Entry information : DpePxd01
Entry ID 7653
Creation 2010-10-22 (Marcel Zamocky)
Last sequence changes 2016-02-17 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-17 (Achraf Jemmat)
Peroxidase information: DpePxd01
Name DpePxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Arthropoda Insecta Drosophilidae Drosophila
Organism Drosophila persimilis    [TaxId: 7234 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DpePxd01
start..stop
S start..stop
DpspsPxd01 3071 0 1..1534 1..1529
DmPxd-A 2699 0 15..1530 18..1527
DerPxd01 2692 0 19..1530 21..1526
DyaPxd01 2679 0 19..1530 21..1528
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1342060..1342220 161 N° 2 1360876..1361091 216 N° 3 1361203..1361274 72 N° 4 1361353..1361594 242
N° 5 1361672..1362343 672 N° 6 1363964..1364173 210 N° 7 1364293..1364471 179 N° 8 1364612..1364793 182
N° 9 1368755..1371425 2671  
join(1342060..1342220,1360876..1361091,1361203..1361274,1361353..1361594,1361672 ..1362343,1363964..1364173,1364293..1364471,1364612..1364793,1368755..1371425)


exon

Literature and cross-references DpePxd01
Literature Drosophila 12 genomes consortium (2007) Evolution of genes and genomes on the Drosophila phylogeny. Nature 450:203-218.
Protein ref. UniProtKB:   B4H1J9
DNA ref. GenBank:   CH479202.1 (1342060..1371425)
mRNA ref. GenBank:   XM_002024692.1
Protein sequence: DpePxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1534 (1514)
PWM (Da):   %s   171492 (169078.8)  
PI (pH):   %s   6.18 (6.15) Peptide Signal:   %s   cut: 21 range:21-1534
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWWRGVLLFHLFLLAGWSEAAYCPTGCNCYERTVRCIRAKRTTTPQVPYDTQVLDLRFNHFEEVPADAFRGMGQLSTLFLNENELAHLQDGAFQGLLALRFLYLNNNRLSRLPAAIFQGLPRVEAIYLENNDIFQLPAGVFDNLPRLNRLFLYNNKLTQLPVEGFNKLNSLKRLRLDGNAIDCNCGVYSLWRRWHLDAQRQLVTISLTCAEPQALQRQSFASLQEQHFKAKPNLLVAPQDLQTFAGESVQLDCEVTGLPKPQITWMHNTNEVGEDQVNREILLSGSLLIRSVATTDMGIYQCLARNEMGEVRSQPIRLVVSSSSSSNRNPLDNPHIDPRSNQVWADADGNANADAGGATPTPPSFTHQPHDQIVALHGAGHVLLDCAASGWPQPDIQWFVNGRQLAQSTASLQLQANGSLLLLQPTQLTAGTYRCEASNRLGTVQATARVEVKDLPEILMAPQNQTIKLGKAFVLECDADGNPLPTIDWQFNGSPLASTPAGDLLLENENTELVVSAARQDHAGVYRCTARNENGETSAEATIKVERSQSPPRVAIEPSNLVAITGTTIELPCQAEQPEVGLQISWRRDGRLIDPNVQLTEKYQISGAGSLFVKNVTILDGGRYECQLKNEFGRASASALVTRNNVDLAPGDRYVRIAFAEAAKEIDLAINNTLDTLFSNRSSTGPPNYGELLRVFRFPTGEARQLARAAEIYERTLVNIRKHVQRGDNLSMSSEEYEFRDLLSREHLHLVAELSGCMEHREMPNCTDMCYHSRYRSIDGTCNNLMHPTWGASLTAFRRLAPPIYENGFSMPVGWTKGQLYAGHPKPSARLVSTSVVATKEITPDSRITHMVMQWGQFLDHDLDHAIPSVSSESWDGIDCKKSCEMAPPCYPIEVPPNDPRVRNRRCIDVVRSSAICGSGMTSLFFDSVQHREQINQLTSYIDASQVYGYSTPFAQELRNLTADEGLLRVGVHFPKQKDMLPFAAPQDGMDCRRNLDENTMSCFVSGDIRVNEQVGLLAMHTIWMREHNRLATKLREINPHWDGDTLYQEARKIVGAQMQHITFKQWLPLIIGESGMQLLGEYKGYNPQLNPSIANEFATAALRFGHTIINPILHRLNETFQPIPQGHLLLHKAFFAPWRLAYEGGVDPLLRGMLAVPAKLKTPDQNLNTELTEKLFQATHAVALDLAAINIQRGRDHGIPGYNVYRKFCNLSVAEDFEDLSDISNAGIRQKMKELYGHPDNVDVWLGGILEDQVEGGKVGPLFQCLLVEQFRRLRDGDRLYYENPGVFLPEQLVQIKQANFGRVLCDVGDNFDQVTENVFILAKHQGGYKKCEDIPGINLYLWQDCGNCNSMPTIFDSYIPQTYTKRSSRQKRDLRQPKEKEQEEVPATESYDSPLEALYDVNEERVSGLEELIGIFQKELKKLHKKLRKLEDSCNAVDAEPVAQVVQLAPAPAPVAPKPRRSHCVDDKGTTRLNNEVWSPDVCTKCNCFHGQVNCLREKCGEVSCPPGIDPLTPPEACCPHCPMLKGELP

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns). no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGTGGCGAGGAGTGCTCCTGTTCCACCTGTTCCTGCTGGCGGGCTGGTCGGAGGCCGCCTACTGTCCGACGGGATGCAACTGCTACGAGCGCACCGTGCGCTGCATTCGCGCGAAG
CGCACGACCACTCCGCAAGTGCCCTACGACACCCAAGTTCT
GTGAGTATTCCTCTTCATCCTTTTCCGGGGGATTGGGGCTCTGTTCTGCATAAATCATTCTGGCTGTTGGCTTTCCAAA
TTCCAAATTCCATAAATTAGTTTTTAATGTTTTCCGTTGGCCCTCTGCAGGCGGCAGTGGCGTTAATTTGATGCCCTGCCCCATCTGTGCCAGCATCATCTTTATCTCCATGCATCCAAC
CTAACCTCCCACCACCATCAACACCCCCACCCCCACCATCGTGTTGACTCAATTAAACGGATGTCTAGAGAGAGAGCTGCCTGGGTTCTGGGCTCTGGGTTCTGGATTCTGTGTTCTGTG
CTCTGTGCTCTGTGCCCTGGGATTTGTATATTTATCGCACGCCATGCCATGCCCCACACAAAGCGATTGGAGGCGACGCAAACACAACGCGACTACGCGACTCGCAATATTTGCATGCAC
GCGGAATACTTCTGACGTTGCATTTATTTTCCGAAATGTCAGCAGCTTTCGCATGAATTTCGGGAGCCACACCACCAGAATCCGAATCCTCGAAGCGGATTTGTGGGTGGATGGAGCGGC
GGATAACTTGGCAAATGTTTGTGGAGCATATGCATATTTATATAGGCCGCGGCATGCTTTCTCCTCCTGCCCCTCCATTTGGGGCAGCATCTGTGCTGTGCTCTGCTGTGCTGTGCAACG
GTAGCAGCTGCCACAGCCGGCGGCAAGTTGTCAGACGACAGATAGAAAGAGAGACAGCTCTGCTCTGGAGGTGGAATTTCTCCTGGTATTTATGGGGGAATTCAATTTTCATTGGGTTAA
GTTGTTGAGCGAACGATGGAGGATGTACACGAATAAACTGACAGATATTCACACATTCTGTCAGCCAGAGAATGGGCTTCTTCTGTACGGTGCTGCAGTGTGCTGCACAGTGGCTACAGA
GACAGATTTTACCGGATGAAAGATCTATACGGATCCAAGTGAAAGAAGAAGTTCTGAGCTTGAGGAAAAACCCAGTGATGGCCGATTTCAAATTGAAAACAAGGGGCAGGTCCACATTCA
CCATCACCAGTGCAACATAGAGATACATATGTATCTACCAAATTCATCGAGAACCTCCTGCATTTCGGCAGTCATTCCCAGCCTTATCCCATAAGCTCCACAGACCTGGCATAAGCAAAA
AGAATTCTTTGTTTATCCATCATCCGAAGTCGCATACTGCAAATCCGCACTCCATATCATTCCTCTGATCCTCTACCATTTGTTGGCTCGCCGCACAACAATTTCTCAAAGAAGTGAAAC
CCCAAACCACACCCACCCCCACAAAAAAGGAGTAGCCACAGAGAGCACAGACGGAGGGAGGCACTTTTGGCAGTACTTAAATTAATCTTCATTTTAAATAAGGTGATGGCTGCATAATTT
ATCATTGCCCCGAGAGCTGAATGCACACAAAACACTCACACAACAATAGGAAAAATTCCAAAAGAAGGAGAAGGAGAGGGAGCAACAGAGACGGGGCGAGTGGTGGTGTGGATGCATTCA
GCAACTTTTCTGATTCCATTCTGATTCGCATTTCATTTATTCCGCATCCGACCCGTTGCACACTTTTAATTAATTTGTTTCATTTATAACGAGTACGAGTACGAGTACGACTACTGCATG
TGTCTAAAAAAGTTTCCCTGGTTTTTCCTCCAGCTTGTTCTTCCCCTTTGCCCCCTTCCCCCTTCCATGTGGTGTGTGCTTTCCATGGGCAGCAGCCCACATGTTTATGTGCGGCGAGTC
GACTCGAGTCGGGTCAGATTTTCTCCATTTATATTTCATATTTTCTCAAAATGTTCACTCGAATGCCTCCTAAAATAAAATACAAAGAAAAAAAAAAACAAAATGCTCGCATGTACTCGT
ACTAGTCTCCAGGCAGAGGCAGAGGCAGAGGCAGAGGCAGTGACAGACATTATATTTTTGTATTTGTTTGTGCTCTCCGATGCGCATGGAAATGTTTTTGCCTTAATTTTGTTAATGGCC
AAAATGTTGTTTATAATTTTCGTTGCTGGAAGATGCTTCGGGTCGGGGCTCTCGAGATAGATGTCGGACAGAAAATGAAATGTAAAGAAGCAAAGTCAAATAAAATAGTTTATTCAAACG
AATTCCTTAATATTCATCTCAAAAATGTGTTTTATTTGAACTCCAGAAACCTCTTGGATCCACTATTGCCAAATCAAAGAATTCTTGGCTCAAAAGGCTACACGAAAATGTATCTTAAGC
CAGAAATTCTCCTGAAATTTGTTGTAGAAGAGATTGAGAGCCAGATATCAAATCTTTCGAAGCTTTGGGGTTCTATTTTTGCATATCCTGCAATGGTCTCACAGATAAACTGTTAAGATT
TTAAGAGTATATTCAAATGAATGAGAGCTTCCATGTTATAGTCCTACTTCTAATGTGATATCTTGCCTGCAAGTCTACACTTGCTTCGGGGAAAATATCCTGTATATTGCTATCCGCACT
TCATTGAAAAAGCCTTCCTCTCCAGCTGCTGCTGCTGCTGCAGCGCCAGCACCAACGCCAACGCCAGCTCAGGGCCTAAGCCACATTTCACTTCCTTGAAACTGTCCATCCATCAAGCAT
AAAGTCCTCTGCCTTTTTTTCAGCTTTTGCCTCCATTGAAAGTTCCGCTTTCAATGGCTGCTGGGTCGCAAAAAAGAACTGCAACTCACTCTGCCTGCCTCTGCCCCATCTCAGCCCCTT
CCCTTGCCCTCCGTGCCCTTCGGGCCCCAACAAAAGGCCAAACATTTTGGGTCTTTCCGTGTGCATTTTGAACTTGCAACTAAATGGAAGTCCGAGCCGAGACTCTGTAACATATGCGAG
CGGCGGCCGGCAACTTGCATCATTCATCTTGCCACACGCCACTCCGCCCACCCACACACATGGCGCTTGGCGCTTGACGCTGCAAAGGGGGCGAAGGGGAGGCTGCAGTTTTTTTTGCTC
CCTTTCCATCGGAGCTAAATAAATGCACTTGATTTCATTTCATGATGATGCATTTTCCGCTGGCCTCCCATAAACCACACACATTTCTTGCCTCCTCGGAGGCAGTTGCTTTGTCATTAT
ACGAGCGGGGCATGCCACACTCGAAGCCGTGCCTCCGCCCCTACTTTCTTTGCATAGAAGAGCGAACCACATAAAATACAGATGGAGCCCGTGCAGCAGATGAACAAAATCTATTATGCA
CTGAGAAAAATGGTACTATCTTTGCACTCCAAAAGGAACTTTAAACGTGAAACCCCCTCAAATATATATACCTTCCTTTTGCCGGTCAAATATGGGCATTGAAAACCGCATTATTCCACA
CGATTCATTAGCTCTGGGATGGGGTTCATCTGCGAGGCCATAAATTATCTCTATTGGTTATTTTTCTAATTGAATTAAACACCGGTCGTGCCATATCGTATCACCTCATATTTTCCCATA
AATCACTTCCCCAAAAGGACAATTAGTTGGCTTTTTGCAACGACTTTGAGGCAACAGTTTGGCGTACAGGAAAACAAGACCAAAAAAAAAGGGAACTTTAACTTGAGAGGCTTTCAGATC
AAAGTTAATGATATAATATGCCAAGAGCTTGATTTAGTTAAGTTTCATTCAATTTGGAAAATAATATTGGAGCAAAGGCATATGGAAATGGGTTTAATATTAGCTTGGTCTCGGCTAACT
TTTCCATGGAACTTTTCCATATATGCATTGACGTATCGAATATTTTTCAAACATTTGCATTGTTCTTTTTCTTTTTATTGTTTTTGCGAGTGTGGCCTCTGGTCTTTGCCTCTTGGAGGC
TCGGCAGCGGCGGCAGCGCCTTGTGCAATCTAATAACTTCGGGCATTATGCACATATGAAATATATCTCATCTAATGTCTGCCCCTCCCCTCTCTGTCCGCCTGCCTGTGTGGGTGGCTT
TGCTGTTGGAACAAAAATCGCCTCACGTTGCCATATGCCTGGCATATTAAAAACTTTGATTAGTGTCCAGTTCGCTGGCTCTTGCCACGCCCACGCCCACACCACACACCACACACATAT
GCATTGTTCTGCATAATATATGGCCACTACATTGCGATGTACATTGTACATATGTACATATAGTATTTGCTTGGATTTTTGTTTGTGAGTTTTGTGAATCAACTATTTGGGAAAAGTATT
TTTTGTTTGCCCAAAAATTGTTTCAATCTGCCCTCCCGCTCCAATACGCTGGCTGGCTGGCTGGCTGGCTGGCTGGTTGGGTGGCTGTTTTCTTTCTCCCTCTTTGGCTGCTCGCTGTTT
TTCTTCTCTTTCTATTTCGCTGTGTGCCCCCCTCTCTCTTTCTCCCATTCTCTCTGTGAATTTCTCATTTCGTTTTTGGTGCATTTATGCGTGACAAATGCCTTGTATTTTGTGTAGCGC
TCTACGGGTCGTCGTCTCCATATCCGGGCTCCTGGTTCCTGGTTCCAGGATCTCCTCCTCCTCCTCCTCCTTCTGCCATTCCCCCTGTTCCCTCTGTTATTAAATATGCATAAATTTCCT
TTTTGCACATAGCATTCGTTGCTGCTGCTGTTGTTTTTAGTTGCTGGAATTTTGCATTTACATTTGCTGTTTATTTGTCGGTGGAAATATTGAAATTGTTGCCAATGGATGTCCTAGCAG
CAGCGGCAGCAGCAGCAGCAGCTTCTGGGTCCTGCCTGCATTTCCTGGGGGACTCGAAGTGAAATGATATCCAGGGTTTTCCGTTCAGGTGTGGTTCTTGTTGGAATAATTACAGCAGAA
GCAGAATCCGAATCAGAATCAGCAGCAGCTGTGCCTCTGGCTGTGGCTGTATCTGTATCTGTGGCTGTGGCTGGGGCTGTCTTTGTGGAATATGCCCAAATATTGTATCTTCTGGATGGC
AGGAAGCTGTTGCAAATTGTCTAAAGATTGCCTAATTTGCTTGTAATATTTGATTTGATTTAATATGCATCCCTCAAATGCATTTCATATGGATTTAATTAGTTTTTAGCTTCAATTGAT
GCGAGCATCAAATGTTAATTGAATGATGAATGCTTATGGGATTATTATTAGGAAATACTCAAAGAATACCAGATGTTCATTTAACAAATTAGTTTACACACTCGAAGAACTGCTCCCCAT
CTCCCTCTGTTTCTCCCTCTCCCTCTCACTCTCTGTCTTCCTGTGGCAGATCCATCCATCTCTGTTTGCGTTTAGTCCCTGGCAATAAATCCCTCTAAATGCAATTGCCAATTCAATTAC
CAATCAATCAAAGAGCATTCAAACTTCGTCCTTTGGAGCTAGCAAATCCCCCTCCCCTGACACACACACACACGCACTCCTCGTCTGGCTCCTCCTCTCCTCCCCCCCGTTTCGTGTGCA
ATACAATATCATTGCTGTAAGAGCTTTTTTCGGCTGCAGTTGCAGTGTTTGGTTTTTGTGGCATTCAGTCTGACTTTTCGATTGTTAAATATTTGCAGGGCGGGCAACAAAAGCCCGACA
CGGCACTGAAAACAAAATGAATCCGATTCTGTTGGCCAGAATGTGCCACTCAATCGGTAATATGATTTGTAATTATGCAAATGAAGCCGTCCCCCAGTGCACCACCAATAGGGAAAGGGC
AAAAAGAAAAGCAGAGAGGCAGAGACGGAGAGAGAGTCAAATGGGAGTTACATTTTTGGATGATTAAAGCTGAATGAGAAAAGTTGTCCGCCTCAAAGGGAAAGGCAGAAGCAGGGCAGG
GCAGAGGCAGGGCAGGGCTGGGGAAAGGGTCCCCAGCGGCAGGGCAAAGTTTTTGCCAATCAAAGCGTATGCATTTTTAATTCACTGCCAAATGCAGATGGAATGAAGGAGATGGCTATC
GAAGAGAGACAGAGAGAGAGAGAGAGAGACCAACGTGAAGGAAGCCGAATCTCGAGTTGCATCGAGAGAGCGGGGGCCCCAATGCGATTCTGTCAAGGAGCCTGTCCGACTGTCTATCTC
TCTGTCTCTGTGCCTGCCTGCCAGGCTGTTCGCTTCACTTTGACATAGAAAAATCTTCTATTGATTTCGCCTTGCCACATGCAGCATGCAGCATGCAGCATGGCTGCCCCCAATCGTATC
AGCCATCCCTCTTTTGGCTCCCTCTTCAGCCCCACCTTCTCCTTCTCTCCCCCACTCCCCCACGTCTCGTCACGCTGTGCAATTTGCATTTAAAGTTTAGCTTTTTTCTTTTTGCCATTC
TCCCTTTTGCATTCCTGCCAATTCCTTTGCTTTAATGCTACAAAGTAGCACTTGCTTCATTGCCATCGTCCACGCCCCCAGTCCCAGTCCCAGTCCCAGTCGCAGCCCCCAGCCCTCAGC
CTCTGGCCAACGCCCACACGCTTTGTCATTTCGCATGCTCGTTAGTGCAGAGCAAAGAATGCAAAATAGCAAGATACTGGCGGGATAGTAGGTGGCAGGAGGTGGCAGGAGATAACATGC
AACACCACCAACATCATCGCTACACAAACACATGCCACAATTTATAAGCAAAGTTATTTTGCCCCAGCAGAAAAAAAACACGAGGTGGGAAAGGGCTGGGGCAGGGGCTGGGGCTGGGGC
AGAGCTCGGTTGCCCCGATAGCAACCGGCAACATGTCAAAGTGGAGCAATCGGCATGTGCAACGGACACGGAGCAGAACGGACACAGACACGGACACGGATTCGGACTTGGAGTCGGAGT
CGGAATCGGACTCTGTCGGAGGCAACTGTCGGTCAAGCATAAGAAACAAGCAGTAGAAGCGGTCCATAAGTATGCAATGGCAAAAGAGAGAAAAACACAGAGACCCAGAGAGACGGAGAG
ACGGAGAGACAGAGAGTGTATATACGAATAGGGGATACCTTAAAAACAAAGGGAAACAGTATCCGTGATAGCTTTGGTAAATACCAGCCTTATGTATCGCCATATCCTTAAAAGTGTATA
AGGGTCAAAGACGAAGTAACCCGATAGAAGAGAAGCAGAGACCTTTGGATAAGTTCAAAAGAGCCAGTATGGATCTTAAATATTTGAAGACTCCTCCGGCTGCTGCCTCCTGCCTGTGGC
ATACCCCAAGCAGCACTCCGGAATTACCTTACCCGTTTTAAGAGAAAGGTAGAATTCTGGAGGAGCCCAAAAGCGGGCGAATGAAAAGCATTGAAAAGGCAAAGGCCTGGAATGCTGAAA
CCTGCGCTGAGAGATGCCGCTGCCGATGCCGTGGCCGATGCTGGCCATCATGTGGAGCCGACCAGGTAAAGTCAACAACAGAGTCAGAGTGGCAGCAGGGCGAGTGGAAAAAATGTAAGA
AAAGATGCCACTGCCACTGGTAGGGCTACTGCCCTGCCGCTCACTGCTCGACGAGGCGGCAAACTAACCCCACCCCCGTCCAGAGCAGGTCCAGGGCCAAGTGGCAGACCACGTAGCCAA
GGCAGCGGACAGATGCATAGCCGTAATAATGTTAATGTAAATGTTGCAAGTGGAGCAGGTACAGGGGCACAGGGGCACACGGGGCAAGTCGAGTGGCCATCAGTTGGCCCGAGCTGCTGC
TGCTGTTGAAGATTCTGGCAGATATTAACATGGCGTATACGTAATGGTTCCGAATTAGTGGACTGAATTATCTTTAATATTTATGCTATCTATAATATAGTGGTTATTTATAAGGATAGC
GGGGGGTTCTTTGGGGTTTCAACTAGCACTCTCGACTTACCTCTACTCCGCGAGAAGAAGTCGAGCAAAAGGGGATTGGAAGATCACGCGTTGCGACGGTCCACAAGGAAATTGTACAAG
GTGGTCCGCTAACTCCCGTTCGGGTCTTATTTCACGAAAGAGTGAGCGCACTAGAGAGAGCGCTGATGAGAAAGAGAAGAACGAAGCCTGCTGCTGTACGACCCGAAAGGAGAGCGCGTG
GCGAGAGCGGACCACCTTCCATACCACCTGCGGGTAGTGGCGTTTTGGTGCTTAAGCGGAAGAATACAATGATGAGCAAAGGAATAGCGAAAGGTATAGCTCAAATGACTATGAACTATA
GAAGGCTCAAATAAGCGGCTAAACGATCCTCAAAAGCTTATTTGGCTCAGGTTCAATACCACATACCACGTACTCGCTCAAATGCATTGCAATGGGGGAAATTGCCTTTAAAAGAATTGG
AAATGAGTTTGAAAATAGCCGAAATACACAATAAAAGAACTTAAATTTAATATCCTCCCCCCCACCAATGCCACGCCCTAATCTAATACCCAGAACACACACACAGTGCAAAAAATACAA
TATATGTAGGAGGACTGGCATAATATTCGGCTTTTATCCGCATATTAAACCATTTCCACTTGAATGGAGAACTGATTTCATTGCGTTTTTATGCTCGTACGATCCATATATCGTACGCAA
TGCTCCTGTATATGTACATATATCCACTCCACTTCACGTGCATTGTGTGTGTGCTTCCCTTTTTGGCTCTTCAAATATATAAAATATATCCTAGTGCCAGATGGGAGAAGGCGGAAGGCA
GAGGAGACAAGGGAGGGGCATATAAATCTGCTGTATAATTGAATTTCACACGCTGCCAAAATATCAAATAAAAAATAAATAAAACCCAAAAAGCAACGAAAGTTTAAATAAAATTTAGTT
CAACAAAAATACCCAAGCGGTGAAGGGTGGGGAGGGGGGGTGGGAATGGCGGAGTGTGAGCTGCCTGAAAATGTGAGAATTATAACCGAACTGAACCGAACCACCTCCCCACTCTCCCCC
AATGGGCACCCTTCTTCTGGTAGCCACTTTTAACCATGGAGGTGTTGACCGAACTGCAAGCAGCTTAAGCAGCATGCCACAGCAGTCACCAGTCACCACGCAACAGAGCAACCCGTCGGT
GGAGGGGGGTACGAGGAGTATGAAATCCTGTGGAGAATGCAGATGGGAATGAAAGTCCTGAGGAGATTGCAGATGGGAATTGAAGGTCCTCAGGAGGAGGGGGACGGGACTTGCTCTGGG
AATGGGAATGGGAATACTCGCTTGTATGCTCGCTCCTTTAGTCGGACGGCAATTGCATGTGTGGCAAGTGCTCTTGTGAGACATTTACACCTGTAAAAACATTTGGACCAGAGGAGGGTA
GGAGGAAGAGGAAGAAGCAGCGGCAGCAGCAGCAGCAGCAGCAGCCGGGGGCTGGAGGAACAGGAAGAGTATGGAGCTAAGGGGAGCATAATATTGGGAGTAGAAGAAATAAGAGCACGG
AAAGGAATGGAGAAGGAGAATCATTAGCAGGATAGGCAGCAGTGCCTGCGGGGGGGGGACCACCAGTAGGGGAAGCAGTACCTGGAGACCAGAGAATGGTGATGGCTGATGGCACAACAC
ATTAGCAGCCCAAGAAAACAGAAAATAGAAAACAGAAAAGTGACGCTCGAGCTGTGACAAGAGCAGTCCTCGTGTGTAAAGAACAGAGCAGAACAGAACAGAACAGAACAGAACAGAACA
GAACAGAACACTCTATAAATAGAACTAAGGACACCTAAGGACGATCTAAGGGGAGAGCTAAGAGAGCTGCAGGCACCCAAGGAGTGCAGCACGAGGAGAGTGCACTGCCTCAGATGACCA
GCAATTTGGAAAGGCTTCGAAATTTGTTGCTTGGGAATTTCCTTGCTTTATCTCCAGCTGGTTTTCTGGTTTCAGGTTCGACTTTTCCTACTGCTTTTCTTTGGGAGTTGCCCTCCGCTG
CTCCCGCCGCTGCTCCTGCCCTGCTCCTCCTCCTGCTGTTGGGGAGTTCTTCTTTTTGCGAGTTTTTTCAGTGGCAGCCCAAAAGTATGCAACGAAAGTTTAGATTCCACCCCTCCCTCA
CGCTCGCTCGCTCGCTCGCTCCGACTCTCGGAAGTGAATTTTCCGCACGTGGCCTAACTTTTGCTGCCTGGCTCCGTGGCCCCTCCCAGGACGCACCATTCTGGCGTGTCATGCAGTCAG
CAATCTTTATCCAACCCCCAGCCCCCAAACCCCCCTCGCACTCCCACTCGACTGCACGCCCCTTTGAGTGGGCGCCTTTCATTCTTTTCTTGCGGATTTTCCTCGAGGATTGCATTTAAC
GCAGAAACAGGAAGGAAGGAAATGCCATGTCGACGCTAAAACTGGGTTAGCTTACATAACGACAACATTAACGACAACGTTTTCCTTCCTCTCAAACAGGGGGTCGGCGGGGCAGGGCAG
GGCAGTGCAGGGCAGGGCAGATGGCGGAGGAGGAGCTGAATGAAGCCATGTAGGAGGGCGTTCGCTTCACGCTTCGTCGCTTATTGGACATAATTACTGAATATAACAATTCTGTGGTGT
GTGCGGCATGGGGCATGGACTCCGCCTGCCATAGCCACTTGTGCGTAACCGCAGCAGCGACAGATAACTGCAACAAAAGCAAAGTCCGGGGCATGCAGCCAGCCAGCGATGGTGTGCTGG
GGCCAAAGGACCCACATATCAATTCCGTGTGAGCGGACATCGTGCAACTTCTTGTTGCAACAGTTCCCGGCCGGACAGGAGCACCGCCCCGGTTCCTGGTCAGTGGAGAAGAGCAGGCAT
CCGTTGCCTTTATCGCTTACACTTGGCCAAAGCCCCGCTTTTATGCTTCTTTTTTTATACCCGATACTCAAAATGAGTATTGGGGTATATTAGATTTGTGGTAAAAGTGGATGTGTGTAA
CGTCCAGAAGGAATCGTCCGTCTGTCCGTCTGTCCGTCCCCTTCAGCGCCTAATGCTCAAAGACTATAAGAGCCAGAGCACCGATGTTTTGGAACCAGACTTCTGTGATATGTCACTGCT
ACAAAAATATTTCAAAACTTTGCCCCGCCCACTTCCGCCCCCACAAAGGGCGAAAATCTGTGGCATCCACAATTTTAAAGATAAGATAAAACCAAAAACGCAGAATCGTAGAGAATGACC
ATATCTTATAGACTTATAATCTGAATTGGATCGTATTATTATTATAGCCAGCATCAAGAAAACAATTTCATTTTTTCTCGCCCTATCTCTCTCTAACACACACGTAGCATAGGCGGCTTT
GCTTAGAGTAAAACATTAGCGCCTAGATCTCAGAGACTATAAAAGCTAGAGCAGCCAAATTTGGTATCCACACTCCTAATATATCGGACCGAGACGAGTTTGTTTCAAAATTTCGCCACA
CCCCCTTCCGCCCCCGCAAAGAATGCAAATCTGGGGATATTCACAAATCTCAGAGACTATTAAAGCTAGAGTAACCAAATTTGGTATCCGCACTTCTGTTAGATCTCACTATAAAACGTA
TATCTCAGAATTTCGCCCCACCCCCTTCCGCCCCCACAAAGGACGAAAATCTGTTGCATCCACAATATTGCAGATTCGAGAAAACTTAAAACGCAGAATCATAGATAGCGACCATATCTA
TCAGATTGCTGAATCTGGATCAGATCAGATCATTTTTATAGCGAAAGGAAACAAATCAATTTGCACTGGCTACGCAGCGCCCGACGTCACGCTAAGACTGATTTTCTGTCTCTCTCGCAC
GCACTCTTTGTCGTGTCGATTAATATAAGCGGCGTCTGCCGGAGGAGAGCCATACTGACTTAGTATCGGGTATAACTGTAGAGTTGCGGTGTCCGCAGCAACTCACAACGTTCCTCCTCG
TTTTTTTTGTGTTTGGCATTGATTCAACGGAATCCTTAAAGTTGAACAGTTTTAGAGTTGGATTTGGGGTTTGGGTTTCGGGTTTCGGGTCTCCGATTTCCGATTTCCGATTTCGGATAT
TGGGTCTGGGCTTGGAGCGTAATGCCAACGAAACTTTTGGCCCTTTTGTCACTTTTGGAACAATGTTAATTGCTTTAGAGTTTACTTTTCGACTTTAGCTTCCCGGGATAAAGGGGGGCG
GGGGCGATGGGCGGTGGGCGGTGGGCGGATGTCCCAAGGCATGCATTAAATTGTGCTGATCTGCTGCATGCCATGGTTTGGCTCTTTTGTTGCTTTGTTCGAATGGAAATCGGAGCTAAA
CAAAGCGTTTTATGCATGCACACTCCAAGCCAATTACGCAAAGTGCTCTAAGTATCTCAAACAGCAGCAGCAGCAGCAGCAGCAGCCGGGGGCAGCAACCGACCCAAAACTGGACACAAT
TACATTAACAGTTTAGCACACACACACCGATAGAGGGAGAGAGGGAGAGAGTGTGTGTGTGTGTGTGCAAGGATTGAGGGCAAAACAAACAGAATGAAATTAAATCAAAGGCTCGAAAAT
AAGCTCTGGAAAAGGAGTGCTGCCTGCTGCTGCTGCAGTAACCAACAGTAACCAACAGTAACTAACTGGGCTAAAAGCTGTTGGCTTGTCTTGGCCCCTTGTGCCTCTCTGCCGCTGCAA
TCGTCCCTCCCTCAGCCTCTGCCACTTGCTGAAGCTGTCAGACTGACAAAGTGACTGCCTGACTGACAGCTGAACTGTTACATACACCAACACACACACACACACACACACAGAGAACAA
CACAAATAGACGACTGCACACAAATAAACAATGTCAAGAGTTAAAAGCGGTAGGGTAGGGGGTAGGGGTGGAGCTGGGGGTGGCACTGTGCACAGCTTTTGTTTAACAATAATAAAATGG
CACTACTATAGAAAAAACAAAAAATAAGAACAGCCTGCAGGCGAGTGGCTCGACCAAGAGGATACCCCAGGGCCCAGCATGGATGCAACAGCCCCTACTGATCTTGCATCGTCCATTATC
GGCACTCCAAAGCCCAGTCCTATGGCTCCATAGGATGGATCTCGACTATGGATGATAATCCAGATTGTGTACCCTTTCTGGGATCGTCCTGAACACAACATACCCTTGGTAGCCCTGGAA
ATGCCCGCCAGAACAAAGGCAAAGGGCAGGAGGATCCCCTCAGTGCAATTGTGATCTGTGGCATAGGCTGAAGGATTGCATTACCAAGTGTTTTACACACACACACACAGCACAGAGACA
AGCAGAAAGACAAAGACAATTGTCATGGGTCCTTCGGACTATCGTCAGGTGTAAGGGGGGGAGGAGACCATCACCTGGGCAGGGCAACCCCAGCCAACAGAAGGACACACGGGTATCCGC
AGATGCAAGGATGAGCTCCGCCATTGTAGGGCACTTTTATCCATTGTTGTTGTTGCGGCTGCCACTTTTTGTTGCAGCTTCCTTGCTGCGTGTTTGTAAGCCATGTTATTACAATAATGT
GTCTCCCAGTGTGTGTGTGTGTGCGTGCGTGCGTCTGTGTGCATGCGTGTGTGTTTGCGGCATCCTTCCATCCGTCTGTGTATCTGTGCATCTGTGCATCTGTGTGGGTTGTGGAGTGTG
GAGTGTGTGGCAGGCCAAAGTTAAATCATGTTTTTATTGTCACATTTGCCATAAAGGCAGCCCAGGGACCAGAGCCAGAGCCAAAGCACACCAGCAGCAGCAGCAGCAGACCGTAAAAGG
ATTTGGATCGGCTTGCAGGAATGGGAGCAGGGGCACAAGGCGTCATAAGATGCTGCCTAAGCTGTAGGCCCACCTGAGAGGAGCACAGAGACGGAGGGACAGAGAGGCAGGGGAGGCAGG
GGAGGTACATATAGGATGTAAGCCAGACAAATCATAATCAGAGCCAACAACCAGGCCACGCAAGGCGAAAGCAAAAGGCAAGTCCCAACAAAGCACAATTTCACCTTAACAACGAGGCAT
GGCCGAGAGGGGAGAGTGGGACTAAAGGGGGGGTTGATCCCACTGATAAGGCAGCAGCGGCAGTAGCTGCACCCTCCGACGCAGCCACCCCACGTTTATAGCCTTGTTTATGTTGCATAC
TTTATGGCGCTTCAAGGGGTTTCGAACGGGAACAGAGGCAGAAAGATACTCCGGGGAGGGGGGGAGGCAGGAGCGTGTGGCGCGCGCGGAAAAAATGGCAGAGAGTCTAATGAAAATGCA
ATGAACTAGAAAATAAACTGACTCAATGGATAAAAGCCAACTAACGTTGAAAGCGGAACAGCGCGCAGCGAACAGCAAACCAATTTCAATGCAGGAAGCAGGATGCAGGAGGCAGGAGCC
ATAGTTACGAGCATAAAAATTAAACATCTGCTCTGTTTATTGCCGGTCTTATATTGTCTGATGGCAGGGGCGTTATCTTCCGATATAACAATAGCCACAAATGGCAAATGGAGAGTCCTT
AGAGGCTCTTTTCATGAGCCACAAACGAAGAAGGAATCGAAGGACATAGAGCTGTTGCTCCGACCTAGCTTTTCAGTGAAGAAAAGCCCAACACTCCTTCACACTCCTGCCCTAGGAAGG
GACTTTCCACTCCAAAACTCTTCCGAAATGGGGCTTTTAGTCCCTAGAGAAACTTTGAACAATCGAAATGGCAATTCGAGTGCATGGAAGACCACAGTTCTGGCCAAAAACGACAATGCA
ATTGAGATCTCTAAGCGAATGCCACAAACATTTACTGTCAAATGTGCGCCGCCACAAACAGTTACTGCCACACCTCCCCCACACGCCCGCCACACGCACAGTCTTGCCGCACTCTTGTCG
CTGCACTGCATGTTGCATGTGGAGGGCCGCTCTCTAATTTACTTGCTGTGGTTTTTCCTTCACTAATTGTGACAACTAATTGAAATCAAATTAGTGGAAGCCACTAAACAGCTTAACGCT
CGCTGAGCATGTATTTGATTGTGTCCCTCCCGATCTCCCCCCTTGTTGCATGCTGCATACTGCATGTTGCATGTTGCATGGGGTGCCAATTGTTTTCATTCAATTTACTGTCGGAGGTGG
CTTTAAAATATCGCTCTTGGCCTCAGTTTTGGCTAGCCATAAATTTTCCTCAACGGACATCAAAGCGTATACGTAATGGCCCACCCAGTGTGCGTGTGTGTGCTTATGAGAGTGTGTGCG
TGTGCAGGCATGCGTGAATAGACAAACAAGCGAGAGAGAGAGCGAGAGAGAGCAGGCAAATGCCTTTGTCAATAATATGCATTAATTAAGTGCAGACATGGACACCGGGGACACAGTCCA
CAGTTCACAGTCCACAGTCCGGCGTCCACAAGCCAGCAAGGAGTCGACGGAGCAATGGAGCCACACAGCAGGGTTGCAGCACGGTTACGGATACGGCTACGGATACGGATACGGGTAGGG
GCACGGGCACGGGCACCGACACAGAGGCACCGACACAGAGGCAGGTGCCGTACCGATTCGAACCGTGCCGCACCGGACACAGCTTGGCACTCGCTTTATGCATTTCAAATTTTAATTGAA
AATATCGTCCGAATTTAATGCAAAAATGCAAATGTCATTATCCAAACAAAAACAAAAAAAAATAGCCATTTTCCAAAAGCTGCAGCAGTGGCGGAAGTGTCACAGCATTGAATAGTAGTT
TCAAGATTCAATTTCCTTTTCCGCCTGCCACGCACACATGGACACATGGACACATGGACACATGGATGGGGCAGGTGGGCCTGCAGGTGGGCTTAGGGCGTGGTCTGCCTGGAAGAATGA
AAGTTATTTGTGCCGCCTTTGAGCATCTGTTCGGTTGGGACTCGCTTCAGTTCTCTCTTTTTGCATGGCCGCTGCTCGACAAATAGTTGCGCCACTGACATGACGCCAACTATGCGGCCT
GCCACTGCCACTTGCCACTGGCAGTACCTCTGCCGCAGAACAGGAAGAGGCATAGGGAACATCTGCAGCTGCTAGGCTCGTCGCCTGTCGACCGTCGGCTTTGTGGACTCTGGACTCCAC
TCCGGACAGGATGGCGTATGAGTGTGTGTGCACCATTGAAGTGGACCATCGTTTGTCACACGCGTCATGGGTGGGCCTTCCCCTGACGCGTGCAGAAGCAGAGGCAGAGGCAGAACAGTG
GTGGCACAGTGGCATGGAAAAGGGTCCGGTAGCACTTTGCCTGAACAAATAAAACAGAGATGATAGCCGGTGTCTTCCAGGGATAAAAACGAGCTCAGAATGTTGATTCAAATTAGTCAG
ATAGTTATGGTGCCACACTCCACACCCCCCCCCACAGCCCCTCCCACTCGCTTGACCCAATGTGGCAGAGGACTGCCGCTGCCCCGTGTGGATTGTTGGGTGGTTGGGGCTAATGGAGTT
TGCAAGAAGTGGGCGCAAAATGTGGATCAAGCAGCCGCATTCGCACTCGCACAAAGGGTTGCTCTTCGTCTTCTGCTGCTGCTGCCCCTCCTGCAACATAGTGCGGCTCCTGCTCCTGCT
CCTTCTTAGAGAGAGAGAGAAAGAAATGCGAGCCTTTGCAAATTGTTGCTGCACCCGCATCCCAGTCGCCATCGGTCTGGACCACCGACAGCCTCTGCCTCTGCCTCTACCACTGCCTCG
CCCCACTCCACAGCCACCGCAACGTGCATGTGGCTGCCACACAAGAGAGATGTGGATAGAGAGTGTAAGAGAGAGGTTACCACATGGATACCAGTGGGTCGACTAGCCTCAGGACTTGGG
TCTTTCATCAGGCCAGAGCCGGAGCCGTAGCCGGAGCCAGAGCCAAGACCGAAACCAGATAGCAGGAGGCAGGAGGCGGCAGGCAGGAGCCAGGAGCCAGGGAGTCGCCGTGGCAGCGGC
AGTGGCGGCTTTGTTTATGTGTGGCTCCATTTGGGCGTATGCATGTCCTTCTCCTACGGCTTCTCTCCCTTGGATTTACTCCATGGTGGTTGCATGCCCCCTGCCCCTACCCCTGTCCCT
GCCCCTGCCTCAAGCTCTACGTGCGAGTGGTTTTTGTGTTGTTCTGGATTTTTAAGTTGTTTTCGTTGTCGTTGGTTGTTTGTGATGTTGTTTTTTGTTGTTTTTGCTTTTTTTTTGTGT
GCGTTCATCTCCTTTTTTGTGTGTGCCTTTCCTTGTGTTGCATCCACGTCTTTAGTTGCAATTTGAGCATACCAACAAACATATGCACTTAACACACACGAACATGGACACGAGCACGGA
CACGGAGCACTCACACGGAGAAAGGATGAACGCTGACACCAATTAGTGCCTCCTGCTGCTGCTGCTGCTGCTGCTGCCGCTGCTGTTGCAAGTTACTGCTGCTTCTGCTGCTGCTGCAAG
TTAGTTAGTTGCTGGGTTGTTTGTGCGTTGCATGTTTACACTAGCCACAAAACATAATTTCTGTTTAGACAACTTTAGCGGCAGCCCCACTTTCCGGTTTTCCACTTTCCGTGCCGTTTG
TGGCCACAGGAACGGCCCCTGTCCGTGCAGCACCTTCGCCCTCTGCTCCTGCTGCTGCTGCCCCTCGACAAAGGGGAAACGTGGCAGGAAGGATACCCTGGACGAGCCAATCATTGCTTT
GCTTCAGACTACCAATTGTTCCTGTGGCAGCTATATGATATTGCGATCCCATCTGATCCTCACTGAAAGCCAACATGAGGCAAGCATCAGAATCCTATTACCCCGCCCCTAGGGCATGGG
TATGGGCCCATAATTATCGCAACAACGAAGTTGGCCAAAAAGGCAGCAGGCAGGAGCAGGCAGCAGGCAGCAGGCAGCAGTTTGCATTTTTGGTATAATTTTCACTTTTGCCAAGGAAAC
TTTTTCGCTGCCGCATTGAATTTGCAACCAACTAAAACCCGCCACACCCGCCACACCCGCCACACCCGCCACACCCGCCCGACCCAGACCAGCGGTTGCCGCTGTTGCAGCTTGCAAACT
TCCTGAGTTGATTAGAAAGTTGTTTTTTTAGCCGCTGTTGCTGCCACATCCTCCCTGCAGTTGCTAATGGCAGCTTAGAGCAAAAGGAGCAGGGCATGGCAGCGCAGGGCAGGGCAGGGC
AGGGCAGGGCAGGAGGATGTTGCAAGGCCCCCTCGCAGCTCGCGAGCATATGCGAGGAGTGAGACCTCAATCTGTGGTTGAGTTCCTCGTCGTTTGGTTGCTTGGTGACTTGGGATTGTG
GCATGGTTGCTACTAGGGCGCGCAAAGCTTATCGCTTCGGTGGCTTGTCGTCAGGCAGCAGGCAGCAGGCAGCAGGCAGCGGCAGCAACATAAACTATGCGAGCATCAACTTTTTTTGTA
ATTAATTTTTAATGTGTGTGCAAAATAAAATGTTTACGTACATAAATGTTCTTGTAGTTTCTGCCTTCCCCTGCCATATCAAGGGGATGTGGCTGGGAGCGAAAGGGTTTATCAAGCGCT
CTAAGAGGCGGATAAGCAGCGCTTAAGTGGGTGCCACAGAGGAAGAGGAAGGGGAAGAGGAAGAGGGTAGCTATGATTTAAGATTGTGTTACGCCCAGAGGAAAATAATTGGATTGCCTT
AAACAGCGTTGGCTGTTGGATACAACAAAAAAGAACGATGCCTGACAAATGGGTTTCTCTTGTGCGGAATATACACGCCTTTCTATCAATCCCTAATTGCATATGACAATTGCTATTGCA
CCCACTATCCCAAAGAGAGAGAGAGATAGAAGAAGAAGAAGAAGAAGAAGAGCACATGACAGACAAGACGGGAAGGGAAGGGACAGGACGGGACGGGACAGGACAGACACTGGCAACTTG
CTGCAATTTGCTTTGGAACCAAAAATTGATTTACCCTCGACTGCTAAACGTGCCACATCCTCCTGCCAACCATCCATCCTTCCATCTACGTCCCCATGTCATCTGCCAGATAAACGATTT
GCTCCATACAGCTACAGCTACATCTACTGCTACATCTACTGCTACTGCTATCATGATTTCTCACTTTGTTCCTCCTCTTTTCCGTACATTTTGCAGAGATTTGCGTTTCAATCACTTCGA
GGAGGTGCCGGCAGACGCTTTCCGCGGCATGGGGCAACTGTCGACGCTGTTCCTGAACGAGAACGAGCTGGCCCACCTGCAGGATGGGGCCTTCCAGGGGCTGCTCGCCCTGAGGTTCCT
CTATCTGAACAATAATCGGCTAAGCCGCTTACCGGCGGCCATCTTCCAGGGATTGCCGCGCGTGGAGGCGAT
GTAAGTGAAACGCGGCACAGCCCTTAATTAAGGATATGCAGAAAGGCA
TAAATCGCCTTAACGACGCCCACTTTTCCGCTTTTCCCCCTTTCTCCCGCCCTCCACTGTTAGATATCTGGAGAACAATGACATTTTCCAGCTGCCTGCCGGAGTTTTTGACAATTTGCC
ACGTCTGAATCGCCT
GTAAGTTGGATGGATGGATGGATGGATGGATACGAGAGGGAGATTAACTTTTTTGGTGGGTACATCTCCATTTTCCAGCTTCCTTTACAACAACAAGCTCACCCA
ACTGCCGGTGGAGGGATTCAACAAACTGAACAGCCTGAAGCGTCTGCGATTGGATGGGAATGCCATCGACTGCAACTGCGGTGTGTACTCCTTATGGAGACGCTGGCATCTGGATGCCCA
GCGTCAGCTGGTGACCATCTCCTTGACCTGTGCCGAGCCGCAAGCCCTGCAGCGCCAGAGCTTCGCCAGCCTCCAGGAGCAGCACTTCAAGTGTG
GTAAGTGCGAACAGAACAGAGCTGA
GAGCTGAGAACGGAGAACTGAGAACTGCACTTCAATCTTTCACCCGTTGCAGCCAAGCCCAATCTCCTGGTGGCCCCACAGGACTTGCAGACCTTCGCCGGGGAGTCCGTTCAACTCGAC
TGCGAGGTCACGGGTCTGCCCAAGCCCCAGATCACGTGGATGCACAACACGAACGAGGTCGGCGAGGATCAGGTCAACCGGGAAATCCTGCTAAGCGGCAGCCTGCTCATCCGCAGCGTG
GCAACCACTGACATGGGCATCTATCAGTGCCTGGCCCGCAACGAGATGGGGGAGGTACGCTCCCAGCCCATCCGCCTCGTTGTCAGCAGCAGCAGCAGCAGCAACCGGAACCCACTGGAC
AACCCCCACATCGACCCTCGCAGCAATCAGGTATGGGCGGATGCGGATGGGAATGCGAATGCGGATGCAGGAGGTGCAACACCCACGCCACCGAGCTTCACCCACCAGCCGCATGACCAA
ATTGTGGCCCTTCATGGCGCGGGACACGTGCTCCTCGATTGCGCCGCCTCCGGCTGGCCACAGCCGGACATACAATGGTTCGTCAATGGTCGCCAGCTCGCCCAGTCCACCGCCAGCCTC
CAGCTGCAGGCCAACGGCAGCCTGCTCCTCCTGCAGCCCACCCAGCTGACAGCCGGCACGTATCGGTGCGAGGCGAGCAATCGCCTGGGCACTGTCCAGGCCACCGCCCGCGTGGAGGTG
AAGG
GTGAGTGTGACACAACAACTTCCAGAAGTAAGGGGGGCTGGGGGGGCACGGCACTCGTTTCGGGATTGCATTTCAGTCACTGCCAGACGACATACCATCGTCCGCAGTCCGCAGTC
CGCAGTCCGCAGTCCACTGGCAACACAGTCACAGTCACAACTGTCGCGTTTTACTCAATTTGCAGTCGATTTAATTTGTTTTCGCCTGAGATGAGGATGAGGATGAGGATGAGCATGGAC
CATGAAGCATGCAGCATGAAGCATGCAGCATGGACTCTGCGACTAGACACTGAGATTGAACATGGAGTCTGCTTTGGATCGGGGTGTTCGGGACTATGCGGAAGAGCTTGTCGAGGGGTT
TTCATAGATGATTGGATTATGTCAGATGTGGCGGCAAAACGGTGGCAGAAGGGTGCTCCTCCGTCAAATCAGAGTACAGAAGGACGGGACGGCACGGGTACTGCTGTACGAAAAACCTAA
CAAAAGAAGAGCATTCAAACTTTTGGTTTAACCACGAATAAATGTATGAAAACAATGTTTCGCTTGAGCATTTTTATGTTCATTCGTTATTGCTGCAATTCAAGCGTTTGTACGTGACTG
TACTTTATTGCGCAATAGAAATGGACGGGGGGCCAGCAGGGGAAAACGCCCTGATATGTCCATAAGGGAAGGGGTTCCCAGACCGACCGACCGACCAACAGACCGACAGACCAACCGAAT
GCCAGAGGGAATGATAGAGTGGCAGAGTGGCAGCGCCTTGATGCAACAATGGCTCATTATAATTTGTGGTTGTCGGCACAAAATGAAGAGCAGACAGCCGGAGCAAAATTTATGCATTAT
TTTGGAAAATAAGTGCAAAAATTATAAACTATTATGTAGAGGGGGGGGCGGGGGGTACGGTACGCACAAATTGCGAAGCTGCGGTTATCCCGAAAGTGCAGTGCTGCAGAGGTGCAGAGG
TGCAGAGGTGCAGAGAGGTGCAGGGGACGTGCGAGTGTATGGACTGTTTAAGCAGTCAGGCGATGCGCTTGGTCAGCATAATTAACCCGGCAAACACACTCACATACCCATAAACAGATG
CACAGAGAGAGAAAAGCTCGAATGTTTTCCGAGTCCATTTCCAGTTGTACAAAATATAGATCAAAGAGGCATTTTCCAAGATAGTGTTTTCATTCTTCTGTCGATGTGCAGATAAAATAT
ATGGGTTTGGTGCAGATTTTCTCGGAGTGTAGGGGCAAATGCATGCACTGGCGCACACACACATTCACGAGCATATGAATAAGCAAATAAATATGCTGGCACCGCTCAAAAGTATGCAAT
GCAAAAATTTGTATTCCAAACGCCCCAGGGGGCAGGCGGCAGGAGGCAAAGCAAAGCTGTGATCAAAGCGAATGGAGGGGCGTGCAGTGGGAGGGGGGAGAGGGAGAGGGATATCGAGTG
GGATACAGAGTGGAACGAAGAAAGAGTTTATGGACAAAAGGCGGAATAGAAAACGAACCGCAGGCGGCGTCGGCGTCGCCGTCGGCGTCGACGTCGGCTATGACCATGTGCCTTTTTTGT
TGCTGCCATTTGGAGCGATAGAATTGCTCGAAAATCGCTCATCCGCGATTCATACCACTTGCAGATTTGCCCGAAATTTTAATGGCACCCCAAAACCAAACAATCAAACTGGGCAAAGCC
TTTGTGCTGGAATGCGATGCCGATGGCAATCCACTGCCCACCATCGACTGGCAGTTCAATGGATCCCCGCTCGCCAGCACCCCGGCCGGAGACCTGCTGCTGGAGAACGAGAACACAGAG
CTGGTGGTTAGTGCTGCCCGCCAGGACCATGCTG
GTAAGTGGTTCAGTGCGGGGCGGGACCTCTCGGGAAAGTGATTCCAAATGGCTTACATTTCATTTCATTTCTCTCTCCCCTCCCCA
CCCCTCCGCTCACCGTGCACGTCCCTGTTGCAGGTGTCTACCGGTGCACGGCGCGCAACGAGAATGGCGAGACGAGTGCCGAGGCAACGATTAAAGTGGAACGCTCCCAGTCCCCGCCTC
GGGTGGCCATCGAACCGAGCAATTTGGTGGCCATTACGGGCACCACCATTGAGCTGCCCTGCCAGGCCGAGCAGCCGGAGGTGGGACTGCAG
GTAAAGTTTCCCGAACGGAATATCCCAA
AAAACTTTTCTTTTTTATTTGCCCCGCCACTTGTTGACGCTTCCTTTGGCTTTCCCACCCCCCCGCCACATCCTCTCCCCCTCTGTCTATCTCTCCCTCTCTTTACATACAGATTTCGTG
GCGCCGTGATGGTCGCCTCATCGATCCCAATGTCCAGCTGACGGAAAAGTATCAAATAAGCGGCGCCGGCAGTCTGTTCGTGAAGAATGTGACCATCCTCGATGGCGGTCGCTACGAGTG
CCAGCTGAAGAACGAATTCGGAAGGGCCTCCGCCTCGGCGCTGGTTACCATCAG
GTGAGTGGCGGTGGCGAAAAAACCGGGATGCGGAATCAAATAGTTCAACTTTGAGTCTCAGACCGC
AACTTTAATTGCGCTCCAGAGTGGGACGGGATGGGATGGGATGGGGCCGGCATGGCAGGGGGCGGTCTCCATAAAACTCCATTAAAATCAAAAAGGGAAAACTTTTTCTCAAAGAGAGAG
AGCAGAGCAGAGCAAAGCAGAGAGGACTTACCAATAAAAGGCCTCGACAGGCAGACGACGACGACGACGACGACGACGACGACGACGATGCAGTTAAAATGCGTTTAAGTGCGCGGTAAA
CTTGTTTAATTAATTGAAAAATACTCGTAGTTGTGCCACAGCAGAAAAAATATATACACAGCAGCAGTCACACAACAGTGGGAGCTACTGCTTCGGGAAGGCCTGCAAATGCCGCCAAGA
AAAACGCAAAAGCACGATCCACGATGAAATTATGCAAGGTGGTCCGCTCTCGCAACGCGCTCTCATTTTGGGTCTTACTTTGCCCAGTACAACAGCAGAGCGCTCTCAGTAGAGCGTAAA
ATTAGACCCGAAAGAGAGCTGATCTTGAGCTTAAGAAAACACAATATGCAAAGACAGTAAAGAGAAAAAGCGAAAAGGTGTCGCCTCTCCCTTACGTTTTCCTTTCCTGCACACAAATGA
GGAGCCGACGCTTCGCGATTACGCCAAGCGCGTGACGATTTGGAACGAACGAACAAGCAAAAGGAAATCCAATAATTCACAGCAAATTCAATGAGTGCGTAGATTTTTTTGGGTAGATTA
ATGTAGGGTGAGGCCCGACAGGACTGAAGTAACGAGAGAGCGTGAGATCACCAAGACTTGAATGGCTGACCGACCTCACCTTTGCAATGAGACATCTTTGGTACATAAGCAAGTAATTAC
AAAATTTTCAAGAAATATAATCCTGCCATGAAGCTGATTTGAATGCACTTCCAAAAATAGTTTTCAAGGCAGGAAGCCCTGCGAGTGCACCGACAAATGCCAGCCTCAAATGATTTTTTA
ATCCGGCTGTTGCTCCACTGTGCTAAATTGCTTGGAAACCACTCACACTCCTGCAAAGACCCGTTGTCCGGCTGCGAGTCCGGGCCCGGGTCCGCAAAAAAGGCGGCTATGAAAAGAACA
TAAAACCATAAAATAAAGCCAGCAGCTAAACTCCAGCACAGTGGCTAGAAATACATAGGAATCTTGAAAATTAAAACAGCCAAACAGTCGCGTCAGGGTGCTTTTCAGGCAGTTAAAAAT
TTACATAACTTGGCCAATAGCTTGGGACACTTTCCGCCAAATCAGAGCCCACTGTGCCGCTGGCTAAACTGCATATAAAATATGCCCCAAAAAAGAACATCAAAAGGCGGCAACGAAAGC
ACAAAAGTTGTCGTTGCCGAAAACGTGCTAAGCCCCGGACAAGCTACGTGCCACATACCCCACCGTACACACAGATAGAGAGAGAAAGGCGAAACAGACGGGGACAGAGGCAAAGATAGA
CAGAGAATCTCTCACAGAGGCAGCCGCACAAGTTATCCAAATTGCCCAAATTGAAATTGAGTTGACAAGTTGCCGGCTGGAACACGAAAGGAGTACAAGAACTAGAACTAGAAGTGGAAG
TGGAAGTGGTAGTGGTGGTGGAAATGGGACTGGAATCTTCTCCAGCTTTCATCTTCCATGTGCATCTGCATCTGCATCTGCATCTCCCACTTCAACTTTAACTTTCTTTTGGGTTCACAT
ACATATATAGTGGTAGTACTCCTCGAAAATAGAACTTTTCCAAATTGTTTGTTCCGCAAATATGGCAAAGCCAACAAAAAAACACCCAGAAGATGGAAAAGAGACAAGGAATTTATTGAG
CACAGGCTCCATCCACATCCACGGCTGGCTCCCGCCTTGGGTCGTAAATCAATCTGAGGCAAGCAGAGGGAAGCAGTGGCAGGGACAGTGGCATATCTGGCCATTAACCGAGGGGTAAAC
GTTGGACCATTGATGCCCCACAAAGAGAGAACCGAACCGAACCGCATCGCAGCGGCTTAGTTTTTGCTTACACAGACAGGCAGCCTTTTCCAAATGCATAATGCAGCTAAAGGGAAAACC
AGCAGGAGGAGGAGGGGGATCGGAAAATAAGGATTTCCATGTACATGTATGTGGTGCACGCACCATTTAGTGCGGCAGAGCCCGGAAGCCGAATCGGCTTACAGGGGAGCCGTCGGCATT
AGAAACTTTACTCATTACGGTGCCAGCCGCAGTCGCCAGACCGCAGCAAAGGACCAAGAATTAAAAGAAGAAAAACAAAAAAAAGGCATAGCATAGCAGAAGAGTAAGTAGTCCGTAGTC
CGCTGTCCGTGGTCCGGAGAGAGTGTGAGAATGCAACGCTAAAAGTGAAAAACTATGTTGAAAGACGGATAGGAAGTGCAGTGCAGTGCAGTGCAGCGCAGGGCAAGGACAGGGACAAAG
ATCCGGTGTGTAGGGGAGGGAGGAAGCGTGGAAGCGTCTCTCTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTGCCCCTGTTGCTG
CAGCTCCTCCTGGGGCTGCTGCTGGCGAAAAAGGCTAACCACGGAAATACATTGCCATACGCCGCACCGCACAGCATGTGGCAGAGCCAGAGGGCGGCAGGGCAGGGCAGGGCACGGCGG
GGCAGGGAGACCAAAACCAACAAAAAACTTTAGCAAAATGAGGCGACTGCAAGTGGATGGAGACTAAAGGTATACCCTGACTAACATTCCCGAATGAGATTAATTACATTGATGGAATGA
GATATCAGAGGAGCCCTTAAAAAGAACTAGAATCAGAAGAAGACTTATCATAGAAAAGTGATCCATTCTCGAGCATTTGAGAGCATATAGATTCTAGAAAGATTCGCTTGACCTCCTCAC
AGGATTAGAAATTCCTCACATACCCTACACACAAAAACAGAAAAGCAAAGGAGCAACCACAGAATGGCAGAGAGAAAATATATGCACTTGGGTCCTGGCCTGGCAGTGGCCCAGGAGCAG
TGGCTACCCACTAGAAGCACTACCAAACTATCCCACGCAGCAGAGCCACTGATAGTGGCAGACTTTTGGCACGGCACAGGACGGCACAGCAGGGCACTACTTGTGGTGCAACAGGGTGTA
TTATGGTCGTTAAGTTATTACCTAGAACGTCGCCTCCGTCGCCCGTTGTAGTCGCTGCCATCGTCACCCCGCACAATGCCAAAGTTTACACAGGCGAAAGTTTTCCGAGGATTCTGAGCA
TTCCTTGAACAGCCACGCTGCATGGCAGACAGAGAATGTGAGGCATGAATTGTTGTTAATGCTGCCTCCCCACCCCTCCCTTTGCAGCAGTCAGAGTTTGAGAGCGCGGATTTTCCTTTT
GGCGCACAAAAAAGTGCAGCAAGATTTCCAGGGGGTGAGGGGGGAGGACTGTCCGAAGGACACACAGACGGAGAGACGGACAGACATCTAGGCGAAGAAAGGGAAATAAACTGGCTGCCA
TTTTTATTAGACAACGCGGCCATTTTAACGACTCCTCGGAGGCGTCTCTGGCGCTGGCGCTGGCGCTGGCATTATGGTAATTAAAATGTGGAAATTCCTTGAAAATATCTTGATTGTTTC
TTCGCTTTGTGCCGCGTCGTCGCTTTGTGGTGGAATATCTGCTCGAGGAATCTCGAAAGTCTAGCCCTAGGATTGTAGTCCATTGTTGTAAATTAATTGGTCCATTTTTGGGGAATATCT
TCTCCTTGAATCATTACCAGAATCCAGAATCCCCTGTAAAATCCTTTCTTTGCAGAAACAATGTGGATCTGGCACCGGGAGATCGTTACGTGCGCATTGCCTTCGCGGAGGCGGCCAAGG
AGATTGATCTGGCCATCAACAACACCCTGGACACCCTCTTCTCGAACCGCTCGTCCACGGGGCCACCGAACTATGGGGAGCTGCTGCGGGTGTTCCGCTTCCCCACGGGCGAGGCAAGGC
AGCTGGCGCGTGCCGCCGAGATATACGAGCGGACCCTGGTCAACATCCGAAAGCACGTGCAGCGGGGAGACAACCTGAGCATGAGCAGCGAGGAGTACGAGTTCAGGGACCTGCTCTCCA
GGGAGCATCTGCATCTGGTGGCGGAGCTGTCGGGCTGCATGGAGCACCGGGAGATGCCGAACTGCACGGACATGTGCTACCACTCGCGCTATCGCAGCATCGACGGCACGTGCAACAATC
TGATGCATCCCACATGGGGTGCCTCCCTTACGGCCTTCCGCCGCCTGGCGCCGCCTATCTACGAGAACGGATTCAGCATGCCCGTGGGCTGGACAAAGGGCCAGCTGTATGCCGGCCATC
CGAAGCCCAGTGCCAGGCTGGTGTCCACCTCGGTGGTGGCCACCAAGGAGATAACCCCCGACAGCCGGATCACACACATGGTGATGCAGTGGGGCCAGTTCCTGGACCACGATCTGGACC
ACGCCATACCCTCGGTGAGCTCGGAGAGCTGGGACGGCATCGACTGCAAGAAGAGCTGCGAGATGGCCCCGCCCTGCTACCCCATCGAAGTGCCACCGAATGACCCGCGTGTGAGGAACC
GCCGCTGCATCGATGTGGTGCGCTCCAGCGCCATCTGCGGCTCGGGCATGACCTCGCTCTTCTTTGACAGCGTCCAGCACCGCGAGCAGATCAACCAGCTGACATCCTACATCGATGCCT
CGCAGGTGTACGGCTACAGCACGCCCTTCGCCCAGGAGCTGCGCAATCTGACCGCCGACGAGGGTCTGCTCCGCGTGGGCGTCCACTTCCCCAAGCAGAAGGACATGCTGCCCTTTGCGG
CCCCGCAGGACGGCATGGACTGCCGCCGCAATCTCGACGAGAACACCATGAGCTGCTTTGTGTCCGGCGACATACGGGTTAACGAGCAGGTCGGCCTCCTGGCCATGCACACCATCTGGA
TGCGGGAGCACAATCGGCTGGCCACCAAGCTGCGCGAGATCAATCCCCATTGGGACGGCGATACGCTGTACCAGGAGGCCCGCAAGATCGTCGGCGCCCAGATGCAGCATATCACCTTCA
AGCAGTGGCTGCCCCTGATCATCGGCGAGAGTGGCATGCAGCTGCTCGGAGAGTACAAGGGCTACAATCCGCAGCTGAATCCGAGCATTGCCAATGAGTTTGCCACAGCTGCCCTGCGCT
TCGGCCACACCATCATCAATCCCATCCTGCACCGCCTGAACGAGACCTTCCAGCCCATTCCGCAGGGCCATCTGCTACTCCACAAGGCCTTCTTTGCCCCCTGGCGCCTGGCCTACGAGG
GCGGAGTGGATCCCCTGCTGAGAGGCATGCTGGCGGTGCCCGCGAAGCTGAAGACCCCCGACCAGAACCTCAACACGGAGCTCACGGAGAAGCTGTTCCAGGCGACGCATGCGGTGGCCC
TGGACCTGGCCGCCATCAACATTCAGCGGGGCCGTGATCACGGCATTCCCGGCTACAATGTCTACAGGAAGTTCTGCAACCTCAGCGTGGCCGAGGACTTTGAGGATCTCTCGGACATTA
GCAATGCGGGAATTCGGCAGAAGATGAAGGAGCTGTATGGTCATCCGGACAACGTGGACGTTTGGTTGGGCGGCATTCTGGAGGATCAGGTGGAGGGCGGCAAGGTGGGTCCGCTGTTCC
AGTGTCTGCTCGTCGAGCAGTTCCGTCGCCTGCGCGACGGCGATCGCTTGTACTACGAGAATCCGGGCGTGTTCCTGCCCGAGCAACTCGTCCAGATCAAGCAGGCCAACTTCGGACGCG
TCCTGTGCGATGTGGGTGACAATTTCGACCAGGTCACAGAGAATGTGTTCATCCTGGCCAAGCATCAGGGCGGCTACAAGAAGTGCGAGGACATTCCCGGCATCAACCTCTATCTGTGGC
AGGACTGCGGCAACTGCAACAGCATGCCCACCATCTTTGACTCCTACATTCCACAGACGTACACCAAGAGGAGCAGTCGCCAGAAGAGAGACCTCCGACAGCCCAAGGAGAAGGAGCAGG
AGGAGGTCCCAGCCACCGAGAGTTACGACAGTCCCTTGGAAGCCCTCTACGATGTCAACGAGGAGCGCGTTAGTGGCCTGGAGGAGCTGATTGGAATCTTCCAGAAAGAGCTAAAGAAAC
TGCACAAGAAGCTGCGCAAACTCGAGGACTCCTGCAATGCCGTAGATGCCGAGCCAGTGGCTCAGGTGGTGCAGCTCGCACCAGCACCGGCCCCCGTTGCCCCGAAGCCCAGGCGCAGTC
ACTGCGTGGATGACAAGGGAACAACGCGGCTGAACAACGAGGTCTGGTCTCCGGACGTGTGCACCAAGTGCAACTGCTTCCACGGCCAGGTAAACTGTTTGCGGGAGAAGTGTGGCGAGG
TGAGCTGCCCGCCCGGAATCGATCCTCTGACGCCGCCAGAGGCCTGCTGCCCGCACTGCCCGATGCTCAAAGGAGAGCTGCCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGTGGCGAGGAGTGCTCCTGTTCCACCTGTTCCTGCTGGCGGGCTGGTCGGAGGCCGCCTACTGTCCGACGGGATGCAACTGCTACGAGCGCACCGTGCGCTGCATTCGCGCGAAG
CGCACGACCACTCCGCAAGTGCCCTACGACACCCAAGTTCT
AGATTTGCGTTTCAATCACTTCGAGGAGGTGCCGGCAGACGCTTTCCGCGGCATGGGGCAACTGTCGACGCTGTTCCTG
AACGAGAACGAGCTGGCCCACCTGCAGGATGGGGCCTTCCAGGGGCTGCTCGCCCTGAGGTTCCTCTATCTGAACAATAATCGGCTAAGCCGCTTACCGGCGGCCATCTTCCAGGGATTG
CCGCGCGTGGAGGCGAT
ATATCTGGAGAACAATGACATTTTCCAGCTGCCTGCCGGAGTTTTTGACAATTTGCCACGTCTGAATCGCCTCTTCCTTTACAACAACAAGCTCACCCAACTG
CCGGTGGAGGGATTCAACAAACTGAACAGCCTGAAGCGTCTGCGATTGGATGGGAATGCCATCGACTGCAACTGCGGTGTGTACTCCTTATGGAGACGCTGGCATCTGGATGCCCAGCGT
CAGCTGGTGACCATCTCCTTGACCTGTGCCGAGCCGCAAGCCCTGCAGCGCCAGAGCTTCGCCAGCCTCCAGGAGCAGCACTTCAAGTGTG
CCAAGCCCAATCTCCTGGTGGCCCCACAG
GACTTGCAGACCTTCGCCGGGGAGTCCGTTCAACTCGACTGCGAGGTCACGGGTCTGCCCAAGCCCCAGATCACGTGGATGCACAACACGAACGAGGTCGGCGAGGATCAGGTCAACCGG
GAAATCCTGCTAAGCGGCAGCCTGCTCATCCGCAGCGTGGCAACCACTGACATGGGCATCTATCAGTGCCTGGCCCGCAACGAGATGGGGGAGGTACGCTCCCAGCCCATCCGCCTCGTT
GTCAGCAGCAGCAGCAGCAGCAACCGGAACCCACTGGACAACCCCCACATCGACCCTCGCAGCAATCAGGTATGGGCGGATGCGGATGGGAATGCGAATGCGGATGCAGGAGGTGCAACA
CCCACGCCACCGAGCTTCACCCACCAGCCGCATGACCAAATTGTGGCCCTTCATGGCGCGGGACACGTGCTCCTCGATTGCGCCGCCTCCGGCTGGCCACAGCCGGACATACAATGGTTC
GTCAATGGTCGCCAGCTCGCCCAGTCCACCGCCAGCCTCCAGCTGCAGGCCAACGGCAGCCTGCTCCTCCTGCAGCCCACCCAGCTGACAGCCGGCACGTATCGGTGCGAGGCGAGCAAT
CGCCTGGGCACTGTCCAGGCCACCGCCCGCGTGGAGGTGAAGG
ATTTGCCCGAAATTTTAATGGCACCCCAAAACCAAACAATCAAACTGGGCAAAGCCTTTGTGCTGGAATGCGATGCC
GATGGCAATCCACTGCCCACCATCGACTGGCAGTTCAATGGATCCCCGCTCGCCAGCACCCCGGCCGGAGACCTGCTGCTGGAGAACGAGAACACAGAGCTGGTGGTTAGTGCTGCCCGC
CAGGACCATGCTG
GTGTCTACCGGTGCACGGCGCGCAACGAGAATGGCGAGACGAGTGCCGAGGCAACGATTAAAGTGGAACGCTCCCAGTCCCCGCCTCGGGTGGCCATCGAACCGAGC
AATTTGGTGGCCATTACGGGCACCACCATTGAGCTGCCCTGCCAGGCCGAGCAGCCGGAGGTGGGACTGCAG
ATTTCGTGGCGCCGTGATGGTCGCCTCATCGATCCCAATGTCCAGCTG
ACGGAAAAGTATCAAATAAGCGGCGCCGGCAGTCTGTTCGTGAAGAATGTGACCATCCTCGATGGCGGTCGCTACGAGTGCCAGCTGAAGAACGAATTCGGAAGGGCCTCCGCCTCGGCG
CTGGTTACCATCAG
AAACAATGTGGATCTGGCACCGGGAGATCGTTACGTGCGCATTGCCTTCGCGGAGGCGGCCAAGGAGATTGATCTGGCCATCAACAACACCCTGGACACCCTCTTC
TCGAACCGCTCGTCCACGGGGCCACCGAACTATGGGGAGCTGCTGCGGGTGTTCCGCTTCCCCACGGGCGAGGCAAGGCAGCTGGCGCGTGCCGCCGAGATATACGAGCGGACCCTGGTC
AACATCCGAAAGCACGTGCAGCGGGGAGACAACCTGAGCATGAGCAGCGAGGAGTACGAGTTCAGGGACCTGCTCTCCAGGGAGCATCTGCATCTGGTGGCGGAGCTGTCGGGCTGCATG
GAGCACCGGGAGATGCCGAACTGCACGGACATGTGCTACCACTCGCGCTATCGCAGCATCGACGGCACGTGCAACAATCTGATGCATCCCACATGGGGTGCCTCCCTTACGGCCTTCCGC
CGCCTGGCGCCGCCTATCTACGAGAACGGATTCAGCATGCCCGTGGGCTGGACAAAGGGCCAGCTGTATGCCGGCCATCCGAAGCCCAGTGCCAGGCTGGTGTCCACCTCGGTGGTGGCC
ACCAAGGAGATAACCCCCGACAGCCGGATCACACACATGGTGATGCAGTGGGGCCAGTTCCTGGACCACGATCTGGACCACGCCATACCCTCGGTGAGCTCGGAGAGCTGGGACGGCATC
GACTGCAAGAAGAGCTGCGAGATGGCCCCGCCCTGCTACCCCATCGAAGTGCCACCGAATGACCCGCGTGTGAGGAACCGCCGCTGCATCGATGTGGTGCGCTCCAGCGCCATCTGCGGC
TCGGGCATGACCTCGCTCTTCTTTGACAGCGTCCAGCACCGCGAGCAGATCAACCAGCTGACATCCTACATCGATGCCTCGCAGGTGTACGGCTACAGCACGCCCTTCGCCCAGGAGCTG
CGCAATCTGACCGCCGACGAGGGTCTGCTCCGCGTGGGCGTCCACTTCCCCAAGCAGAAGGACATGCTGCCCTTTGCGGCCCCGCAGGACGGCATGGACTGCCGCCGCAATCTCGACGAG
AACACCATGAGCTGCTTTGTGTCCGGCGACATACGGGTTAACGAGCAGGTCGGCCTCCTGGCCATGCACACCATCTGGATGCGGGAGCACAATCGGCTGGCCACCAAGCTGCGCGAGATC
AATCCCCATTGGGACGGCGATACGCTGTACCAGGAGGCCCGCAAGATCGTCGGCGCCCAGATGCAGCATATCACCTTCAAGCAGTGGCTGCCCCTGATCATCGGCGAGAGTGGCATGCAG
CTGCTCGGAGAGTACAAGGGCTACAATCCGCAGCTGAATCCGAGCATTGCCAATGAGTTTGCCACAGCTGCCCTGCGCTTCGGCCACACCATCATCAATCCCATCCTGCACCGCCTGAAC
GAGACCTTCCAGCCCATTCCGCAGGGCCATCTGCTACTCCACAAGGCCTTCTTTGCCCCCTGGCGCCTGGCCTACGAGGGCGGAGTGGATCCCCTGCTGAGAGGCATGCTGGCGGTGCCC
GCGAAGCTGAAGACCCCCGACCAGAACCTCAACACGGAGCTCACGGAGAAGCTGTTCCAGGCGACGCATGCGGTGGCCCTGGACCTGGCCGCCATCAACATTCAGCGGGGCCGTGATCAC
GGCATTCCCGGCTACAATGTCTACAGGAAGTTCTGCAACCTCAGCGTGGCCGAGGACTTTGAGGATCTCTCGGACATTAGCAATGCGGGAATTCGGCAGAAGATGAAGGAGCTGTATGGT
CATCCGGACAACGTGGACGTTTGGTTGGGCGGCATTCTGGAGGATCAGGTGGAGGGCGGCAAGGTGGGTCCGCTGTTCCAGTGTCTGCTCGTCGAGCAGTTCCGTCGCCTGCGCGACGGC
GATCGCTTGTACTACGAGAATCCGGGCGTGTTCCTGCCCGAGCAACTCGTCCAGATCAAGCAGGCCAACTTCGGACGCGTCCTGTGCGATGTGGGTGACAATTTCGACCAGGTCACAGAG
AATGTGTTCATCCTGGCCAAGCATCAGGGCGGCTACAAGAAGTGCGAGGACATTCCCGGCATCAACCTCTATCTGTGGCAGGACTGCGGCAACTGCAACAGCATGCCCACCATCTTTGAC
TCCTACATTCCACAGACGTACACCAAGAGGAGCAGTCGCCAGAAGAGAGACCTCCGACAGCCCAAGGAGAAGGAGCAGGAGGAGGTCCCAGCCACCGAGAGTTACGACAGTCCCTTGGAA
GCCCTCTACGATGTCAACGAGGAGCGCGTTAGTGGCCTGGAGGAGCTGATTGGAATCTTCCAGAAAGAGCTAAAGAAACTGCACAAGAAGCTGCGCAAACTCGAGGACTCCTGCAATGCC
GTAGATGCCGAGCCAGTGGCTCAGGTGGTGCAGCTCGCACCAGCACCGGCCCCCGTTGCCCCGAAGCCCAGGCGCAGTCACTGCGTGGATGACAAGGGAACAACGCGGCTGAACAACGAG
GTCTGGTCTCCGGACGTGTGCACCAAGTGCAACTGCTTCCACGGCCAGGTAAACTGTTTGCGGGAGAAGTGTGGCGAGGTGAGCTGCCCGCCCGGAATCGATCCTCTGACGCCGCCAGAG
GCCTGCTGCCCGCACTGCCCGATGCTCAAAGGAGAGCTGCCGTAG

Retrieve as FASTA