGGTAAACCCTTTTAACACTGTATTAATTTGTACCTTTCTCTGTAAGTACTTAGTAAACCGCCATATTAGGCCCAAATTGGCCATTTAC
CCTAAAATTCACTATTAAACCTTTGAGGTATCTCTTTTTTTCCAGGTTCAAACTCGATACAGTTGGTTGCTCCTCTTGATTGTTTTCGTGGCGAAGGTGAAACTGCCCGTCAACGAAGCG
TTCCTTGTTTCCTTGCTGGTGATCTAAGAGCTAACGAACAA
GTGGGTAGTTAAACATTTTGAACTAAGTTTTACATTTTATTGTCCGGGAAAGACTGGTTTTTATTTGTTGCTTTGGAAA
ATTAGTCTTTTAAATATGCTTTTTATTTATGTGTGGGAAACTATTTGTCAATGTTATATAAAGAAGTTTGTCAATGTTATATAAAAAAGTGTGAAAATGTTATACAATACACTATCATGC
TAGCGTGCCTCTAACATTTACCGTGATGACCATTTCAATTCAGGTATCGTTAACTACAATGCACACATTATGGATGAGGGAACACAACAGAATTGCACGATATATAAAACAAGTTAACCA
GCATTGGGACGGAGATACAATCTTCCATGAAACGAGGAAAATAATTGGAGCACAAATGCAGCACATAACATACACG
GTGTGTATTTTTTTACAGCAATGTTTATTGATGTTGTTTTTTTT
ATTTGCTACCCCATTGTGCATTGATGGTTTTTGTGTGGGCTATTTCCAAAAACATCCTATTCTGTTCATATTGCACAATATCTGTTACATCAAGTTTCAAGTTATGTTGATTTTTATTTG
TTAGTTACTTAATGGTTTATGGGCTGTTCTTATAAACTTATTGGTCTGTTAATACTGTTAACACTATTGTGAGGTGAGCCTACTCCGGTCCAAATTCCAATTCCCATGACATGACTTGCA
ATAAGACCTAACTCATATAAAATAAACTATTTAACCTTACAATGCAAGGTTTACACACTTAGCTATCTCTCATAATATGAATTCAACATTTCTGAACAAAACATTATTAAAACATTTTCC
CCAGCATTGGCTACCAAAGTTACTTGGACCATTTACTTCTCTGATTGGTGAATACAGAGGTTACGACCCCAACTTACCATCCTCTATTGTTAATGTATTTGCAACAGCAGCTTATAGGTT
CGGACACACAATGATCAATCCTATCATGTACAG
GTAATGTGATATGCTACATGAACCTTTAGGTTCTTGGCTTAACTGAATGGCTATGACTGGCTGAATAAATAAGTGTGCCTGTTTTAT
AGCAGGCTGGGGCCCCATTTTTGTTATAACACGAGTGTTCTGTTTCTTACACCTCATGCCTGCATATGAGTTACCACATATGTAACTTCGTTGGTACTTTTTTATTATGTTGTTAAACAA
AGTTATGTTGTTAATTTTGTTACAGCACTGTTGTTCGGTTTTATACACCTTCTGCCTGCATATGCGTTATCTCGTGTAAAATTTAGTGGGTAATTTTTTATCATGTTGTTAAAGAAAATT
ATGCTGTTAATTTAACTAGATTAAATGAGACGTGGCACGAATCTCGTTACGGCAACTTGAACCTTCATGAAGCTTTCTTTGCTCCATTCCGCATCGTGCATGAGGGAGGTATAGATCCAC
TGATCAGAGGGTTGATTGCTAAACCTATGAAA
GTAGGTTGTATAATGATTTAAAATAAGTTTAATGACTGTTTTTCTGTCAATAATTCTCACATGGTTACTACTATAAACTGGGTGATGA
CAGAAATAAAAAGTATTTTTTAAAGAAATATCAATATTATTATTTTTATCCAAACATTGTCTTTAGTTATCTGAATACTTTATACTTAGTGTAGATGAGCATTTTGTGTGCAAGCACATA
TTTGAGGGGTTACTTTTGTATTACTGTTCCAACAAAGTGGGGGCTATAACATACTTATATCTTGAAGACTGTTTTTAAATGTTTCAATTTTTTCCCAGCCAACAGAGAGTGATTCAAATA
CTTTAAAATAGGAAATTTACAGTTTTTACTATAAAAGAAGTTTTAAGTAATATGGTAGCGACAGCAGCATAAAAATCTAGAAGGGTAGAACACTAAACTTTCATCAAACTTTTCATCACA
GGCAAGAGACAGTGATTCAAATATGAACGAAGAATTGATTGAACGACTCTTCTCCATGGCTGAGGAGGTTGCACTTGATCTTGGAGCACTTAACATCCAAAGAGGAAGAGATCACGCTCT
TCCATTCTATAATGAATGGAGGCAGTTTTGTAATCTTTCGAGTGCAACAACATTTGATGATCTGGCAACTGAGATAAAAAATCCAGAG
GTGGGGAGTTGTTTGGTAGAAATTTGCGGCTA
AATGAGCTGATTTGCTTGAACATAACCTGTACCTGCATGGCAATTGAATTTCCACTTGCCATCTACATAATCCTATTCTACCTTTCCTATAACAAGGCATGCTAAAGACCTTGGTTCTAG
CATTAAGTCATGAGTTGGCCCATACACTAAGAAAATTTCCCAAATGCTTCAATAAAAAGCAAGCATTACTAATTCCAACTGATACAAAAACAGCCAAAAAAGAGTGACATATATTCAAAA
AAAAAACATACTAAAAATTTAGGATTATGTTGTTATAACAATCAATTATAATTTACCTAATTGTTTGTTCAGGTTCGTAACAAACTACGCGAGCTTTACAAAGTACCTGCAAATATCGAT
CCATTTGTTGGTATGATAGTAGAAGATGTGGTCCCAGGTTCAAGGTTGGGACCAACCCTGGCTTGTCTCTTGACTGAACAGTTCAAAAGGACAAGAGCCGGGGACAGATTCTG
GTAAACT
TTTAAATAATTTATTTTAGTTTTAAGCTGCCTTTAAACTGCAGCACAGTAATGAAAACCTGTCAAGGCTTTTACTTACTTGTAATGGAAAACAAAGACTAACAATTTTTTGGTAGTTGCC
TATATATAAAAAATCAGGATATACAAAAGCAAAACAAACACATTTATTGATAAAACACATTTTAGGTGGGTGTCTACCATATTTTGGCAATTATCTGATGAATGTATAATCCTTAGGCTT
GTCTGTTAAGTAAACAGTTCAAACGGAAAAGAACTGGAAACAGATTTTGGTGACTTTCTTGAGATATTTTTATGCACGGTCTGTTTAAACAAAAACTGGCAGTAGTATTATCTGTATTTG
GTATAGATATTATAAACATATTTTTAATCATAGATCAAAACATTTTGTGTGTTACAGTTGTGACCATCATATATATATAAGGTTGCTAGAGTGCCAATCAATATAAAAAATTAAAATTTT
CAAACTTTTTCTCAGAAATAGGTTATTCCACTTGCGATTCTTCAGCACTAACCAGTATTCATATATCCAGGTATGAGAACCCAGGAATTTTCAGTCCAACGCAGGTCAATGCGTTGAAAC
AAGCATCACTGGCGAGAGTCATCTGCGATAACACTGATTCGATAAAAACTGTTCCACGTGACGTGTTTCTCAACCAACCACAAGCTGACTTTGTGTCATGTGACGAAATACCGTCCATTG
ATTTGTCGGCATGGATCGACTGTTGTTCTGATTGTTCGGATTCTGGATCGTTCGAAACTTTGTCAG
GTGGCTTGTTGTCTATATACAGAAATAAAACAATAAGAAATAAAAATAAGCTTT
TGTAAACGACATTTTAATCTTTTATTGAGAGCAAATATAGAAATTAAATAACCCAAACTTTATTTTTAAAATAATTTAAAACTGCATACCAGCTGACATAATCTATTGTTTATTTTGAAA
TAACTAAACGGTTTGTTTATGATGCTATTTTATATTTTTTTTACTGTAATTTATTTCAGTGTTTATTCTTCCATGTTATTTTTACATCTAAAGTTTCCATTATTTATAAACTGTATTTAG
CTTATCCCATTAGTTTAAATACTAATGTTAAATAAAAATATTTTGCAGACCATTTTCAGCGGAGGTCACGCAGCAAGCGAAGCACAAACAAACGTCATTCACATAGAAATATAAATAACT
CTTCAAATACCAATCAACCATGGGATAATCCCCTAACCCCTAGTCCACCCTTACAAAACGAACCCCGACTGAGAGTTGGAGTTAAAAAAATGAACAAAATTGAACCTGAAGGTATTCCTT
CTGCTTCAATGGACAAAGTATTGTCAGTGATTGAAGCCCTCGAAAGCAAAATATCCCAACTACAAGGACAGGTCCAAACATTGGAACAAAAGCTGCAAGATAGGGATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGATTAAAAGGACACTGACTCTGTGCGTTGCTTTCGCTATATTGGTAAATCTTGATGGTACATGCAAGGCGCAGAGCCCAGAACACCGCGCTTGCCCCTCTGGATGTCTGTGCTTC
GTAACAACTGTCCGATGCATGCATCGAAGGCGAGACACCATCCCACAAGTCGCACCCGAGACCAGAGTCCT
AGACATGAGGTTCAATAGAATTCGTAGCATTCCTGCGTCTACTTTCCGT
CGAATGAGGAATCTGAATTCACT
ATTACTCAACAACAACGAGATCCAATCAATCTCAGAGAACGCATTCCGAGGTCTCTCATCACTCAAGTATTTATACCTATACAAGAACAAAATAAGG
ACGATACACAAAAGAGCGTTCAATGGCCTAGTTTCTTTAGAGCAATT
ATATCTTCACGACAATAAAATCGTCACTGTGCCGTCCGGAACATTTGCCACTTTACCGAAGCTCGAACGATTG
TTACTCCATTCGAATTTGATTGAAACTCTACCAAATCGGCTCTTTGATGATCTGACGCTAAAGCGGCT
GAGGTTAGATGGGAATCGTTTACGCTGTGATTGCGACCTTGCTTGGTTGGCC
ACTTATTTGCAAGGGCCCGGTCGCTCTGTTCTTGCCACTGCAGTATGTTACCAACCAAGGTCACTGTCTGGTCGTCACATACCAACTATCCAACCATCCGAGTTTCAATGCAGTGACACT
AATAACAGTACGTATACAA
TTGCTCCAATTTTTTATGAGATGCCCGAGGATGTAGAAGTACAGCAGGGTGAATCTGTGATATTTAGATGTGGGGTAAGAGGGTCACCCAGGCCCTTGATC
ACTTGGCACCATGATGG
GACACCTGTGCGATTAGATACCAGAGTTAGGAAATCTACTGATGGATCGTTGGTTATTCAAACCTCCAGGCAATCAGACAGAGGTATTTATAAATGCACTGCT
GATAATACTGTTGGCCACAGATCTAGTAGTGTTGCAAGATTAACATATAGAGGAGCCCAAGGTCCTCCTGTCTTTACAACTGTGCCATCCAATAAAGAG
GTAATACTGAATGGTCGAGTT
ACTTTCCAATGTAGAAGCACTGGTACCCCAGAACCTGTGACTAGATGGTATCATAACCATGAGAGACTTCCAGTTACACCAAACTTCATTGTAATGCCAG
GCACACTTCACATAAGATCT
GCATCCATTGAAAACAATGGCACTTACACTTGTATGGCAGCTAACAGTGAAGGTTTCATCAACTCCTCTGCTACTCTGATTGTAAGAA
ACCCACCCAAGTTTACAGTTAAGCCACAAGAC
CAAACAGCAATCCAAGGCAGAAGTGTAACACTTGACTGTCATGCTGAAGGAATTCCGGAACCTACTTTAAGTTGGTTGAGGAATGGACACACTTTAAACAGAGACCAACGTTATCTAGTG
ATGACTTCCG
GTTCTTTACTTATTCGTGGTGTAAACCCTGGTGACGAAGGGACTTACACTTGCAAAGCTGAGAGCAACGCTGGAGTTTCAACTTCAGATGCCTTTGTTACCATAATGGTA
CCTCCCCGATTTACTGTTCGACCACAGAATCAGAGAGTAAGACAAGGACTTACTGTGGATTTCCAATGTCAAGTTGCTGGGAGACCACAACCACAGATAGTGTGGACTATCAATG
GTCGA
GCTGTACCAGATGACCCGCGCTATTCCCTTCTGCCATCTGGTACACTAAGATTACTAAGAGCACAACCGGAACATGCTGGTAATTATCGGTGTGAAGCAGCTAATGCAGTTGGAGCTCAG
CATGCTCAAGTTTCGTTGACAGTTATCCCTCCAACACCTTTAAGTTTTGTGAG
GACACCTGAAGATCAAACAGTTGATGCTGGAACTGATGTGACAATAAGATGCCATGTTACTGGGGGA
GGGGTGGATGATGAAACTGCTCCAAATATATATTGGACCAAAGATAATGTTCGACTAACTACTTCAG
GTCGTTTCTCGATCTCCCGATCTTCCTTGAGTGAATTGTTGATCCGACAAGTT
GCTCGGGATGACACGGGAAGATATGAATGTGTTGCAAGAAGTGGATCGGATTTTATATCTGCTT
CGATGACATTGGTGGTGAACTTAAGGAACACAGTAAAAGATATCGTTGTTAAACTT
GCTCAGATTCTTCCAGCTGATTGTCTTCTACATGGATGTCCTGATGAACTAGACC
AGTCCTCTCACTCCTCCCATGATGAGGAGCAAAGCCCGTTATCACTCGACGAACTTCTTAACCAA
CATTTTCTTGCGTCAGCCTCAAGACAAAAAAGACAAAGTG
TTGTTCACTTGTCCGAGTTATACGACACCATACAAAGTGCAACGAATGAAGTCAACCGTGGAATAAACAATTCGATACAA
CATTTTAATAACGG
GCGTAACCGGCAGAGCCCAGGTGACTTGCTTGCCCTGGTGAGGTTCCCATCCACACGAGCTGGTGTGGACTTAGCAAGAGCTGCAGAAGTGTTCGATGTTGCGTTG
CGCATGATTGAGTGCTGTGTGCGACGAGGCATGAGACCTAGAGATTTTGACGTTCGGCACACAAAGGACAGACAAGAAG
GTGATGGCCCTGCCTCACTAGATGGCGATGAAGAGATGGAT
GTTATGTCATTGATTGGTAGCGAGGCCGTTGAGTTGGTTGCAAACTTATCGGGATGTTCAGCACATCGACCTAATATAGATTGCTCACGAGATATTTGTTTCCATAGAAA
GTACCGCTCC
CCAGATGGTACATGCAACAACCTCCACCACCCAATGTGGGGAGCTTCACTCACTCCTTTCCATCGCTTGTTACAACCCATCTATGAAAATGGATTCAATGCTCCTATCTCATGGAACAAC
AACAAAAA
ATACAACAACAACACTCTACCCTCACCCCGTTCTGTGTCGGTGGGTGTGTTAATGTCAGCAGGATCACGACCCCCAAGAAAAGACCCCGATTTTACCCACATGGTGATGCAG
TGGGGTCAATTCTTAGATCACGACCTTGATTTCACAACCATGGCTCCAAGTGTGCAAAGATTCTCAGATGGTTTGGCGTGCAAAGACACTTGTGAACATGAAGCTCCTTGTTTTCCTATT
CTAG
TTGATAACGACTCCCGCCACTCCCGTTTCCACCACCACCCCCCATCACCAAGGAGACATGGAAGGCAACATCCACACGGATCAGGAAGATGCATGACCTTCACAAGATCAAGTGCG
GTGTGTGGATCTGGGATTACTTCCGTATTCTTCAGTGCAATATCCAGGAGGGAACAAATAAACCAG
ATAACATCTTATTTGGATGCGTCAAATGTATACAGTAGCAATGATAAAGAAATG
CGGAATCTGCGAGATTTTTCATCAGACCTTGGTTTATTGAAGGAAGGCCAGTCACTTGAACTTGGACAGAAACCATTGTTACCTTACAATGTATATAGTGACCTTGAATCTG
GTTCAAAC
TCGATACAGTTGGTTGCTCCTCTTGATTGTTTTCGTGGCGAAGGTGAAACTGCCCGTCAACGAAGCGTTCCTTGTTTCCTTGCTGGTGATCTAAGAGCTAACGAACAA
GTATCGTTAACT
ACAATGCACACATTATGGATGAGGGAACACAACAGAATTGCACGATATATAAAACAAGTTAACCAGCATTGGGACGGAGATACAATCTTCCATGAAACGAGGAAAATAATTGGAGCACAA
ATGCAGCACATAACATACACG
CATTGGCTACCAAAGTTACTTGGACCATTTACTTCTCTGATTGGTGAATACAGAGGTTACGACCCCAACTTACCATCCTCTATTGTTAATGTATTTGCA
ACAGCAGCTTATAGGTTCGGACACACAATGATCAATCCTATCATGTACAG
ATTAAATGAGACGTGGCACGAATCTCGTTACGGCAACTTGAACCTTCATGAAGCTTTCTTTGCTCCATTC
CGCATCGTGCATGAGGGAGGTATAGATCCACTGATCAGAGGGTTGATTGCTAAACCTATGAAA
GCAAGAGACAGTGATTCAAATATGAACGAAGAATTGATTGAACGACTCTTCTCCATG
GCTGAGGAGGTTGCACTTGATCTTGGAGCACTTAACATCCAAAGAGGAAGAGATCACGCTCTTCCATTCTATAATGAATGGAGGCAGTTTTGTAATCTTTCGAGTGCAACAACATTTGAT
GATCTGGCAACTGAGATAAAAAATCCAGAG
GTTCGTAACAAACTACGCGAGCTTTACAAAGTACCTGCAAATATCGATCCATTTGTTGGTATGATAGTAGAAGATGTGGTCCCAGGTTCA
AGGTTGGGACCAACCCTGGCTTGTCTCTTGACTGAACAGTTCAAAAGGACAAGAGCCGGGGACAGATTCTG
GTATGAGAACCCAGGAATTTTCAGTCCAACGCAGGTCAATGCGTTGAAA
CAAGCATCACTGGCGAGAGTCATCTGCGATAACACTGATTCGATAAAAACTGTTCCACGTGACGTGTTTCTCAACCAACCACAAGCTGACTTTGTGTCATGTGACGAAATACCGTCCATT
GATTTGTCGGCATGGATCGACTGTTGTTCTGATTGTTCGGATTCTGGATCGTTCGAAACTTTGTCAG
ACCATTTTCAGCGGAGGTCACGCAGCAAGCGAAGCACAAACAAACGTCATTCA
CATAGAAATATAAATAACTCTTCAAATACCAATCAACCATGGGATAATCCCCTAACCCCTAGTCCACCCTTACAAAACGAACCCCGACTGAGAGTTGGAGTTAAAAAAATGAACAAAATT
GAACCTGAAGGTATTCCTTCTGCTTCAATGGACAAAGTATTGTCAGTGATTGAAGCCCTCGAAAGCAAAATATCCCAACTACAAGGACAGGTCCAAACATTGGAACAAAAGCTGCAAGAT
AGGGATTAG

Retrieve as FASTA