Entry information : DanPxd01
Entry ID 7649
Creation 2010-10-22 (Marcel Zamocky)
Last sequence changes 2016-02-17 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-17 (Achraf Jemmat)
Peroxidase information: DanPxd01
Name DanPxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Arthropoda Insecta Drosophilidae Drosophila
Organism Drosophila ananassae    [TaxId: 7217 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DanPxd01
start..stop
S start..stop
DmPxd-A 2759 0 22..1531 19..1527
DerPxd01 2751 0 25..1531 21..1526
DsiPxd01 2724 0 22..1531 19..1528
DyaPxd01 2722 0 24..1531 20..1528
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9452312..9452490 179 N° 2 9468684..9468899 216 N° 3 9468975..9469046 72 N° 4 9469119..9469360 242
N° 5 9469456..9470109 654 N° 6 9471653..9471862 210 N° 7 9471935..9472113 179 N° 8 9472270..9472451 182
N° 9 9475620..9478281 2662  
join(9452312..9452490,9468684..9468899,9468975..9469046,9469119..9469360,9469456 ..9470109,9471653..9471862,9471935..9472113,9472270..9472451,9475620..9478281)


exon

Literature and cross-references DanPxd01
Literature Drosophila 12 genomes consortium (2007) Evolution of genes and genomes on the Drosophila phylogeny. Nature 450:203-218
Protein ref. UniProtKB:   B3M7Y3
DNA ref. GenBank:   CH902618.1 (9452312..9478281)
mRNA ref. GenBank:   XM_001957049.1
Protein sequence: DanPxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1531 (1505)
PWM (Da):   %s   171346.23 (168556.7)  
PI (pH):   %s   6.47 (6.43) Peptide Signal:   %s   cut: 27 range:27-1531
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSPGVRPVLWLQLLGLVLIFGGAESVYCPAGCNCLERTVRCIRAKLSAVPQVPQDTQVLDLRFNHIEELPANAFSGLPQLTTLFLNDNELAYLQDGALNGLPALRFLYLNNNRLSRLPATIFQRLPRLEALSLENNDIWQLPSGLFDNLPRLNRLILFKNKLTQLPVDAFNRLHSLKRLRLDSNAIDCNCGIYSLWRRWHLDVQRQLVDISLTCASPQHLQKQSFGSLSEQHFKAKPQFLVIPQDTQAASGEQVVLSCEVTGLPRPQVTWMHNTNELGEEQTGSEVLASGSLLIRSVSARDMGIYQCIVRNEMGELRSQPVRLVVNNNAPAGGGEQESENQVWAVAGSSPTSSSLPSSPAPPKFTHQPHDQIVALHGPGHVLLDCAASGSPQPDIQWFVNGRQLTQSRPDLQLQANGSLVLVQPTQLSAGTYRCEAHNSLGFVQATARIEVKELPEILMPPQNQTIKLGKAFVLECDADGNPLPTIDWQFNDQPLIPGSRADLLLENENTELVVSSARQEHAGVYRCTARNENGEVSAEATIKVERSQTPPRVAIEPSNLVAITGTTIELPCQAEQPEDGLQILWRRDGRLIDPNVQLTEKYQISGTGSLFVKNVTILDGGRYECQLKNQFGRASASALVTRNNVDLAPGDRYVRIAFAEAAKEIDLAINNTLDMLFSNRSDRVQPNYGELLRVFRFPTGQARQLARAAEIYERTLVNIRKHVQRGDNLTMESEKYEFRDLLSREHLHLVAELSGCMEHREMPNCTDMCFHSRYRSIDGTCNNLQNPTWGASLTAFRRLAPPIYENGFSMPVGWTKGMLYSGHAKPSARLVSTSLVATKDITPDARITHMVMQWGQFLDHDLDHAIPSVSSESWDGIDCKKSCEMAPPCYPIEVPPNDPRVRNRRCIDVVRSSAICGSGMTSLFFDSVQHREQINQLTSYVDASQVYGYATPFAQELRNLTSEEGLLRVGVHFPRQKDMLPFAAPQDGMDCRRNLDENTMSCFVSGDIRVNEQVGLLAMHTIWMREHNRLARKLKQINPHWDGDTLYQEARKIVGAQMQHITFKQWLPLIIGESGMKMMDQNPGYNPQLNPSIANEFATAALRFGHTIINPILHRLNETFQPIPQGHLPLHKAFFAPWRLAYEGGVDPLMRGFLAVPAKLKTPDQNLNTELTEKLFQTAHAVALDLAAINIQRGRDHGMPGYNVYRKMCNLTVAQDFEDLAGEISNAEIRQKMKELYGHPDNVDVWLGGILEDQVEGGKVGPLFQCMLVEQFRRLRDGDRLYYENPGVFTPEQLVQIKQTNFGRVLCDVGDNFDQVTENVFILAKHQGGYKKCEDIPGINLYLWQECGRCNDKPAIFDSYIPETYTKRSSRKRRDLQGKQEHDEVTTAESYDSPLEALYDVNEERVSGLEELIGSFQKDLKKLHKKLRKLEESCNSVDSEPVAQVVQLAAAPVSVPVQGKQRRSHCVDDKGTTRLNNEVWSPDVCTKCNCFHGQVNCLRERCGEVSCPPGVEPLTPPEACCPHCPLVK

Retrieve as FASTA  
Remarks Complete from genomic (8 introns). No EST. Strain="TSC#14024-0371.13"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTTCTCCGGGAGTGCGGCCGGTCCTATGGCTGCAGCTTCTCGGCCTGGTCCTCATTTTTGGAGGAGCAGAGTCCGTCTATTGTCCGGCCGGATGCAATTGCCTGGAGCGCACCGTT
CGCTGCATTCGCGCCAAGCTGTCCGCCGTGCCTCAAGTGCCGCAGGACACCCAAGTGCT
GTGAGTATTATCCTATTTTATGGGGTGGACTACAGGAAGAAAAATGGGACTCTATTAGATT
AGATTTCTGAGTTTCTACACTGTTTGTTTTGTATTGTTGAGATATATTTGTGTCTGAATAAAAATAAAAATAGAATAGACTGTCTAGATTCTTAAGAATCATGTTTTATGATAGGAAACA
ATTCTTATAGATCCATAGATTCAAAAACTACTAGGGAAGTACAAGTTCTATGCTATGTTTTCAAGAAATTTCAAGAGGTCTAAGGAGTAGGATTATAAAATATATCTCCATCTGTACCTA
AAGAAGAGGATTAGGATTTAAGAACTCTGTCAGACCGTAATTTGGTTGAGAGTCTAACTTCTTGTTTGCTTTCGCCAAGTGTATCTACATAAATCAACGCCGGAGCTGGCTTGCAAATCC
ATAAATTAGTTTTTAATGTTTTTTGTGCACGCAGCGAAAAGATGACAGCGTTAATTTGACGCCACCCCAGGCCCTTCCTACCGGCTTTCTCCGGCTGCTTTCTGCTCCCGGTTTTCCGGA
TTCTACAGATTCTCCGCTCCGGCTGTGGCTTTGCGTTGTGTTGACTCAATTAAACGGATGTCTAACCAACAGAGCTGGCTGGGATTTGTGTATTTATCACTCTGCTGCGTCGCGAGTCGC
ACTATTTGCATGCATGTGCAATATTTCTGACGTTGCATTTATTTTGCAAAATGTCAGCAGTTTTCGCATGAATTTCGGGGACCACATCCCAACCCGGTCCCTGGTCCGTAGCCTACAGAT
TCGTGGAGTCGGATAGCTTGGCAAATGTTTGTGGAGCATATGCATATTTATGTAGGCCGTGGCATGCCCCAAAACGGAGACAATTGGGAGGAGCGGAAAGCCGGCGACGTGGAGCAGCTG
CCACTGCCGCCAAAGGCTGTTACGGAGGGGGTGCCGCACACAGATTTTACGTGGCATTTACGGGGAATTCAATTTTCATGGGGATGAGCGGATGAAGACTGGGGATTGGCAGGAATAAGG
CGGCAGACTTTCAAACTCTTGACAGGTGCAAAATGCATCCTTACGGCGGAGAATGTCAGCGAATTTGAATTCCCAAACGGATACATTTTCCAGTTGATATTATTGCGCTTTTAAGAGTCA
TAAGTTTGAGAGGTTGAATGGGGAATCTGTGGCATGAGATCCCTAGAATGAATCCTAGGACAAGGACTCTCTGCATCAAATCCCTAAATAACAATTCATTTATCCCATTTGCATCTACTC
GTAATCCTGCTCTCATGAACAATTCTCTGGCAAATCCCACATTCTCGACGCAACTGCAATTTCTCAAGCGGAAAAAACGAAACAACACCATTTGGCAGTACTTAAATTAATCTTCATTTT
AAATAAGGTGATGGCTGCATAATTTATCATGCCTCTCTGGAAAGCAACAGCGCTGGTAGTAGAACAAAAATAAAACAATGCGAAAATAGCAAAACACTAGCACTGCCCGAGAGTGCATTC
AGGAACTTTTCCATTTTGATTCCCATTTCATTTGATTCGTAGCCGACCCGTAGCACACTTTTAATTAATTTGTTTCATTTATTACTGTATGTCTGAAAGTGGCACTTGTTTTGCACTATT
TTGTACTATTTTGCCTCAGTCACTCTTCCCCAGTCGAGTCCAATTTCTCCGTTCTGTCATAATAATTCCGAAAATCAAAAAATCTGAAATATGTAGTGTTTTTCCTCCCAGAGACAAGTA
TATGTCTCACACATGTCTTTCATCTTTAGGAAAATGTTTGTGATTTAATTTTGGTTATGGAAAATATTTTGTTTACATTTCGGTACCATGTCTCACATATTTATAAAGAAAATGTGTGAA
AAAAAGCTTACTCGGAGGTGTATTAGTTTTCCAATATTTCATGATCTCACTTTGAAGGCAGGGAAATTTTTCTTCTGAAAAACTTTTCGCCTATTTCGTGAAAAGCCTTTTTAGTAAATT
CTTTCACATTTTAGCAACTCTTCAGTTTCGGCCCTTATTCAATTTCCTGCTGCTGCCGACCTGCTCCTGCTCAGGGCTCTAAGCCACATTTCACTTCTTTAAAACGCTCCATCCATCAGC
CATAAAGTCTTCTCGGCAGCCATTGAAAGTGGCTCCTTTCGGAGGGCGGAGCTCATAAAAAAAGTGCTGCACCACTCACCCCCAGACCCACCTCTGACCTCATCCCAAACTCTCCTCGAA
CAAAGGCCAAAACGATTTCGGCCCGTCCCGTGTGTATTTAAACTTGCAACTAAATGGAAGTCGAAACTGTGTAACATACGGCGGCCGGCTGCCTACATCATTCATCTTGCCACGCCCCCC
CATGGAAATAAGGGGGTGGTGGGGCTCTTTTTAATACTCATCCCCCATGTGTGGGCTAAATAAATGCACTTGATTTCATTTCATGATGATGCATTTTTAGCTGACCTCCCATAAAGCACA
CATTTCATCTTGCTCCGCCGTGGAGGCAGTTGCTTTGTCATTATTCCCTGAATGGAGCACATACATATCTCTCAGTGGATATCCTATCTTGATATGGCCACTGAAAAAAATATATAATAG
TGGGGGTTTAAAAGGAGCTATTAGTTGGTAACTATAAGTTAGTTCTAGAATCTGGATAGATAGTCTCTAAATTATAGCAGCTACTATTCCTCAAATTTTAAGATATATTTTAGAAGCTTC
TTAACATTTTCTTCAAGTACATCTTAGCATAGCAAGATGAGCACATAAAATCCAGATGGAGCCAAGGCACACGAACTGAATTTGTTGATGCCCCTGCCCCAGCACCTCCTCCTGCCCCAC
CCCCCTCTAGTGGGATCTCTGCCACATATGCGATATCTAATAACTCGGTGGGCATTATGCACATATCATATATGTATGCCACATATATCACATAATGCCTCGCCTCGACTTGCCACTCTG
CCCTCTGGCCTCTGGCGTGTCAAAACAAAAGTCGCCACACGTTGCATGCATGGCATATTAAAAAGTTTGATTAGCGTCCAGTTCGCTGACTCTGCCACGCCCACTTTATGTTGCGCCCAC
TTGGGCAATATGTTCTCGGTTTGGTTCCATCCACATATTTTTTTTTTTTTGGGGAATCAACTATTTTAGAAAACTATTTTGCTTGCAAAAATGTTGCATCCATCTCCCCTTAACTCGATT
CTCTCTAGCACTGTCTACCTCTCCTTTTCTGGTTCCCTATACCCCTCTCTTTCTAGCCCCCTATACCCCTCTCTTTCTGGGAGAATCTCTTTCATCTCGTTGGGTGCATTTATGCGTGAG
AAATGCCTTGTATTTTGTAGCTGGTCGTCGTCGTCGTCGTCATAGTCGGCGTCTCCATATCCTTGTTCCTGTTTCTGCCCCAATTCCCCTTACCCTCTGTCCCACTCCTGTTTCCCTTCC
TGTTCCTATGTTGTTATTAAATATGCATAAATTTCCTTTTTGCACAGCCAGCAGCAGCAGGCAGTCGTTATTGTTGCTTTCGGAATTTTGCATTTACATTTGCTGTTTATTTGTCGGTGG
AAATATTGAAATTGTTACCAATGCCATGGATAGTCCAGTCCGAGTCCTGTCTAGGACGATGAGGACGGGGGCTGGTGCAATGTGTTTCCGGCCCAGGATCTCCGGGCTCTCTCCGGACTC
TCCGGATTCTCGGGGCTCAGGTGCGGATGAGTGGCCAGGGGCCGGGCCAGGATATATGTCCGACGCACCCACCCATCGACTGGATGGGGATAATTACGGCAGTCGGCGAGTTGTCTGGCA
AAGATGCTGCCCCACCCAGTGATTTGTGGCTATTTAATTTTCGAGTATTTAATTTCAGTTCCTGCATTCATGCATTTTGATGAAGCTAGGAATAAATAATATTAATAGCCATTCTCATTT
CCTCGGCAAGGCGATTTGTTTTCAAAGAGAAACTCACTAAAATATTAAACACAAATATGTACCTAGTTTCTATTGATTTATTTCAACAAACACAACACTTAATCCAATCCATAAATATGG
ATTAAAAGAGTCGTGACAGATTGTATTAGATTATAAACAATCCAGCTAGAAGAGTGTTTAAGAGAGATTAACACAAATATTCGTGTATTTATTTACCATTTGTTCTGGAGTGTTTAAAAA
TGATTTATTTATTTAAAAATGCATTTATTCATTTCTATAACACGGTTCGGAGGATTAATATAAGGAGGATATTTTACCTAAATTTTACAAAAATAGTTCAAAGCATTGAAAGCTTATTTA
TATACACTTGTTATTATGAAGCGTTGATGCTTATTTTATGTATTTTGATGCAGAAAAGGATTAATTAAAGGATTACAAAAAGCCAGTGTTATTTTACTCACGACTGGGATTATAAAAAAT
AGTTTGTTCCCAGATTTTTATGCGGGTTCATCCACAAATTGTTTAAGTTATTCCGCTAAAGAATCGAATAACAATTGGCAAAGATATAGCCATCGCTGGGCGCCATATTTGTGGCTCCAT
GAATTTTCAAAGGAGATCCCCCAGAAAATTTACCAAAAAAAACTAAAAAAAATTATGTTGTCTGATTTTGATGCAGATTTGTGGAGAATCGATCTACAAATCGTTTAAGGTAGTCCGCTC
AAGAATCGGATGATTTTTACCAAAGATAAAGCTTTTGCGGATAGAAGATAGAAGAACCTACTAATTCTGAGTCGGATGGTGATTCCGTTCAATCAAATAGTTTAAAATCGCCCTAATGGA
TTCCCCATCTATCGCTGGAGGAGCAACTTAGTGTTCTCCAGCCATCCATCAATGTGTCCACGTTTGTCTAACGACAAATCCACTAAATGCATTTCCAATTCAATTACCAATCAATCAAAG
AGCATACAAACTTTGCACTCGTCTCCTCGCGCGCTGTCCGACCGCCTCTGCGCAACAGCAGCCCCACATCCACCCACTTTTGTGAAATATAATATTATTGTTGTTAAGGTTTTTGCCCTC
TGGTTTGACTTTTCAATTGTTGCCATATTTTCAGCCGAAAAAAAGGATGAAAATCGAAATTTTGCACACTCGCATGGAACATGAAACATGAAAATAAAATTAAATTGCCTATGCGGGAGG
GGAGGGCTTTTGAAAAACGTAATATGATTTGTAATTATGCAAATGAAGCGGTAGACCAATATTCGGTGGCCCACTCGAAATGGGCGTTACATTTCTGGGGCGATTAAACTTCCAAAGGAT
ACAACCTAAAGGGAAAAGTTTTTGCCAATCACACGGCGTATGCATTTTTAATTCACTGTCAAATGCAGATGGAGAAATGTAATCGAGAAATGTGAAAATGTGCAGGGAGATTGGCACCGA
GTGGCATCTTTAATGCATATAGATTCCAGATACCAGATACCGGATCGGATTTTTCGATTCCCCCCAGGGTGCTGGGAGCAGGACTGCGTTTCCCCCTTTGACGGAGAAAAATTCTCTATT
GATTTCGCCTCCCGATTCCTTCTCCAATCCGTCACGGCGAGCAATTTGCATTTAAAGTTTGATATTTTTTTTTTGTTTTCTGTTCCTGCCAATTCTCTTGCTTTAATGCTACAAAGTGCC
ACTTGCTTCATTTGCCAGCAGCAGCTCTTCTGCGCCACGCCCAGTCGCCCAGTCGCCCAGACGCCCAGACGCCCACATGCCAAAACGCCCACACGCTTTGTCATTTCGCATGCTCGTTAG
TGCAGAGCAAAGAATGCAAAGTAGCAAGATAGGAAGATGCAACAACAGCAACGGCAACATCATCACTACACAAACACTTGCCACAATTTATAAGCAAAGTTATTTTGCCATCGAGGAGGA
GGGTGGCTGGCTGCCTGGGAGCAGTGGCAAGGACAGGGGCAGGGGCAGCGATTGCAACCGGCAACATGTCAAAGTGGAGCAATCGGCATGTGCAACGGACACAGAAGACAGAACAAGCCA
CTGGAACCAGGATGGCTACAAAGCCGAGAAAGATAAATTGCCAGGACTGTGGGTGTCCTGTTTTTGGTTTGCTTTTTTCCCAGTGTAGAAGACGGTCAAGCATAAGAAGCATGTAGCCTC
GAAGGAAAAGCAGAAGCATGGCATGGAGGAGCAGCCCATAAGTATGCTATGGCAACGGAGCGAAGCCAAAAGCAACGGAATAAGAGCTGCAAATAAAAAGCGGAAGCCGAGGACTGAATG
CAGCATCTTTCTCCAGACCCCCAGGTGAGAGTAGCAGCTTCCAGCCATCGTGTGGGCCGGACCAAAGTCAACAACAGACATCGAGCAGGCCAAAAAAAGAAAAAAAGGACGGTTTCAAGA
TCGAAAGCATGCTACTCATTTCACTCACCAATTAGTAAAGCATTGGGAAAAATATAGGCTTTCAATTCCAAAAAAAGGGTTTATCTTTAAGTAAAGTATATGAAATATTTTTAAATACTG
AATTATCTCTAAAGGTTATTATTATTTGGCAAGTTATCCCTTGATAGGGTATAAAAAAAAAGGCAAAAAAGCCTTGTCGAAAAGCAAAAGCAGTCGAACCGAGTCCAGGACAAGTGGCAG
ACCACGTAACCGACAACCGTATAGCCGGGGAGCGGAACTTGGTCCAGACAGATGCATAATAATGTTAATGTAAATGCTGGAGACTGGAGACCGAAAGGAGCTAAAGAAGACCGTGGAGGG
CATTACCGGGGCGTATGCGTAATATGCTAGCAAATTTGAAGCTCTTTTGGCAAATGTGAGTGGCAAGTCAATTGACAAAATTAACATTAACTATAAGCAGGAAGGACTTGGGGCTTAAGG
CCTTTTAAAGAGCCAGTCTTGGGAGCTGGTATAACTATATTATATCCAGTGGGTGCAGCATAAATCCCAGTCGTATCTGAAATAGGAAACTGCATCAGCAGTGGCTTTGGGTAATGTTCG
CCTTTTATACGCATATTAAACCATTTCCACTTGAATGGCGAACTGATTTCATTGCATTTTTATATCGCATATATATTGTATGTGAGGGCGTGGGCGTGGGCGAGGACGTGGTGTGGCTCC
TGCTATCCTTTTTTTTTTGGCTCCTCAAATAAAAGCCCTACTGGCAGAGCTCCGTGCTCCATGCTCGACATATAAATCTGCTGTATAATTGAATTTCACACGTTGTGAAGGAGCAAAAAA
AAATAATGCCAAAATGCTGCACAAAACGAGGCAAAAATAACAAAAAAAGAACACAACCGGCGGCAGCGAAAGTTTAAATAAAATTTATTTCAACAAAAATACACACACGTCGGTGGGAAA
ATGTGCAAGGACTGAGCTGCCTGCAAAATGTGAAAATTATTTGAAAGGGCAGAGGGCGGAAGTCGGAGGACGGAGGACTCCTCCAGGTGGCCACTTTTAACCATGAAGGTGTTGCCTGGC
CAGGCGGCAAGCAGCTTAAGGAGGCCAGGACGGGGGCGGCGAGGGGAGCGGCGACAGGACTTCTGTCTGAGGGAGTCCTGAAATTGCATATGTGGAAAGTGCACTTGTGAGACATTTACA
CCTGTAGGGATGTCGATGGAGCGCTGGGTTCTGATCCGGCAGCTCCTGGATGAGCTGCAGCACTTACAGGATGAGGATAAGGATGTGGGCGAGCTAAAGGAGCAGTCGAGGCACAACACA
TTAGCAGCCGAAGAAAACTGAAAAGTGTCGCTCGAAAGAGTGTTTTTCCGGCGAAAAGAGCCGTTTTCACGAGTGAGAAAAACTGTAACTTTCGAGGCTTCCGAATGTACTGGGAAAAAA
CTTTAAGGACATATTTTTGGCTCAATAAAGTATTAGTAAAGTCCTTTAGGTTTCTCACAATTAATGAGAGTATTGGATATTTTCGGAACTCCTCATCGTTTTCGTGGTTCAAATAAAATG
CCAAATCAATGCCCGTTCTTGGAGAGGCATTCTTTCCTTGTCCAGGACGAAACCTGAGGGACACCGAGCTAAAAAGAAAGGCGAGTGAGGTGGCCAGAAAAAATTTGTAGCTTGGGCATT
CGTGCTTCTGGCTGGCTTCTTTTTATTTTGGTTCTGAGGGCCTTTCTCCTTCTGACCTGAAGGCAGTCTTCCTTTTGATTTTCTTTTGCTGTCAGGAGTTTTCTTTCGGTGGCAACCCAA
AAGTATGCACTGGAAGTTTAGATTCCTCTCTTGTTCATCCATTCTTCCACTCATCCTGTTCCTGCTCCTTTTCCCCCAAGTGTGAGAGTGTGTGTGTGTCTCGGAAGTGAATTTTCTACA
CGTGGCTTAACTTTTGCTGCCTGTTCTGGCCAAGTCTGGCGTGTCAGGCAGTCAGCAATCTTTATCCAGCCTCTCCTCTCCTCTCCTCACTCTGTCCTAGCCACTCCTTCAGGACCTCTT
CAGCCCTTCACCGCCCTTGGGTGGAGGAGCCTTTCATTCTTTTCTTGCGGATTTCGCTCAAGGATTGCATTTAACGCAGGAACAGGAAGGAAGGAAATGCCATGTCGACGCTAAAACTGG
GTTAGCTTACATAACGACAACATTAACGACAACGTTTTCCTTCCGGGGGGAGGGCTGCATGGGTTGCGCGGTGGGTGGCACGGTGCGGCAGTGCGGTAAAGCCAAGCAGGATGGCAGGAT
CCGCTTCATGCTCCGCCGCTTATTGGACATAATTACTGAATATAACAATTCTGCGGTAGCCTCCAGGCACTTTAAAAAAAAGTATGAATTTCCAATCTAATGAATTCCCTGAAGAATTAT
ATTTTTTTTAAAGGATGGCTTTTAAAAAGAATTTTAAGGTATAATATATTTAAAAACCTCGTCCCTAGAACCTCAAAAAGTAATTAGAATTTAACCAAAAACACTGTATTTTTTCAAGTG
CCACAACTTGCCATTTAGCTCGCCACTTGTGCGTATCGGCAGCGACAGATAAGTGCAACAAAGCCAGGGGGCAGCAGCGGATGCAGCCAGGAGTCGCCACAAAGCCGGGCCACATATCAA
TTCCGTGTGAGCGGACAAAATGTTCTTGCTGCAGTTTTAGTTCCGGAATGTCCTGTCCTGTTCCGGGCTTAGGATCCGGGGTCAATGGCGGGGGCGATAGAGTCCTTTATCGTTTACACT
TGGCCAAAGGCGGATCAGGTCACAGTCCACTTGGTGGTACAGATTTCGCACTAAATCCTTAAAGTTGCTTGGCTTGAACCCAAGGGCTGAATGGCTCAAGCAGAGCGAAAGTTTCGTCCT
TTGCCAGTTGGGGAAACAATGTTAATTGCTTGGCAGTTTACTTTCTGCAACTGTTGAACTTTTCCGGCGCAGGTGAGAGCCATTAAGTGTGATCTATTGGCCCGAAACCTGGCCTAGTCA
AGCAATTAAGCAGAAGAGTTTTTGGATATTGTTCCCCCAGATAGTGACAAAGGACTGTCCGGAGTAGCCATGATCCTTTGTCGAGAGTCCTTTGTTGTTCCGAATTCGGAGCCAAACAAA
ACGTTTTATGCATGCACACTCCTAGCCAATTACGCAAAGTGCTCTAAGTATCTCAAAACAGTCCTAACTGGACACAATTACATTAACAGCTTAGAACAAACACACAGGCTGGCTAAAATG
CAGATGCAGATACAGATACAATGGCAGCAGCAGCAGCTGCAGACACAGATGCAGATACAGATACAGTAGCTAGAAGTGAGCCGAATTCGGAGCAAGCAAACAGAACGAAAATTAAATCAA
AGCTGCAGAGGCTCGAAAATAAGCTCCGGAAAGGAGTCCTGGGTAACGGTAACTAACTGCACTTTAACCCAGTCACCCTTCAACCCTTCAGCCCCGCCACTGCTTAACCCGTCAACCTTA
ACCCTCTGACAAAGTGACTGCCTGACTGACAGCTGAACCACCTACGTCCCCCCCAGTTCGCAAATAAACAATGTCAAGAGCCGAGAGGAGGTCCTGCCGTGTCGGGCGGCAGTGGGCGGG
TGGCTTTTGTTTAATAATAATAAAATGTCACTGGGCACAAAAATAAACGGCAAGGGAAACTCTGAACGGCTGAAGGATTACATATCACACACACACTCGTCCAAAAGAGACACAGAGATT
CAAAAAAGAGGCACAGCAATTGTCATGAGTCCTTCTGACTATCGTCAGTCGGGGAAATCACCTGGGCAACCCAACAGCATGTGTCCTGGCATGCAAGGATGCTACTAGCTGCTTGCTTCT
TGCCACTTGCTCTCCTTGCAGGCACTTTTATTCTTTGTTGTTGCTGCTTCTGATGCTTTAGTGTTGCTGCTGTCGTTATATTGCCGAGCATGTTGCTGCTGCTATTTCTGCTGCCTCTGC
CGTTGCGTGTTTGTAAGCCATGTTATTACAATAATGTGCAATCTGAGCCAGGATACACAACCGAAAGAAATAAAATACTTTATGTTTATAATTTTTTTAATGATAATTAGAGTCAACTTA
CAGACAGGCTACTAAACACAAGTAGACTTAATTGCAACTATTACCTGGAAGACCTATAAAAAAACAATTTTAAAATCATTTTTCTCTCTGTGCATGTGTGGTATCTGCGGCACTGCGTGT
GTGGATGCCTGTGTGCGGCAGGCCAAAGTTAAATCATGTTTTTATTGTCACATTTGCCATAAAGGCAGCCAGGGGACCATGGCAGACCATAAAAGGATTTAGCCGTCATAAGATGTAGGA
GGAGGAGCAGGCCCAGGACTCTGATTGCAGGTGGGTAAGCCAGACAAATCATAATCAGAGCCTCCAACAGGCAGCAGGCCGGCAAGGCAACCAGCTTAACAAAGCCAGAATCACCTTAAC
AACCTGCTGAGGATTGGCTCTGAGTCGAGGTTCTGTTCAGGGTGTTTGTGATCCCGTTGATAAGGCAGCAACAGCCAGGATACCAGCACCCAGGTGGCAGCTGCTCCTCCCATCCACTGC
CCTCTTAGCCACGTTTATAGCCTTGTTTATGTTGCATACTTTATACTTTATAGAAAGGGGTGGGTGTGAAATGTGTGCGCGGATAAAAAGCGGAGCGTAAGCGCTAACTCTAATGAAAAT
GCAATGAACTAGAAAATATACTGACTCAATGATAAAGCCAACTGACGTTGAAAGCGAACAGAATCCAATTTCAGACCATGTAAGACATAGAAAATTAGAGCGCTACTGCAAAAGGATATC
GCAGATACCAGGGTGGATGGAGGAAACTAACAAACAAGCAGTAGGGTTAACTTTGAATAAACTATCCCTAGGGAGATAACACATATTTAAGTATGAATTTCCGGGGTTTTCTTTGTTCAA
ATACTACATTTCCAGTAGAATACCTTCAGGAACCCAAAACCGCCCTTATTAAGCATTTTGCAAGCCCTCAAAAACCACATTCCGGTCTTAAGCAATCAGACTGCAAATCTCAAAGCAGAC
ACCACAAACTTGTACTGCCAAAATTCCACCGCACACACACACACACACTCTCACAGACAGCCCCTCTTAACCCCATCAATCCCCTGCTTAACCCGATGTTAAGCAAATCCCCACTAATTT
ACTGGCTGCGGTTTTTCCTTCACTAATTGTGACAACTAATTGAAATCAAATTAGTGAAGCCACTAAACACAGCTTAACTAACGCTCGCCGAGTACCCAGCATATTTTCCACCTCATGTCC
CCACGAGGGTTAAAGCCCCAACCCCCCACCCTTTCCTTGGTGGTGCAAATGGGTTAACCGAAAACCCCACAGAATGCTAATTGTTTTCATTCAATTTGGTGTCTGCGCTGGCTGGGCTGC
TTTAAAATATCGCTCATGGCTCCAGTTTGGCTGACCATAAATTTTCGTCATTCGGACATCAAAGCGTATACGCAATATTCCAGTGTGTGGCAGGTGAGTTGTGTGGTGTGCAGAGTGGAC
CTTATATTTTTAATAGATTTGAATATTTTACTCTGTTTTGTTAAGATCTAAAATTTAATGAAATAAATTGAGTTGTGCCACTTCACACATATAAGCTTTTTTTTACTATTTAACACTTGC
TTGCTTTTTTTCTACTTTCCCATCTTGAGATCTGTAATTTTTTCGATTCTTATTTGCTTTTAAATCGATCTTAGGAATAATTTACCCTCTAGAATAATATTTATATATTAACTTAATTAA
AAATTGTAATCACACTTTATTTATAATTTTGATTTAAGTATTTAGAGGGCAGAATCAGTCTCTATGAGTATTTCAAGAGGTTTCCGTGTATGTAACCTACTTTAAGAGAAAGTTTTTAAA
GTTTTTATATCAGGAACCATTTCCTAAGAATTTAATAAATCATCTTAAGCCACAATTCCCTCTTCATATTATACTAGCCATATTTAGTAGCCATCTCAATAACACATTTTCAGTTTAATT
AAAAATCCAACAGAAACTTAACTTGATTTTTAAATATAAAGTAAAAGACAAACAGTGCCAGAGTGTTGGGCTTAAAGTTTTCTAATTTGCAAAGGACAAGGTCCTGTCGCAAAGTCCACC
CTCGTGGGCAGGCATGCGTGAATAGACAAACAGGCCGGAGTTGAGCAGCCTTTGTCAATAATATGCATTAATTAAGTGCAGACATGGATACGGCCAAGCACACAGCCGGGCAGCAGCAGC
AAGGAATCAAATCCAGAGGCCGGCACAGGAGGCAGGGGCGGGCCCCCGTCCAGGACACGCCACGGCACTCACGGCTGTGCAAATTTAATTGAAAATATCGAATAATGCGAAAATGCAAAT
GTCATTATCAAATTCACGCCGCCGGAAGTGCCAGAGTGCTGAAAAGAAGTTTCAAGATTCAATTTCCGCCTCCCATGGCAGCGCCATGGCAACACATGACGCGAATCCCGGCAGGTGGTC
TTAGGGTGTGGCCAAAAACTGAGGGGGATGAGGTGGCTAGGGGCAAAAATGTCGGCCTGGGGCGCGGGTGGGGTGTTCCTGCGATTGAATACCGGAGCCAGGCAAGTTATTTGTGTCTCT
GCATTCATTTTTGGAGCAAATAGTTGCGCAACTGACATGACGGCCCCCGCAGATGGCGGATGGACTCACTTGAGAGGATCCTCGCACACAGAAGGCACTGCAAAAAAATTTGACAGCACT
ATCCCCAGAGCTATGCCTTTGGCAGATGGTATGCTTCCCGGGTTCTCTCGGTGTCTGACCAACTAGGCTCGACAAGAACTCGGAAACCCATTGCCCGGACACGCACTCTCCATGTGTGCA
CATTGAAGTGGACCATCGTTTGTCACACGTCACCCGGACGGGTGGTGGCGCCACAGTGGTTATGCAGAAAGGGACTCGAAAAGTGGCATGGAATTTTAAAGTGCACAGAGCCCCATACCA
CCCGGAGCAAATAGCAAACAGCAAACAGCAACACAGATAGAGGGAGGCGCCTCCAAGTCAAAGTTTGAAAAGAAGCCGGGTTCCATGTTGATTCAAATTAGACCGATCCATCTGCCGGCA
CTCGACTTGACCCACTGTGGTGCCTCCTCGTGTTGACTGATGGTGGCGGGGCTAATGGAGTTTGCAAGAAGTGGGCAAGAATGTGGATCAAGCAGCCGCAGCCGTCGCACAAAGGCCTTC
TCGGCCCATACCCCTCATCCTTTGACATTCCTCCTTCCTTGTGGGGGAAATGCGAGCAACTTTGCAAAATTTTTGCTGCCACCCGGCATCTGCCCGCCACTGACTGCCTCACTTCCTTCG
TGCACCGCAACGTGCATGTGGCTGCCACCTTCTAGTTGATGCACTCGAAAATGATTTTCAAGAGTTCTGGGAGTGAATTTTTTGACTGGATTTAAGGATTTCCTAAGAAACGCTTAATCG
AAAACATTATATTTTAAAAGTTCTACAAATTTTAAAATAATATATTTAGTAACAAAGCTTCAGGGATTATTTGTAATTCTGAATTTCTTTATATTTATTTTATAAACATCTTAAAATCTC
TTCTATCTCTGATGGAAGATTAATGAATATTGGATGAGGCACACAACTAAATCCGCAGTGTATGTCCCAGTCAAGGGGTTACAAGGATGGTAGTGGGTCCACTGGCCTCGGGACTTGGGT
CTTTCATCAGGCCAAAACCAAAACCAGAGCCAGGACTAGAGCCAGGACCAGAGCCAGGACGAGAGCCAAGACCGTAACAGAAACCGAACTCAGGGCTGAGGTGGCTAGGTGGCTGGCTGC
TTTGTTTATGTGGCTCCATTTGGGCGCATGCATGACCCACTCAGCCACTCAGCCACCCAATGACCCAACCACGAAGCCACCAAACCACCGAGCCACCCACCTCCTGTGGTTCTTGTTATT
ATTGTGCCGGGGCCTCAAGCTCTACGTGTGAGTGGTTTTAGTGTTGTTCTGGATTTTTAAGTTGTTTTCGTTGTAGTTGCTTGTTTGTGTTGCCTTTTTTGTTTTCTGTTATCCTGAGGT
AGAGAGAGGTCCTGGGCGAGTGTGGCTATGTGTACTTTTCGCCTTTCTCGTCCTGTGTTGCATCCTCGTCTTTAGTTGCAATTTGAACACTCACACACTGACAGAGCGAATGCTGACACC
AATTAGGGCTGCAAGTTGTTGTAGTTGCAAGTTGCTGCTGCCACTGCCGCTGCTGCTGGTAGTTAGTTAGTTTGGTTGCACTTTGTGCGTTGCATGTTTACAGTAGCCACAAAACATAAT
TTCTGTTTAGACAACTTCAGTCGGGGCTCCAATTGCAGTTGCTTCTGGCCACAGGGAAGCCAAAACAGAAATACAAAAAATAGGGAAAACCCCAAAACGAGCAAAAACGGGGTCATAATT
ATCGCAGCAACAAAGACAGCAGCGGTAAACGATGTTGCCACAAGCCAGGACGCAGAAGGCAGCCACCAGCCAGCAGCCAGCAGCAGTGGCTACAATTTTTGGTATAATTTTCACTTTGGC
CAAGAAGAAACTTTTTCGCTGCCGCATTGAATTTGCAACCAGCTTAGCCCGGCCAGCAGCAACAGCGGCAAATAGCAACAAAGTTCACGAGTTGATTAGAAAGTTTTTTACCGCTGTTGC
AGCTACATCCTTAACTCAATGCAGCCCCTACTCCAGCCTGCAACCTTTGCACTCGAAAAAAAAAGTCTAGTAGCTAATTTTGGGCTATAATTCCAGCTATAATGTAGTCTTTCTGGAGAG
ATCAGAAGAAGCTTAGAGACTTCTGGTCCAGTTCGGTCTGCCATAGATTCTTCTTAGAGAGGTCTGAGGATGTCCCTGATATCATTTGGTCAAAAAATATCAAAAAAACTATAAATATTC
CTTTTTCTTAGTGCACTGTTGCTAATGGCAACTCCCCATGAGCTCTGCATATGCGAAAAGACCTCAATCCGGTGGCTTTGGCTCCCGGCCCCCTATGCCACTATGTGCTTGGATATATAT
TTACAGTTTGCTTTGCTTTTTGAGAGGGAGGGGTAGGGGTAGGGGTGGACAGGGTTGCCAGGGTAGCCGGCTTATGGCTTATCGCTTGGCTGCTTTGTCGCCGTAAACTATGCGAGCATC
AACTTTTTGTAATTAATTTTTAATGTGTGCAAAATGTTTGTGAAAACGAGCATGTTGTTTGTCGCTAAGCCATATCGAGCGGATGTCGTTAGAACGGCTTATCAAGTGTGCTAAGAGGCG
GATAAGCCACCGCGGGTCCAAGAAGCTCCCTCTACCAAGCTCTATGCCACATGCCATTCCATAGGTCTGAGTTTATCCAGAGAAAATAATTAGATTTTGTTTTAAGCTCCCAATGCCGGA
TGTGAGTTAACTCTTGCACACTTTCTGGGCCACTAATTGCATATGACAATGCTGCATGAGCTTTAACCCGGCCGGGAGAGGTGGAGGATGTGCGGGTGTGAAAGGACGAAGCACAGCAGA
CCGCATGACGGGAATTGGCATTGGCAACTTGCAGCAATTTTCCGGAACCAAAAATTGATTTACCCTCATCTGCTAGAGCTCTGAAGTTGCGGATACAACGCACTGAAAGAAAAGAACTTC
TTACTTTCTTACTAATAGGTTTTAAGTTTAGTTTCTAGTTAGAGTCATAGGACAGTCAAAGACACTATATGTCAGGACACTCAACAATAGTATTTTTTAAGAGAAACCTGATAGCTTCAG
ACTTCCTTCAGTGTAGCCTTTTTCAGCAGCCCATCTATCGAACAACCACCCATCCATCCATCAGATAAACGTTCTGCTATCTCGGATTCCACCATTCAGCTCTTTCCTTTTCACAGAACT
CACTCACTCACTCACTGTGTCCATGTTTTTGCGTTTGGCAACATTTTTGCAGAGATTTGCGTTTCAATCACATCGAGGAGCTGCCGGCGAACGCGTTCAGTGGCCTCCCCCAGCTGACGA
CACTCTTCCTGAATGACAACGAGCTGGCCTACCTGCAGGATGGGGCCCTCAACGGACTCCCGGCCCTGAGATTCCTCTATCTGAACAATAATCGGCTAAGCCGCTTACCGGCCACCATCT
TCCAGCGCCTGCCACGCCTCGAGGCGCT
GTAAGTAAACCCACCTTAATTAAGGATCCAGCTCGTCCTGCAATCGCCTTACCGCCTCACCGCTTACCATTTCAGGTCCCTGGAGAACAATG
ACATTTGGCAGCTGCCTTCAGGACTCTTTGATAACTTGCCGCGCCTGAATCGCCT
GTAAGTTGACGATAGACCTATTTGGTGGAGGAGGGCGCTTTCAGGCTCCTTATTTTCCTCTCTCT
TTCACAGGATCTTGTTCAAGAACAAGCTCACCCAACTGCCAGTGGATGCTTTCAACCGATTGCACAGCCTGAAGCGCCTACGTTTGGACAGCAATGCCATCGATTGCAACTGCGGCATCT
ACTCGCTGTGGCGCCGCTGGCACTTGGATGTCCAGCGTCAGCTGGTGGACATCTCCCTCACCTGTGCCAGTCCCCAGCACCTTCAGAAACAGAGTTTCGGAAGCCTCTCCGAGCAGCACT
TCAAGTGTG
GTAAGGATTTGAGAGGGACTACTTATTGTTAGTGATTTGTGGAATGATTCTAGGATTATTATTATAATTATTATACTCTGGAATATCATTTACAGCCAAACCCCAATTTCT
GGTGATTCCCCAGGACACGCAGGCGGCGAGTGGAGAGCAGGTGGTGCTAAGCTGCGAGGTAACCGGGCTGCCCCGACCCCAGGTCACGTGGATGCACAACACCAACGAGCTGGGCGAGGA
GCAGACCGGCTCGGAAGTCCTCGCCAGCGGCAGCCTGCTCATCCGGAGCGTGAGCGCCAGAGACATGGGCATCTACCAGTGCATAGTCCGCAACGAGATGGGCGAGCTGCGTTCCCAGCC
CGTCCGTTTAGTGGTCAATAATAACGCACCAGCAGGAGGAGGGGAGCAGGAGTCGGAGAACCAGGTGTGGGCGGTTGCCGGCTCATCACCCACGTCGTCCTCGTTACCATCGTCACCCGC
GCCACCGAAATTCACCCATCAGCCTCACGACCAAATTGTGGCTCTTCACGGACCCGGACACGTGCTGCTCGATTGCGCCGCCTCCGGCTCCCCGCAGCCGGACATACAATGGTTCGTCAA
TGGCCGCCAACTGACCCAGTCCAGGCCCGATCTCCAGCTGCAGGCCAACGGCAGCCTGGTCCTCGTCCAGCCCACCCAGCTGTCAGCCGGCACGTATCGCTGCGAGGCGCACAATTCCCT
GGGTTTCGTTCAGGCCACCGCCCGCATCGAGGTGAAGG
GTGAGTTAATGGAGCGGAAAGGGAATGCAATTTGGAGATGGTACTCCGTGCAGTGGCTATTGCGGGTTTTTACATAAAATCT
ATGTTAATATCAGTCATATACCCTTTGAAAAATACCTCTGAAATAGTGAAAAATATGGTCCAAAATCACTCTCCTTTAAAAGGACTCTCCAGCAAAAAGGCCCTCAGTGATTGTCAGAGA
TCCTGTCAGAATCCCAGTGCCACACAACCAAGCCGAGAGTCACAACTGTCGCGTTTCACTCAATTTGCAGTCGATTTAATTTGTTTTCGTCTGGGAACTGGACCGACCCGAAGTCGGGGG
ACTAGACAGGACACACTGGCCACACGGGGACGGAACTGGGGATGGAAGGACCTGCACCCTCCGCTTAGGGCGTTGGGACTTGTTGGTGAAGTTTGCCACACTTTTCGTGGGTGGGAGATG
GAATAGATTGTGACAACTATGACAGCATCTGGTGGCAGTGATCGCAAGTTCATATAGGAAATAGTCACAGAATCAGTTTCAAATGAGACACTACTTGGGAGAACTCCTTAAAGAACTTGG
GGGAACTCTATCCTGAAAAATGCAATTTAAGAAACTATTTTTTAGTGCCAGCACTTAGCCATAGAATATAAATGGCTTGGGGTTTTGATTGGCGAACATTACGGATCTGCTCATTAAACA
AGCCAAGGAGAAGTGCATCCCGGCATGGGTTTAATCCCAAAAACAAACCACCACTTGAGCTTTTTATGTTGTTCCATTCGTTATTGCTGTATTTGAAGCGTTTGTACGTGACTGTACTTT
ATTGCGCAATAGACGGCACGAGGCACGAGGATATCCTGGTGGTAGCATGACGTATACATGTGCATTATGTTTTCCGCACGGGGCAGGGGCAGGGGCAGGAGCAGGGGCTTCCAGACAGAG
AGGCGGAGATAGAAAGTGGATGCAACATCGCCTTGGTGCAACAATGGCTCATTATAATTTGTGGTTGTCGGCACAAAATGAAGTGCGAAATTTATGCGTTAAATTTTGTGCAACATAAAG
TACAAAAATTATAAACTATTACGCGCCAGCGAGGGGGAGCTGCGGTTATCCGCAGAGTAGTGCGGGGACAACGGGGCGTATGAACTATTTGAGCAGTCAAGCGTGGAGCTTGCTCAGCAT
AATTAACCTGCCACACATACAACCACCCTGACAAACACGCGTTTAAGCAAACACTCGCACACAAACAAGCACCAGGCATATAAATAAGCAGTGGAAAATAAATATGGCGGACCCGCCGTT
GCCGGAAAGTATGCAGAGTATTTTGAATTGCATATTACCCATACGCCCCGTGGGAGCGTGTGTTTTCGGGGGTTTGGGGCATGTTAGAAGCAAACAAAGGACTCCACTCCCGGTGAAAGC
AAAACCGCAGGCAGTGTTTGCCGGATTGTTGCTGCCATTTGGAGCACAAAAATTGCTAGAAAATCGTTCATACGACCCGTTGCATTTCATCCTTTTGGTTTCTGTTTTTTTTTTTTTTAA
TTTATTTCTCCTCCTCCGCAGAACTGCCCGAAATTTTAATGCCCCCGCAAAACCAAACAATCAAACTGGGCAAGGCCTTTGTGCTGGAGTGCGACGCCGACGGCAATCCGCTGCCCACCA
TCGACTGGCAATTCAATGACCAGCCCCTTATCCCCGGCTCCCGTGCAGACCTGCTGCTGGAGAATGAAAACACCGAGCTTGTGGTGAGCAGTGCCCGCCAGGAGCACGCCG
GTAAGTAGG
ATAAAAGTGATTGCCCAAAACGGGTTTACATTTCATCTCGTTCGAATACCCACTCCTTTTCAGGGGTCTATCGCTGCACGGCCCGAAATGAAAACGGGGAGGTGAGCGCCGAGGCAACCA
TCAAGGTGGAACGATCCCAGACGCCACCGCGAGTCGCCATTGAGCCGAGCAATTTGGTGGCCATTACAGGCACCACCATTGAGCTGCCCTGCCAGGCCGAACAGCCGGAGGACGGCCTGC
AG
GTAAAGTTGAGCCGGAAAACTTTCCATTTTATTTGCCCGCAACTTGTTGAGGTCCTTTTCCTTTGCCTCACAGAGCAAAAAATATCAGAAATTGAATAATTGATTGAACTGAACTGAG
AATTAAACTGAGCCCGGTTTTTTTCACTGTATCCGCAGATTTTGTGGCGCCGCGATGGCCGACTCATTGATCCGAACGTGCAGCTGACGGAAAAATATCAAATAAGCGGCACGGGAAGCC
TCTTCGTCAAGAATGTGACCATCCTGGACGGCGGCCGGTACGAGTGCCAGCTTAAGAATCAGTTCGGCAGGGCCTCCGCCTCCGCTCTCGTCACCATCAG
GTGAGTGCGTCCGCCCAGTG
GGAGTGGCAGGCCAAAAGGTATATACATATAAGAGAACAAAGGTAACTGGGAATCCGCATCCGCATCCGAATCACAATCAAACAGCTCAACTTTGAGCAAGGACCGCAACTTTAATTGCA
CCGTCGGAGGGGCAGGGGTGGATCCAGGACTGTATAAAACTCCATTAAAATCCAAAAAGGAAAAACTTTTTCTCAAAGGCCGGGGATGAGACCGAGCAGGCAGGAGTGGATGGGAAAAAT
CAAAGGAGCAGTGCAATCAGAGGACGCACTTAAAATGCGTTTAAGTGCGCGGTAAACTTGCTTAATTAATTGAAAAATAGTTCTCCAGGAGAGAAAAGGAAATAGTAGGAACTTAACGAT
ACAGTGGTGGATGGAAAAGTATATTTTCTTAAATTCTATCACTCTCCTTAAATAAATTGCATTTAAATCTAAAGCCTATGCTAAGAGACACCACAATTGTTGTACGAAACTTTAAAACTC
GCCCTCAAATGATTTTTTAATCCCTGTTCTGGCGCCACAGAGCTAAATTGCTTGGAAACCACTGCCACAAAAATGGGCTTTGAAAATAACATAAAACCATAAAATAAACCTGCCAACTAG
AGTCCTTGCACAGTGGGTGGAAAGCCAAGAAAATTTGAGTGAAAAACATCATTCCCTCCGGCCAACATAAACATCAAACTTGCAGCTTCTCCAGGACGGGCTTGCTGCCTGGCTGGTTGT
TATCAAAAGCAGTTAACAGCTGGAAAAACTTACTAATCCCACCGACAGGATCAGATCCACTGTGTTGTCAGCTAAACTGCAAATAAAATATGCACCAAGGCGGCGAACATCAAAAGGCGA
TGGTGGCGGCAGGGAAAGCACAAAAGTTGTCGCCAGTTGCTAGTTTCCAGTTGCTAGTTGCCGGTTGCCAAACTGAAAAACGTGCTAAGCCCGGAAAAGCTACGTGCAACACTCACACAC
ACACACGCACAGCAGGGTGGCATGAAAATTCCTTTCCGAAGCAACCGCACAAGTTATCCAAATTGCCCAAATTGAAATTGAGTTGACAAGTTGCTTCTGGAAAGAAGAACTAGCGCAGAT
ACACTCTTCAAAAATCGACTTACTGAATATTAATTCGAATAAAATAATTCATAAATTCTTGCATTTCTTTTCTCTAAGTGCACATAGACCCGATCTTAGTCTTTAGCATCCGCTCTTCTT
TTTTGAGGAGAAGGACGTTGGAGTTCTCGAACTGTTTGTTCCAACAAAAAAGGACAAGATGTGAATTTATTGAGCAAATGGTCCCTGCATGCCTCTGCCACCGGCTGTAAATCAATTTGA
GGCAGCTGGAAAAAAATAGGGAGTCCTCGGACATGGGTGGCGGGAGGTCCTGGCCATTAACCGACTGGCAGAGACCAATGATGGCCCACAAAAGAACCGCCAGGCAGCGGCTTACTTTCT
GCTTACACAGCCATTTTCAGATGCATAATGCAGAAGGATAAAGGAGCAAAGGACCCGGGTATATCCATGTGAGTGGGTGCCGGGGCTGGGTACGCACCATTTAGTGGCACGGCGGAAGCT
GAATCGGCTTACAGTTTTGCGCCAGCAGCATTAGAAACTTTACTCATTACGCTGCCAACCTCAGTCGCCAAACCGCAGCAAAGCACCCGGAGACTGGCAGAGCCAAAGCCGGAGCCGTAG
CCGGAGCCGGAGAAAAAATTATAAAGAAGAAAAGTCCGGAGAGTGTGAGAAAGCAGCACTAAAAGTGAAAAACTATGTTGGAAGACAGCACGACGCCCAAGGATCTCCGGAAGAGTGGGG
CCCGGTTGGCGCCACAAAATGTAAGGAAAAACCAGACCCAAAAACCGCTGAAAGCCCCGCCAATCCGCCCAGTCACCCTGCCACCCACCATCCGTTGTTGCGAAAAAAAAAACAACTAAA
GGCAGCACACAGAAATCCGCCTAAGTTGTGGGTAATGCTGGCGTAAAACAAAAGCTTATCCTGTTACCGCTCCCGCTCCTGGAACACAGATCCTACGGACGAGCTTGATGTTGCTGTTGG
CGAAAAGGCCAACCACGGAAATACATTGCCATACGCCGCAGCATGTGGCAGGGCGAGTGAGAGTGAACCAAGGAAGCCAAAAGGAAAAACGAAACAAAATTAGGGGCATTTTAAGTTGAG
GCAACTAGGATACCCAGGATACTACGTATATTTAGATGTAACAATAGAATATAAGCTGAATAATTGTATTAACTATTTTCTTAGTTTGATTGAGTTTAGAGATCTGTAATTCCTTCAGGT
TTACTTAACCTATTGACCTATTTAACCAAACCCGTATACTAATAGAGATTATATGAATCCCAAAAGTAAACAGACTCGAAATACCCTCGGCAATTGTCAACTGTAGAACAACAAACGCCC
CGCCACGTTGCACAAAAAGGAGCCGCAGAATGGCAGCGTCGAAATATGTAGTCCGTAACCCACTATCCACTGGGTGGCTGGAGTTCCGGAAAAGGTGGTGGACCCCGACTGGCAACTGGC
AACTGATAGTAGCGGACTTTTGGCACTGGCACTGGCACTGGCGCTGGCGGTGCAACAGGGTGTATTACGGTCGTTAAGTTATTACCTACAACGTCGCCTCCGCCTCCTCCTCCGCCTCCA
ATGGCTGCGGAGCACAATGCCAAAGTTTACACCGTCGAAAGTTTCCGCTGGGAGCCAAGGAGCATTCCTTGAACAGCCAGTGGAGAATGCCAGGCATGAATTGTTGTTAATGCCGCCTCC
ACCAACCACCCACCACGCAGGACATCCCCCTTAACTTTCTGCAGTCAGAGTTGGAAAAGCGCAGCGCGGATTTTCCCTGACTTGGCGAGGAAAAATAATAAAAAAGTGCGGAATAATTTC
ATAGGAGAGTCAGGCGGAGAAGGGAGTCCATAGACTCCATGGCATTTTTATTAGACGACGTGGCCATTTTGGCGACTCCCTCACAAAAGTCGCCGGCATTATGGTAATTAAAATGTGGAA
TTCCCAGGAATGGCTTGATTGCTTCAGCACTTTGGGTGACTAAAAGGAGTAAACTTCAGGATCTAGAATTTAATTGAATTTTTAATAACTTTTTAAGGTTATTTATTTATTTTACCATTT
ATTTATTCCGATCCACTTTCCGTTCCAGAAACAACGTGGACCTGGCTCCGGGAGATCGCTATGTGAGGATAGCCTTCGCCGAGGCGGCCAAAGAGATCGATCTGGCCATCAACAACACCC
TGGACATGCTCTTCTCCAACCGATCGGACCGTGTGCAACCGAACTACGGGGAGCTCCTCCGGGTATTCCGCTTCCCCACCGGCCAGGCCAGGCAGCTGGCCAGAGCGGCCGAGATCTACG
AGAGGACCCTGGTCAACATCCGGAAGCATGTGCAGCGCGGCGACAACCTGACCATGGAGAGCGAGAAGTACGAGTTCCGGGACCTGCTCTCCCGGGAGCATCTTCACCTGGTGGCCGAGC
TGTCAGGATGCATGGAGCACCGAGAGATGCCCAACTGCACGGACATGTGTTTCCATTCGCGGTACCGCAGCATCGACGGAACGTGCAACAACCTGCAGAACCCCACCTGGGGCGCCTCCC
TAACGGCCTTCCGGCGATTGGCTCCGCCGATCTACGAAAACGGCTTCAGCATGCCCGTGGGGTGGACCAAAGGGATGCTCTACTCGGGCCACGCCAAGCCCAGTGCCCGACTCGTGTCCA
CCTCCCTGGTGGCCACCAAGGACATCACGCCCGATGCCAGGATAACGCACATGGTGATGCAGTGGGGTCAGTTCTTGGACCACGATCTGGACCATGCCATTCCCTCCGTGAGCTCGGAGA
GCTGGGACGGTATAGACTGCAAGAAGAGCTGCGAGATGGCCCCGCCCTGCTACCCCATCGAGGTGCCTCCCAACGATCCACGAGTCCGGAACAGGCGCTGCATCGACGTCGTTCGCTCCA
GTGCCATTTGCGGCTCCGGCATGACCTCTCTCTTCTTCGACAGCGTCCAGCACCGCGAGCAGATCAACCAGCTGACCTCCTACGTGGACGCCTCTCAGGTTTACGGCTACGCCACTCCCT
TTGCCCAGGAGCTGAGGAACCTGACCTCCGAGGAGGGACTACTCCGGGTGGGAGTGCACTTCCCGCGGCAGAAGGACATGCTTCCATTCGCCGCCCCGCAAGACGGCATGGACTGTCGCC
GGAACCTGGACGAGAACACCATGAGCTGCTTCGTTTCTGGAGACATTCGGGTGAACGAGCAAGTGGGCCTCCTGGCCATGCACACCATCTGGATGCGAGAGCACAACCGGCTGGCCAGGA
AGCTGAAGCAGATAAACCCCCACTGGGACGGCGACACCTTGTACCAAGAGGCCCGCAAGATAGTGGGCGCCCAGATGCAGCACATCACCTTCAAGCAGTGGCTGCCTCTGATCATCGGCG
AGAGTGGCATGAAGATGATGGACCAGAATCCGGGATACAATCCGCAACTGAATCCCAGCATTGCCAACGAGTTTGCCACTGCTGCCCTGCGTTTCGGCCACACCATCATCAATCCCATCC
TGCACCGTCTGAACGAGACCTTCCAGCCCATTCCCCAAGGACATCTGCCGCTGCACAAGGCCTTCTTCGCCCCCTGGCGGTTGGCCTATGAGGGCGGCGTCGATCCCCTGATGAGAGGAT
TCCTGGCCGTGCCGGCCAAGCTCAAGACCCCGGATCAGAACCTCAACACAGAGCTGACGGAGAAACTCTTCCAGACCGCTCACGCCGTGGCTCTGGATCTGGCTGCCATCAACATCCAGA
GGGGAAGGGACCACGGCATGCCCGGCTACAATGTCTACAGGAAGATGTGCAACCTGACCGTGGCCCAGGACTTCGAGGACCTCGCTGGGGAAATCAGCAATGCCGAAATCCGGCAGAAGA
TGAAGGAACTCTATGGGCACCCGGACAACGTAGACGTATGGCTGGGAGGCATTCTGGAGGACCAGGTGGAGGGCGGAAAGGTCGGTCCCCTGTTCCAGTGCATGCTTGTTGAGCAATTCC
GGCGCCTCCGCGACGGCGATCGACTGTACTACGAGAATCCCGGAGTCTTTACGCCGGAACAGCTCGTTCAAATCAAGCAGACCAACTTTGGCCGCGTCCTGTGCGATGTGGGTGACAACT
TCGACCAGGTCACCGAGAACGTCTTCATCCTGGCCAAGCACCAGGGTGGCTACAAGAAGTGCGAGGACATCCCTGGAATAAATCTGTATCTGTGGCAGGAGTGCGGCCGTTGCAATGACA
AGCCGGCCATTTTCGACTCCTACATTCCAGAAACCTACACCAAGAGAAGCTCGAGAAAGCGCAGGGATCTCCAAGGGAAACAGGAGCACGATGAGGTGACCACAGCCGAGAGCTATGACA
GTCCATTGGAGGCCCTGTACGACGTCAACGAGGAGCGCGTGAGTGGCCTGGAGGAGCTGATTGGCAGCTTCCAGAAGGATCTGAAAAAATTGCACAAGAAATTGCGCAAGCTGGAGGAGT
CCTGCAATTCGGTGGACTCCGAGCCGGTGGCCCAGGTGGTGCAGCTGGCAGCTGCTCCGGTGTCCGTGCCTGTCCAGGGAAAGCAAAGACGGAGCCACTGCGTCGACGATAAAGGCACCA
CCCGGCTCAACAACGAGGTATGGTCGCCGGACGTCTGCACCAAGTGCAACTGCTTCCACGGGCAGGTGAACTGTCTGCGGGAGCGATGCGGGGAGGTTAGCTGCCCGCCGGGAGTGGAGC
CACTTACGCCTCCGGAGGCCTGCTGCCCACACTGCCCGCTTGTCAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTTCTCCGGGAGTGCGGCCGGTCCTATGGCTGCAGCTTCTCGGCCTGGTCCTCATTTTTGGAGGAGCAGAGTCCGTCTATTGTCCGGCCGGATGCAATTGCCTGGAGCGCACCGTT
CGCTGCATTCGCGCCAAGCTGTCCGCCGTGCCTCAAGTGCCGCAGGACACCCAAGTGCT
AGATTTGCGTTTCAATCACATCGAGGAGCTGCCGGCGAACGCGTTCAGTGGCCTCCCCCAG
CTGACGACACTCTTCCTGAATGACAACGAGCTGGCCTACCTGCAGGATGGGGCCCTCAACGGACTCCCGGCCCTGAGATTCCTCTATCTGAACAATAATCGGCTAAGCCGCTTACCGGCC
ACCATCTTCCAGCGCCTGCCACGCCTCGAGGCGCT
GTCCCTGGAGAACAATGACATTTGGCAGCTGCCTTCAGGACTCTTTGATAACTTGCCGCGCCTGAATCGCCTGATCTTGTTCAAG
AACAAGCTCACCCAACTGCCAGTGGATGCTTTCAACCGATTGCACAGCCTGAAGCGCCTACGTTTGGACAGCAATGCCATCGATTGCAACTGCGGCATCTACTCGCTGTGGCGCCGCTGG
CACTTGGATGTCCAGCGTCAGCTGGTGGACATCTCCCTCACCTGTGCCAGTCCCCAGCACCTTCAGAAACAGAGTTTCGGAAGCCTCTCCGAGCAGCACTTCAAGTGTG
CCAAACCCCAA
TTTCTGGTGATTCCCCAGGACACGCAGGCGGCGAGTGGAGAGCAGGTGGTGCTAAGCTGCGAGGTAACCGGGCTGCCCCGACCCCAGGTCACGTGGATGCACAACACCAACGAGCTGGGC
GAGGAGCAGACCGGCTCGGAAGTCCTCGCCAGCGGCAGCCTGCTCATCCGGAGCGTGAGCGCCAGAGACATGGGCATCTACCAGTGCATAGTCCGCAACGAGATGGGCGAGCTGCGTTCC
CAGCCCGTCCGTTTAGTGGTCAATAATAACGCACCAGCAGGAGGAGGGGAGCAGGAGTCGGAGAACCAGGTGTGGGCGGTTGCCGGCTCATCACCCACGTCGTCCTCGTTACCATCGTCA
CCCGCGCCACCGAAATTCACCCATCAGCCTCACGACCAAATTGTGGCTCTTCACGGACCCGGACACGTGCTGCTCGATTGCGCCGCCTCCGGCTCCCCGCAGCCGGACATACAATGGTTC
GTCAATGGCCGCCAACTGACCCAGTCCAGGCCCGATCTCCAGCTGCAGGCCAACGGCAGCCTGGTCCTCGTCCAGCCCACCCAGCTGTCAGCCGGCACGTATCGCTGCGAGGCGCACAAT
TCCCTGGGTTTCGTTCAGGCCACCGCCCGCATCGAGGTGAAGG
AACTGCCCGAAATTTTAATGCCCCCGCAAAACCAAACAATCAAACTGGGCAAGGCCTTTGTGCTGGAGTGCGACGCC
GACGGCAATCCGCTGCCCACCATCGACTGGCAATTCAATGACCAGCCCCTTATCCCCGGCTCCCGTGCAGACCTGCTGCTGGAGAATGAAAACACCGAGCTTGTGGTGAGCAGTGCCCGC
CAGGAGCACGCCG
GGGTCTATCGCTGCACGGCCCGAAATGAAAACGGGGAGGTGAGCGCCGAGGCAACCATCAAGGTGGAACGATCCCAGACGCCACCGCGAGTCGCCATTGAGCCGAGC
AATTTGGTGGCCATTACAGGCACCACCATTGAGCTGCCCTGCCAGGCCGAACAGCCGGAGGACGGCCTGCAG
ATTTTGTGGCGCCGCGATGGCCGACTCATTGATCCGAACGTGCAGCTG
ACGGAAAAATATCAAATAAGCGGCACGGGAAGCCTCTTCGTCAAGAATGTGACCATCCTGGACGGCGGCCGGTACGAGTGCCAGCTTAAGAATCAGTTCGGCAGGGCCTCCGCCTCCGCT
CTCGTCACCATCAG
AAACAACGTGGACCTGGCTCCGGGAGATCGCTATGTGAGGATAGCCTTCGCCGAGGCGGCCAAAGAGATCGATCTGGCCATCAACAACACCCTGGACATGCTCTTC
TCCAACCGATCGGACCGTGTGCAACCGAACTACGGGGAGCTCCTCCGGGTATTCCGCTTCCCCACCGGCCAGGCCAGGCAGCTGGCCAGAGCGGCCGAGATCTACGAGAGGACCCTGGTC
AACATCCGGAAGCATGTGCAGCGCGGCGACAACCTGACCATGGAGAGCGAGAAGTACGAGTTCCGGGACCTGCTCTCCCGGGAGCATCTTCACCTGGTGGCCGAGCTGTCAGGATGCATG
GAGCACCGAGAGATGCCCAACTGCACGGACATGTGTTTCCATTCGCGGTACCGCAGCATCGACGGAACGTGCAACAACCTGCAGAACCCCACCTGGGGCGCCTCCCTAACGGCCTTCCGG
CGATTGGCTCCGCCGATCTACGAAAACGGCTTCAGCATGCCCGTGGGGTGGACCAAAGGGATGCTCTACTCGGGCCACGCCAAGCCCAGTGCCCGACTCGTGTCCACCTCCCTGGTGGCC
ACCAAGGACATCACGCCCGATGCCAGGATAACGCACATGGTGATGCAGTGGGGTCAGTTCTTGGACCACGATCTGGACCATGCCATTCCCTCCGTGAGCTCGGAGAGCTGGGACGGTATA
GACTGCAAGAAGAGCTGCGAGATGGCCCCGCCCTGCTACCCCATCGAGGTGCCTCCCAACGATCCACGAGTCCGGAACAGGCGCTGCATCGACGTCGTTCGCTCCAGTGCCATTTGCGGC
TCCGGCATGACCTCTCTCTTCTTCGACAGCGTCCAGCACCGCGAGCAGATCAACCAGCTGACCTCCTACGTGGACGCCTCTCAGGTTTACGGCTACGCCACTCCCTTTGCCCAGGAGCTG
AGGAACCTGACCTCCGAGGAGGGACTACTCCGGGTGGGAGTGCACTTCCCGCGGCAGAAGGACATGCTTCCATTCGCCGCCCCGCAAGACGGCATGGACTGTCGCCGGAACCTGGACGAG
AACACCATGAGCTGCTTCGTTTCTGGAGACATTCGGGTGAACGAGCAAGTGGGCCTCCTGGCCATGCACACCATCTGGATGCGAGAGCACAACCGGCTGGCCAGGAAGCTGAAGCAGATA
AACCCCCACTGGGACGGCGACACCTTGTACCAAGAGGCCCGCAAGATAGTGGGCGCCCAGATGCAGCACATCACCTTCAAGCAGTGGCTGCCTCTGATCATCGGCGAGAGTGGCATGAAG
ATGATGGACCAGAATCCGGGATACAATCCGCAACTGAATCCCAGCATTGCCAACGAGTTTGCCACTGCTGCCCTGCGTTTCGGCCACACCATCATCAATCCCATCCTGCACCGTCTGAAC
GAGACCTTCCAGCCCATTCCCCAAGGACATCTGCCGCTGCACAAGGCCTTCTTCGCCCCCTGGCGGTTGGCCTATGAGGGCGGCGTCGATCCCCTGATGAGAGGATTCCTGGCCGTGCCG
GCCAAGCTCAAGACCCCGGATCAGAACCTCAACACAGAGCTGACGGAGAAACTCTTCCAGACCGCTCACGCCGTGGCTCTGGATCTGGCTGCCATCAACATCCAGAGGGGAAGGGACCAC
GGCATGCCCGGCTACAATGTCTACAGGAAGATGTGCAACCTGACCGTGGCCCAGGACTTCGAGGACCTCGCTGGGGAAATCAGCAATGCCGAAATCCGGCAGAAGATGAAGGAACTCTAT
GGGCACCCGGACAACGTAGACGTATGGCTGGGAGGCATTCTGGAGGACCAGGTGGAGGGCGGAAAGGTCGGTCCCCTGTTCCAGTGCATGCTTGTTGAGCAATTCCGGCGCCTCCGCGAC
GGCGATCGACTGTACTACGAGAATCCCGGAGTCTTTACGCCGGAACAGCTCGTTCAAATCAAGCAGACCAACTTTGGCCGCGTCCTGTGCGATGTGGGTGACAACTTCGACCAGGTCACC
GAGAACGTCTTCATCCTGGCCAAGCACCAGGGTGGCTACAAGAAGTGCGAGGACATCCCTGGAATAAATCTGTATCTGTGGCAGGAGTGCGGCCGTTGCAATGACAAGCCGGCCATTTTC
GACTCCTACATTCCAGAAACCTACACCAAGAGAAGCTCGAGAAAGCGCAGGGATCTCCAAGGGAAACAGGAGCACGATGAGGTGACCACAGCCGAGAGCTATGACAGTCCATTGGAGGCC
CTGTACGACGTCAACGAGGAGCGCGTGAGTGGCCTGGAGGAGCTGATTGGCAGCTTCCAGAAGGATCTGAAAAAATTGCACAAGAAATTGCGCAAGCTGGAGGAGTCCTGCAATTCGGTG
GACTCCGAGCCGGTGGCCCAGGTGGTGCAGCTGGCAGCTGCTCCGGTGTCCGTGCCTGTCCAGGGAAAGCAAAGACGGAGCCACTGCGTCGACGATAAAGGCACCACCCGGCTCAACAAC
GAGGTATGGTCGCCGGACGTCTGCACCAAGTGCAACTGCTTCCACGGGCAGGTGAACTGTCTGCGGGAGCGATGCGGGGAGGTTAGCTGCCCGCCGGGAGTGGAGCCACTTACGCCTCCG
GAGGCCTGCTGCCCACACTGCCCGCTTGTCAAGTAA

Retrieve as FASTA