Entry information : DpspsPxd01
Entry ID 7654
Creation 2010-10-25 (Marcel Zamocky)
Last sequence changes 2016-02-17 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-17 (Achraf Jemmat)
Peroxidase information: DpspsPxd01
Name DpspsPxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Fungi/Metazoa; Metazoa; Bilateria; Ecdysozoa
Organism Drosophila pseudoobscura pseudoobscura    [TaxId: 46245 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DpspsPxd01
start..stop
S start..stop
DpePxd01 3071 0 1..1529 1..1534
DmPxd-A 2698 0 15..1525 18..1527
DerPxd01 2686 0 19..1525 21..1526
DyaPxd01 2677 0 19..1525 21..1528
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1311184..1311344 161 N° 2 1328721..1328936 216 N° 3 1329048..1329119 72 N° 4 1329190..1329431 242
N° 5 1329502..1330158 657 N° 6 1331745..1331954 210 N° 7 1332074..1332252 179 N° 8 1332393..1332574 182
N° 9 1336518..1339188 2671  
join(1311184..1311344,1328721..1328936,1329048..1329119,1329190..1329431,1329502 ..1330158,1331745..1331954,1332074..1332252,1332393..1332574,1336518..1339188)


exon

Literature and cross-references DpspsPxd01
Literature Drosophila 12 genomes consortium (2007) Evolution of genes and genomes on the Drosophila phylogeny. Nature 450:203-218.
Protein ref. UniProtKB:   Q29FB4
DNA ref. GenBank:   CH379067.3 (1311184..1339188)
mRNA ref. GenBank:   XM_001354252.2
Protein sequence: DpspsPxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1529 (1509)
PWM (Da):   %s   170971.72 (168558.5)  
PI (pH):   %s   6.18 (6.15) Peptide Signal:   %s   cut: 21 range:21-1529
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWWRGVLLFHLFLLAGWSEAAYCPTGCNCYERTVRCIRAKRTTTPQVPYDTQVLDLRFNHFEEVPADAFRGMGQLSTLFLNENELAHLQDGAFQGLLALRFLYLNNNRLSRLPAAIFQGLPRVEAIYLENNDIFQLPVGVFDNLPRLNRLFLYNNKLTQLPVEGFNKLNSLKRLRLDGNAIDCNCGVYSLWRRWHLDAQRQLVTISLTCAEPQALQRQSFASLQEQHFKAKPNLLVAPQDLQTFAGESVQLDCEVTGLPKPQITWMHNTNEVGEDQVNREILLSGSLLIRSVATTDMGIYQCLARNEMGEVRSQPIRLVVSSSSSSSNRNPLDNPHIDPSSNQVWADADAGGATPTPPSFTHQPHDQIVALHGAGHVLLDCAASGWPQPDIQWFVNGRQLAQSTASLQLQANGSLLLLQPTQLTAGTYRCEASNRLGTVQATARVEVKDLPEILMAPQNQTIKLGKAFVLECDADGNPLPTIDWQFNGSPLASTPSGDLLLENENTELVVSAARQDHAGVYRCTARNENGETSAEATIKVERSQSPPRVAIEPSNLVAITGTTIELPCQAEQPEVGLQISWRRDGRLIDPNVQLTEKYQISGAGSLFVKNVTILDGGRYECQLKNEFGRASASALVTRNNVDLAPGDRYVRIAFAEAAKEIDLAINNTLDTLFSNRSSTGPPNYGELLRVFRFPTGEARQLARAAEIYERTLVNIRKHVQRGDNLSMSSEEYEFRDLLSREHLHLVAELSGCMEHREMPNCTDMCYHSRYRSIDGTCNNLMHPTWGASLTAFRRLAPPIYENGFSMPVGWTKGQLYAGHPKPSARLVSTSVVATKEITPDSRITHMVMQWGQFLDHDLDHAIPSVSSESWDGIDCKKSCEMAPPCYPIEVPPNDPRVRNRRCIDVVRSSAICGSGMTSLFFDSVQHREQINQLTSYIDASQVYGYSTPFAQELRNLTADEGLLRVGVHFPKQKDMLPFAAPQDGMDCRRNLDENTMSCFVSGDIRVNEQVGLLAMHTIWMREHNRLATKLREINPHWDGDTLYQEARKIVGAQMQHITFKQWLPLIIGDSGMQLLGEYKGYNPQLNPSIANEFATAALRFGHTIINPILHRLNETFQPIPQGHLLLHKAFFAPWRLAYEGGVDPLLRGMLAVPAKLKTPDQNLNTELTEKLFQATHAVALDLAAINIQRGRDHGIPGYNVYRKFCNLSVAEDFEDLSDISNAGIRQKMKELYGHPDNVDVWLGGILEDQVEGGKVGPLFQCLLVEQFRRLRDGDRLYYENPGVFLPEQLVQIKQANFGRVLCDVGDNFDQVTENVFILAKHQGGYKKCEDIPGINLYLWQDCGNCNSMPTIFDSYIPQTYTKRSSRQKRDLRQPKEKEQEEVPATESYDSPLEALYDVNEERVSGLEELIGSFQKELKKLHKKLRKLEDSCNAVDAEPVAQVVQLAPAPAPVAPKPRRSHCVDDKGTTRLNNEVWSPDVCTKCNCFHGQVNCLREKCGEVSCPPGIDPLTPPEACCPHCPMLKGELP

Retrieve as FASTA  
Remarks complete sequence from genomic (Chromo XR, 8 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGTGGCGAGGAGTGCTCCTGTTCCACCTGTTCCTGCTGGCGGGCTGGTCGGAGGCCGCCTACTGTCCGACGGGATGCAACTGCTACGAGCGCACCGTGCGCTGCATTCGCGCGAAG
CGCACGACCACTCCGCAAGTGCCCTACGACACCCAAGTTCT
GTGAGTATTCCTCTTCATCCTTTTCCGGGGGATTGGGGCTCTGTTCTGCATAAATCATTCTGGCTGTTGGCTTTCCAAA
TTCCAAATTCCATAAATTAGTTTTTAATGTTTTCCGTTGGCCCTCTGCAGGCGGCAGTGGCGTTAATTTGATGCCCTGCCCCATCTGTGCCAGCATCATCTTTATCTCCATGCATCCAAC
CTAACCTCCAACCACCATCAACACCCCCACTCCCACCCCCACCATCGTGTTGACTCAATTAAACGGATGTCTAGAGAGAGAGCTGCCTGGGTTCTGGGCTCTGGGTTCTGGATTCTGTGT
TCTGTGTTCTGTGCTCTGTGCCCTGGGATTTGTATATTTATCGCACGCCATGCCATGCCCCACACAAAGCGATTGGAGGCGACGCAAACACAACGCGACAACGCGACTACGCGACTCGCA
ATATTTGCATGCACGCGGAATACTTCTGACGTTGCATTTATTTTCCGAAATGTCAGCAGCTTTCGCATGAATTTCGGGAGCCACACCACCAGAATCCGAATCCTCGAAGCGGATTTGTGG
GTGGATGGAGCGGCGGATAACTTGGCAAATGTTTGTGGAGCATATGCATATTTATATAGGCCGCGGCATGCTTTCTCCTCCTGCCCCTCCATTTGGGGCAGCATCTGTGCTGTGCTCTGC
TGTGCAACGGTAGCAGCTGCCACAGCCGGCGGCAAGTTGTCAGACGACAGATAGAAAGAGAGACAGCTCTGCTCTGGAGGTGGAATTTCTCCTGGTATTTATGGGGGAATTCAATTTTCA
TTGGGTTAAGTTGTTGAGCGAACGATGGAGGATGTACACGAATAAACTGACAGATATTCGCACATTCTGTCAGCCAGAGAATGGGCTCCTTCTGTACGGTGCTGCAGTGTGCTGCACAGT
GGCTACAGAGACAGGTTTTACCGGATGAAAGATCTATACAGATCCAAGAGAAAGAAGAAGTTCTGAGCTTGAGGAAAAACCCAGTGATGGCAGATTTCAAATTGAAAACAAGGGGCAGGT
CCATATTCACCATCACCATACAACATGGAGATATGTATCTACCAAATTCATCGGGAACCTGCTGCATTTCGGCAGTCATTCCCAGCCCCATCCCATAAGCTCCACATAACTGGCATAAGC
AAAAAGAATTCTTTGTTTATCCATCATCCGAAGTCGCATACTGCAAATCCGCACTCCATATCATTCCTCTGATCCTCTACCATTTGTTGGCTCGCCGCACAACAATTTCTCAAAGAAGTG
AAACCCGAAACCACACCCACCCCCACAAAAAAGGAGTAGCCACAGAGAGCACAGACGGAGAGAGGCACTTTTGGCAGTACTTAAATTAATCTTCATTTTAAATAAGGTGATGGCTGCATA
ATTTATCATTGCCCCGAGAGCTGAATGCACACAAAACACTCACACAACAATAGGAAAAATTCCAAAAGAAGGAGAAGGAGAGGGAGCAACAGAGACGGGGCGAGTGGTGGTGTGGATGCA
TTCAGCAACTTTTCTGATTCCATTCTGATTCGCATTTCATTTATTCCGCATCCGACCCGTTGCACACTTTTAATTAATTTGTTTCATTTATAACGAGTACGAGTACGAGTACGACTACTG
CATGTGTCTAAAAAAGTTTCCCTGGTTTTTCCTCCAGCTTGTTCTTCCCCTTTGCCCCCCTTTCATGTGGTGTGTGCTTTCCATGGGCAGCAGCCCACATGTTTATGTGCGGCGAGTCGA
CTCGAGTCGGGTCAGATTTTCTCCATTTATATTTCATATTTTCTCAAAATGTTCACTCGAATGCCTCCTAAAATAAAATACAAAAAAAAAACAACCAAATGCTCGCATGTACTCGTACTA
GTCTCCAGGCAGAGGCAGTGATAGACATTATATTTTTGCATTTGTTTGTGCTATCCGATGCGCATGGAAATGTTTTTGCCTTAATTTTGTTAATGGCCAAAATGTTGTTTATAATTTTCG
TTGCTGGAAGATGCTTTCGGGTCGGGGCTCTCGAGATAGATGTCTGACAGAAAATAAAATGTAAAGACACAAAGTCAAATAAAATAGTTTATTCAAACGAATTCCTCAAAAATGTGTTTT
ATTTGAACTCCAGAAACCTCTTGGATCCACCATTGCCAAAGCAAAGAATTCTTGGCTCAAAAGGCTACAGGAAAATGTATCTTAAGCCAGAAATTCTCCTGAAATTTGTTGTAGAAGAGA
TTGAGAGCCAGATTTGATATCTTTCGAAGCTTTGGGGTTCTATTTTTGCATATCCTGCAATGTTCGGATTTTAAGAGTATATTCAAATGAATGAGAGCTTCCATGTTATAGTCCTACTTC
TAATGTGATATCTTGCTTGCAAGTCTACACTTGCTTCGGGGAAAATATCCTGTATATTGCTATCCGCACTTCATTGAAAAAGCCTTCCTCTCCAGCTGCTGCTGCTGCTGCAGCACCAAC
GCCAGCTCAGGGCCTAAGCCACATTTCACTTCCTTGAAACTGTCCATCCATCAAGCATAAAGTCCTCTGCCTTTTTTTCAGCTTTTGCCTCCATTGAAAGTTCCGCTTTCAATGGCTGCT
GGGTCGTAAAAAAGAACTGCAACTCACTCTGCCTGCCTCTGCCCCATCTCAGCCCCTTCCCTTGCCCTCCGTGCCCTTCGGGCCCCAACAAAAGGCCAAACATTTTGGCTCTTTCCGTGT
GCATTTTGAACTTGCAACTAAATGGAAGTCCGAGCCGAGACTCTGTAACATATGCGAGCGGCGGCCGGCAACTTGCATCATTCATCTTGCCACACGCCACTCCGCCCACCCACACACATG
GCGCTTGGCGCTGCGAAGAGGAGGCTGCCGTTTTTTTTTGCTCCCTTTCCATCGGAGCTAAATAAATGCACTTGATTTCATTTCATGATGATGCATTTTCCGCTGACCTCCCATAAACCA
CACACATTTCTTGCCTCCTCGGAGGCAGTTGCTTTGTCATTATACGAGCGGGGCAAGCCACACTCGAAGCCGTGCCTCCGCCCCTACTTTCTTTGCATAGAAGAGCGAACCACATAAAAT
ACAGATGGAGCCCGTGCGGCAGATGAACAAAATCTATTATGCACTGAGAGAAACGGTACTATCTTTGCATTCCAAAAGGAACTTTAAACGTGAAACCCCCTCAAATATATATACCTTCCT
TTTGCCAGTCAGATATGGGCATTTCCATTTCATTAGCTCTGGGATGGGGTTCATCTGCGAGGCCATAAATTATCTCTATTGGTTATTTTTATAATTGAATTAAACACCGGTCGTGCCATA
TCATATCACCTCATAGTTTCCCATAAATCACTTCCAAAAAGGAAACTTAGTTGGCTTTTTGCAAGGACTTTGAGGCAACAGTTTGGCGTAGAGGAAAACACGACCAAAAAAAGGGAACTT
TTGCTTGAGAGGCTTTCAGATCAAAGTTAATGATATAATATGCCAAGTGCTTGATTTAGTTAAGTTTCATTCAATTTGGAAAATAATATTGGAGCAAAGGCATATGGAAATGGGTTTAAT
ATTAGCTTGGTCTCGGCTAACTTTTCCATGGAACTTTTCCATATATGCATTGACGTATCGAATATTTTTCAAACATTTGCATTGTTCTTTTTCTTTTTATTGTTTTTGCAAGTGTGGCCT
CTGGTCTTTGCCTCTTGGAGGCTCGGCAGCGGCGGCAGCGCCTTGTGCAATCTAATAACTTCGGGCATTATGCACATATGAAATATATCTCATCTAATGTCTGCCCCTCCCCCTCCCGTT
CCCTCTCTGTCTGCCTGCCTGTGTGGGTGGCTTTGCTGTTGGAACAAAAATCGCCTCACGTTGCCATATGCCGGGCATATTAAAAACTTTGATTAGTGTCCAGTTCGCTGGCTCTTGCCA
CGCCCACGCCCACGCCCATGCCCACACCACACACCACACACACATGCATTGTTCTGCATAATATATGGCCACTACATTGCGATGTACATTGTACATACATATAGTATTTGCTTGGATTTT
TGTTTGTGAGTTTTGTGAATCAACTATTTGGGAAAAGTATTTTTTGTTTGCCCAAAAATTGTTTCAATCTGCCCTCCCGCTCCAATACGCTGGCTGGCTGGCTGGCTGGTTGGGTGGCTG
TTTTCTTTCTCCCTCTTCGGCTGCTCGCTGTTTTTCTTCTCTTTCTATTTCGCTGTGTGCCCCCCTCTCTCTTTCTCCCATTCTCTCTGTGAATTCCTCATTTCGTTTTTGGTGCATTTA
TGCGTGACAAATGCCTTGTATTTTGTGTAGCGCTCTACGGGTCGTCGTCTCCATATCCGGGCTCCTGGTTCCTGGTTCCAGGATCTCCTCCTCCTCCTCCTCCTTCTGCCATTCCCCCTG
TTCCCTCTGTTATTAAATATGCATAAATTTCCTTTTTGCACATAGCATTCGTTGCTGCTGCTGTTGTTTTTAGTTGTTGGAATTTTGCATTTACATTTGCTGTTTATTTGTCGGTGGAAA
TATTGAAATTGTTGCCAATGGATGTCCTAGCAGCAGCGGCAGCAGCAGCTTCTGGCTCCTGCCTGCATTTCCTGGGGGACTCGAAGTGAAATGATATCCAGGGTTTTCCGTTCAGGTGTG
GTTCTTGTTGGAATAATTACAGCAGAATTCGAATCCGAATCAGAATCAGCAGCAGCTGTGCCTCTGGCTGTGGCTGTATCTGTATCTGTGGCTGTGGCTGGGGCTGTCTTTGTGGAATAT
GCTCAAATATTGTATCTTCTGGATGGCAGGAAGCTGTTGCAAATTGTCTAAAGATTGCCTAATTTGCTTGTAATATTTGATTTGATTTAATATGCATCCCTCAAATGCATTTCATACGGA
TTTAATTAGTTTTTAGCTTCAATTGATGCGAGCATCAAATGTTAATTGAATGATGAATGCTTATGGGATTATTATTAGGAAATACTCAAAGAATACCAGATGTTCATTTAACAAATTAGT
TTACACACTCGAAGAACTGCTCCCCATCTCCCTCTGTTTCTCCCTCTCCCTCTCACTCTCTGTCTTCCTGTGGCAGATCCATCCATCTCTGTTTGCGTTTAGTCCCTGGCAATAAATCCC
TCTAAATGCAATTGCCAATTCAATTACCAATCAATCAAAGAGCATTCAAACTTCGTCCTTTGGAGCTAGCAATCCCCCTCCCCTGACACACACACACACGCACTCCTTGTCTGGCTCCTC
CTCTCCTCTCCCTCTCCTCGCCCCCGTTTCGTTTGCAATACAATATCATTGCTGTAAGAGCTTTTTTCGGCTGCAGTTGCAGTGTTTGGTTTTTGTGGCATTCAGTCTGACTTTTCGATT
GTTAAATATTTGCAGGGCGGGCAACAAAAGCCCGACACGGCACTGAAAACAAAATGAATCCGATTCTGTTGGCCAGAATGTGCCACTCAATCGGTAATATGATTTGTAATTATGCAAATG
AAGCCGTCCCCCAGTGCCCCACCAATAGGGAAAGGGCAACAAGAAAAGCAGAGACGGAGAGAGAGTCAAATGGGAGTTACATTTTTGGATGATTAAAGCTGAATGAGAAAAGTTGTCCGC
CTCAAAGGGAAAGGCAGAGGCAGGGCAGGGCAGGGCAGAGGCAGGGCAGGGCAGGGCAGGGGGAAAGGGTCCCCAGCGGCAGGGCAAAGTTTTTGCCAATCAAAGCGTATGCATTTTTAA
TTCACTGCCAAATGCAGATGGAATGAAGGAGATGGCTATCGAAGAGAGATAGAGAGAGGGAGACCAACGTGAAGGATGCCGAATCTCGAGTTGCATCGAGAGAGCGGGAGCCCCAATGCG
ATTCTGTCAAGGAGCCTGTCCGACTGTCTATCTCTCTGTCTCTGTGCCTGCCTGCCAGGCTGTTCGCTTCACTTTGACATAGAAAAATCTTCTATTGATTTCGCCTTGCCACATGCAGCA
TGCAGCATGGCTGCCCCCAATCGTATCAGCCATCCCTCTTTTGGCTCCCTCTTCAGCCCCGCCTTCTCCCCCACTCCCCCACGTCTCGTCACGCTGTGCAATTTGCATTTAAAGTTTAGC
TTCTTTCTTTTTGCCATTCTCCCTTTTGCATTCCTGCCAATTCCTTTGCTTTAATGCTACAAAGTAGCACTTGCTTCATTGCCATCGTCCACGCCCCCAGCCCCCAGCCCCCAGCCCTCA
GCCCTCAGCCTCTGGCCAACGCCCACACGCTTTGTCATTTCGCATGCTCGTTAGTGCAGAGCAAAGAATGCAAAATAGCAAGATACTGGCGGGATAGTAGGTGGCAGGAGGTGGCAGGAG
ATAACATGCAACACCACCAACATCATCGCTACACAAACACATGCCACAATTTATAAGCAAAGTTATTTTGCCCCAGCAGAAAAAAACACGAGGTGGGAAAGGGCTGGGCCAGGGGCTGGG
GCAGAGCTCCGTTGCCCCGATAGCAACCGGCAACATGTCAAAGTGGAGCAATCGGCATGTGCAACGGACACGGAGCAGAACGGACACAGACACGGACACGGATTCGGACTTGGAGTCGGA
GTCGGAATCGGACTCTGTCGGAGGCAACTGTCGGTCAAGCATAAGAAACAAGCAGTAGAAGCGGTCCATAAGTATGCAATGGCAAAAGAGAGAAAAACACAGAGACCCAGAGAGACGGAG
AGACAGAGAGTGTATATACGACTAGGGGATACCTTAAAAACAAAGGGAAACAGTATCTGTGATAGCTTTGGTAAATACCAGCCTTATGTATCACCATATCCTTAAAAGTGTATAAAGGTC
AAAGACGAAGTAACCCGATAGAAGAGATGCAGAGACCTTTGGATAAGTTCAAAAGAGCCAGTATGGATCTTAAATATTTGTAGACCCGTACGGCTGCTGCCTCCTGCCTGTGGCATACCC
CAAGCAGCACTCCGGAATTACCTTACCCGTTTTAAGAGAAAGGTAGAATTCTGGAGGAGCCCAAAAGCGGGCGAATGAAAAGCATTGAAAAAGCAAAGTCCTGGAATGCTGAAACCTGCG
CTGAGAGATGCCGCTGCCGATGCCGTGGCCGATGCTGGCCATCATGTGGAGCCGACCAGGTAAAGTCAACAACAGAGTCAGAGTGGCAGCAGGGCGAGTGGAAAAAATGTAAGAAAAGAT
GCCACTGCCACTGGTAGGGCTACTGCCCTGCCGCTCACTGCTCGACGAGGCGGCAAACTAACCCCACCCCCGTCCAGAGCAGGTCCAGGGCCAAGTGGCAGACCACGTAGCCAAGGCACC
GGACAGATGCATAGCCGTAATAATGTTAATGTAAATGTTGCAAGTGGAGCAGGTACAGGGGCACAGGGGTACAGGGGCACACGGGGCAAGTCGAGTGGCCATCAGTTGGTCCGAGCTGCT
GCTGCTGTTGAAGATTCTGGCAGATATTAACATGGCGTATACGTAATGGTTCCGAATTAGTGGACTGAATTATCTTTAATACTTATGCTATCTATAATATAGTGGTTATTTATAAGTATA
GCGGGGGGTTCTTTGGAGTTTCAACTAGCATTCTCGACTTACCTCTGCTCCGTGAGAAGAAGTCGAGCAAAAGGGGATGGGAAGATCACGCTTTGCGACGGTCCACAAGAAAATTGTAAA
AGGTGGTCCGCTAACTCCCGTTCGGGACTTATTTCACGCAAGAGTGTTCGCACTAGGGAGAGCGCTGATGAGAAAGAGAAGAACGAAGCCTGTTGCTGTACGACCCGAAAGGAGAGCGCG
TGGCGAGAGCGGACCACCTTCTATACCACCTGCGGGTAGTGGCGTTTTGGTGCTTAAGCGGAAGAATACAATGATGAGCAAAGGAATAGCGAAAGGTATGGCTCAAATGACTATGAACTA
TAGAAGGCTCAAATAAGGGGCTAAACGATCCTCAAAAGCTTATTTGGCTCAGGTTCAATACCACATACCCCGTACTCGCTCAAATGCATTGCAATGGGGGAAATTGCCTTTAAAAGAATT
GGAAAAGAGTTTGAAAATAGCCGAAATACACAATAAAAGAACTTAAATTTAATATCCCCCCCCACCAATGCCACGCCCTAATCTAATACCCAGAACACACACACAGTGCAAAAAAATACA
ATATATGTAGGAGGACTGGCATAATATTCGGCTTTTATCCGCATATTAAACCATTTCCACTTGAATGGAGAACTGATTTCATTGCGTTTTTCTGCTCGTACGATCCATATATCGTACGCA
ATGCTCCTGTACATGTACATACATATATCCACTCCACTTCACGTGCATTGTGTGTGTGCTTCCCTTTTTGGCTCTTCGAATATATAAAATATATCCTAGTGCCAGATGGGAGAAGGCGGA
AGGCAGAGGAGACAAGGGAGGGGCATATAAATCTGCTGTATAATTGAATTTCACACGCTGCCAAAATATCAAATAAAAAATAAATAAAACCCAAAAGCAACGAAAGTTTAAATAAAATTT
AGTTCAACAAAAATACCCAAGCGGTGAAGGGTGGGGAGGGGGGGATGGGAATGGCGGAGTGTGTGCTGCCTGAAAATGTGAGAATTATAACCGAACTGAACCGAACCACCTCCCCACTCT
CCCCCAACGGGCACCCTTCTTCTGGTAGCCACTTTTAACCATGGAGGTGTTGACCGAACTGCAAGCAGCTTAAGCAGCATGCCACAGCAGTCACCAGTCACCAGGCAACAGAGCAACCCG
TCGGTGGAGGGGGGTACGAGGAGTATGAAATCCTGTGGAGAATGCAGATGGGAATGAAAGTCCTGAGGAGATTGCAGATGGGAATTGAAGGTCCTCAGGAGGAGGGGGACGGGACTTGCT
CTGGAAATGGGAATGGGAATACTCGCCTGTATGCTCGCTCCTTTAGTCGGACGGCAATTGCATGTGTGGCAAGTGCTCTTGTGAGACATTTACACCTGTAAAAACATTTGGACCAGAGGA
GGGTAGGAGGAAGAGGAAGAAGCAGCGGCAGCAGCAGCAGCAGCCGGGGGCTGGAGGAACAGGAAGAGCATGGAGCTAAGGGGAGCATAAGTAATATTGGGAGTAGAAGAAATAAGAGCA
CGGAATGGAATGGAGAAGGAGAATCATTAGCAGGATAGGCAGCAGTGCCTGCGGGGGGGGGGGGAGCACCAGTAAGGGAAGCAGTACCTGGAGACCAGAGAATGGTGATGGCTGATGGCA
CAACACATTAGCAGCCCAAGAAAACAGAAAAGTGACGCTCGAGCTGTGACAAGAGCAGTCCTCGTGTGTAAAGAACAGAACAGAGCAGAACAGAACAGAACAGAACAGAACAGAACACTC
TATAAATAGAACTAAGGACACCTAAGGACGATCTAAGGGGAGAACTAGGAGAGCTGCAGACACCCAAGGAGTGCAGCACGAGGAGAGTGCACTGCCTCAGATGACCAGCAATTTGGAAAG
GCTTCGAAATTTGTTGCTTGGGAATTTCCTTGCTTTATCTCCAGCTGGTTTTCTGGTTTCAGGTTCGACTTTTCCTACTGCTTTTCTTTGGGAGTTGCCCTCCGCTGCTCCCGCCCTGCT
CCTGCCCTGCTCCTCCTCCTGCTGTTGGGGAGTTCTTCTTTTTTCGAGTTTTTTCAGTGGCAGCCCAAAAGTATGCAACGAAAGTTTAGATTCCACCCCTCCCCCCCACCGCACGCTCGC
TCCGACTCTCGGAAGTGAATTTTCCGCACGTGGCCTAACTTTTGCTGCCTGGCTCCGTGGCCCCTCCCAGGACGCACCATTCTGGCGTGTCATGCAGTCAGCAATCTTTATCCAACCCCA
AACCCCCAAACCCCCCTCGCACTCCCACTCGACTGCACGCCCCTTTGAGTGGGCGCCTTTCATTCTTTTCTTGCGGATTTTCCTCGAGGATTGCATTTAACGCAGAAACAGGAAGGAAGG
AAATGCCATGTCGACGCTAAAACTGGGTTAGCTTACATAACGACAACATTAACGACAACGTTTTCCTTCCTCTCAAACAGGGGGTCGGCGGGGGCAGGGCAGGGCAGATGGAGGGGGTGG
AGCTGAATGAAGCCATGTAGGAGGGCGTTCGCTTCACGCTTCGTCGCTTATTGGACATAATTACTGAATATAACAATTCTGTGGTGTGTGCGGCATGGGGCATGGACTCCGCCTGCCATA
GCCACTTGTGCGTAACCGCAGCAGCGACAGATAACTGCAACAAAAGCAAAGTCCGGGGCATGCGGCCAGCCAGCGATGGTGTGCTGGGGCCAAAGGACCCACATATCAATTCCGTGTGAG
CGGACATCGTGCAACTTCTTGTTGCAGCAGTTCCCGGCAGGACAGGAGCACCGCCCCGGTTCCTGGTCAGTGGAGAAGAGCAGGCATCCGTTGCCTTTATCGCTTACACTTGGCCAAAGC
CCCGCTTTTATGCTTCGTTTTTTTTTTGTGTTTGGCATTGATTCAACGGAATCCTTAAAGTTGAACAGTTTTAGAGTTGGATTTGGGGTTTGGGTTTCGGGTTTCGGGTCTCCGATTTCC
GATTTCGAATTTTGGGTCTGGGCTGGGAGCGTAATGCCAGCGAAACTTTTGGCCCTTTTGTCACTTTTGGAACAATGTTAATTGCTTTAGAGTTTACTTTTCGACTTTAGCTTCCCGGGA
TAAAGGGGGGCGGGGGCGATGGGCGATGGGCGGTGGGCGGTGGGCGGATGTCCCAAGGCATGCATTAAATTGTGCTGATCTGCTGCATGCCATGGTTTGGCTCTTTTGTTGCTCTGTTCG
AATGGAAATGGGAGCTAAACAAAGCGTTTTATGCATGCACACTCCAAGCCAATTACGCAAAGTGCTCTAAGTATCTCAAACAGCAGCAGCAGCAGCAGCCGGGGGCAGCAACCGACCCAA
AACTGGACACAATTACATTAACAGTTTAGCACACACACACCGATAGAGGGAGAGAGGGAGTGTGTGTGTGTGTGCAAGGATTGAGGGCAAAACAAACAGAATGAAATTAAATCAAAGGCT
CGAAAATAAGCTCTGGAAAAGGAGTGCTGCTGCTGCCTGCCTGCTGCAGTAACCAACAGTAACCAACAGTAACCAACGGTAACTAACTGGGCTAAAAGCTGTTGGCTTGTCTTGGCCCCT
TGTGCCTCTCTGCCGCTGCTATCGTCCCTCAGCCTCTGCCTCTGCCACTTGCTGAAGCTGTCAGACTGACAAAGTGACTGCCTGACTGACAGCTGAACTGTTACACACACCAACACACCA
ACACACACACACAGAGAACAACACAAATAGACGACTGCACACAAATAAACAATGTCAAGAGTTAAAAGCGGTAGGGTAGGGCGTGGAGGTGGGGGTGGCACTGTGCACAGCTTTTGTTTA
ACAATAATAAAATGGCACTACTATAGAAAAAACAAAAAATAAGAACAGCCTGCAGGCGAGTGGCTCGACCAAGAGGATACCCCAGGGCCCAACATGGATGATCTTGCATCGTACATTATC
GGCACTCCAAAGCCGAGTCCTATGGCTCCATAGGATGGATCACGACTATGGTTAATAATCCAGATTGTATACCCTTTCTGGGATCGTCTTGAACACAACATACCCTTGGTAGCCCTGGAA
ATACCCGCCAGAGGCAAAGGCAAAGGGCAGCAGGATCCGCTCAGTGCAATTGGGATCTGTGGTATAGGCTGAAGGATTGCATTACCAAGTGTTTTACACACACACACACACAACACAGAG
ACAAGCAGAAAGACAAAGACAATTGTCATGGGTCCTTCGGACTATCGTCAGGTGTAAGGGGGGGGAGGAGGCCATCACCTGGGCAGGGCAACCCCAGCCAACAGAAGGACACACGGGTAT
CCGCAGATGCAAGGATGAGCTCCGCCATTGTAGGGCACTTTTATCCATTGTTGTTGTTGCGGCTGCCACTTTTTGTTGCAGCTTCCTTGCTGCGTGTTTGTAAGCCATGTTATTACAATA
ATGTGTCTCCAAGTGTGTGTGCGTGTGCGTGCATGCGTGTGTGTTTGCGGCATCCTTCCATCCGTCTGTGTATCTGTGCATCTGTGTGGGTTGTGGAGTGTGGAGTGCGGAGTGTGTGGC
AGGCCAAAGTTAAATCATGTTTTTATTGTCACATTTGCCATAAAGGCAGCCCAGGGACCAGAGCCAGAGCCAAAGCACACCAGCAGCAGCAGCAACAGCAGCAGCAGACCGTAAAAGGAT
TTGGATCGGCTTGCAGGAATGGGAGCAGGGGCACAAGGCGTCATAAGATGCTGCCTAAGCTGAAGGCCCACCTGAGAGACGGAGAGACGGAGAGGCAGGGGAGGTACATATAGGATGTAA
GCCAGACAAATCATAATCAGAGCCAACAACCAGGCCACGCAAGGCGAAAGCAAAAGGCAAGTCCCAACAAAGCACAATTTCACCTTAACAACGAGGCATGGCCGAGAGGGGAGAGAGGGA
CTAAAGGGGGGTTGATCCCACTGATAAGGCAGCAGCGGCAGTAGTTGCACCCTCCGACGCAGCCGCCCCACGTTTATAGCCTTGTTTATGTTGCATACTTTATGGCGCTTCAAGGGGTTT
CGAACGGGAACAGAGGCAGAAAGATACTCCGGGGGGAGGCAGGAGCGTGTGGCGCACGCGGAAAAAATGGCAGAGAGTCTAATGAAAATGCAATGAACTAGAAAATAAACTGACTCAATG
GATAAAAGCCAACTAACGTTGAAAGCGGAACAGCGCGCAGCGAACAGCAAACCAATTTCAATGCAGGATGCAGGAGCCATAGTTACGAGCATAAAAATTAAACATCTGCTCTGTTTATTG
CCGGTCTTATATTGTATGATGGCAGGGGCGTTATCTTTCGATATTACAATAGCCACAAATGGCAAATGGAGAGTCCTTAGAGGCTCTTTTCATGAGCCACAAACTAAGAAGGAATCGAAG
GACATAGAGCTGTTGCTCCGACGTAGCTTTTCAGTGAAGAAAAGCCCAACACTACTTCACACTCCTGCCCTAGGAAGGGAGTTTCCACTCGAAAACTCTTCCAAAATGGGGCTTTTAGTC
CCTAGAGAAACTTTGAACAATCGAAATGCCAATTCGAGTGCATGGAAGACCACAGTTCTGGCCAAAAACGACAATACAATTGAGATCTCTAAGCGAATGCCACAAACATTTACTGTCAAA
TGTGCGCCGCCACAAACAGTTAATGCCACACCTCCCCCACACGCCCGCCACACGCACAGTCTTGCCGCACTCTTGTCGCTGCATGAAACATGCAATGTGGAGGGCCGCTCTCTAATTTAC
TTGCTGTGGTTTTTCCTTCACTAATTGTGACAACTAATTGAAATCAAATTAGTGGAAGCCACTAAACAGCTTAACGCTCGCTGGGCATGTATTTGATTGTGTCTCTCCCGATCTCCCCCT
TGTTGCATGCTGCATGTTGCATGGAGTGCCAATTGTTTTCATTCAATTTACTGTCGGAGGTGGCTTTAAAATATCGCTCTTGGCTTCAGTTTTGGCTAGCCATAAATTTTCCTCAACGGA
CATCAAAGCGTATACGTAATGGCCCACCCAGTGTGCGTGTGTGTGCTTATGAGAGTGTGTGCGTGTGCAGGCATGCGTGAATAGACAAACATGCGAGAGAGAGAGCGAGAGAGAGAGAGA
GCAGGCAAATGCCTTTGTCAATAATATGCATTAATTAAGTGCAGACATGGACACCGGGGACACAGTCCACAGTTCACAGTCCACAGTCCGGCGTCCACAAGCCAGCAAGGAGTCGACGGA
GCAATGGAGCCACACAGCAGGGTTGCAGCACGGTTACGGATACGGCTACGGATACGGATACGGGTAGGGGCACGGGCACGGGCACCGACACAGAGGCACCGACACAGAGGCAGGTGCCGT
ACCGATTCGAACCGTGCCGCACCGGACACAGCTTGGCACTCGCTTTATGCATTTCAAATTTTAATTGAAAATATCGTCCGAATTTAATGCAAAAATGCAAATGTCATTATCCAAACAAAA
ACAAAAAAATAGCCATTTTCCAAAAGCTGCAGCAGTGGCGGAAGTGTCACAGCATTGAATAGTAGTTTCAAGATTCAATTTCCTTTTCCGCCTGCCACGCACACATGGACACATAGACAC
ACGGACACACATGGATGGGGCAGGTGGGCCTGCTGGTGGGCTTAGGGCGTGGTCTGCCTGGAAGAATGAAAGTTATTTGTGCCGCCTTTGAGCATCTGTTCGGTTGGGACTCGCTTCAGT
TCTCTCTTTTTGCATGGCCGCTACTCGACAAATAGTTGCGCCACTGACACGACGCCAACTATGCGGCCTGCCACTGCCACTTGCCACTGGCAGTACCTCTGCCGCAGAACAGGAAGAGGC
ATAGGGAACATCTGCAGCTGCTAGGCTCGTCGCCTGTCGACCGTCGACCGTCGGCTTTGTGGACTCTGGACTCCACTCCGGACAGGATGGCGTATGAGTGTGTGTGCACCATTGAAGTGG
ACCATCGTTTGTCACACGCGTCATGGGTGGGCAGGGGTGGCAGAGACAGAGGCAGAACAGTGGTGGCACAGTGGCATGGAAAAGGGTCCGGTTGCACTTTGCCTGAACAAATAAAACAGA
GATGATAGCCGGTGTCTTCCAGGGATAAAAACGAGCTCAGAATGTTGATTCAAATTAGTCAGATAGTTATGGTGCCACACTCCACATCCCCCCCACAGCCCCACCCACTCGCTTGACCCA
ATGTGGCAGAGGACTGCCGCTGCTGCTGCCTCGTGTGGATTGTTGGGTGGTTGGGGCTAATGGAGTTTGCAAGAAGTGGGCGCAAAATGTGGATCAAGCAGCCGCATTCGCACTCGCACA
AAGGGTTGCTCTTCGCCTTCTGCTGCTGCTGCTGCCACTCCTGCAACATAGTGCGGCTCCTGCTCCTGCTCCTTCTTAGAGAGAGAAAGAGAGAGAGAGAGAAAGAAATGCGAGCCTTTG
CAAATTGTTGCTGCACCCGCATCCCAGTCGCCATCGGTCTGGACTGCCTCTGCCACTGCCTCGCCCCACTCCACAGCCACCGCAACGTGCATGTGGCTGCCACACAAGAGAGATGTGGAT
AGAGAGTGTAAGAGAGAGGTTACCACATGGATACCAGTGGGTCGACTAGCCTCAGGACTTGGGTCTTTCATCAGGCCAGAGCCGGAGCCGGAGCCAGAGCCAGAGCCAAGACCGAAACCA
GATAGCAGGAGGCGGAAGGCAGGAGGCAGGAGCCAGGAGCCAGGGAGTCGCCGTGGCAGCGGCAGTGGCGGCTTTGTTTATGTGTGGCTCCATTTGGGCGTATGCATGTCCTTCTCCTAC
GGCTTCTCTCCCTTGGATTTACTCCATGGTGGTTGCATGCCCCCTGCCCCTGCCCCTGTCCCTGCCCCTGTCCCTGCCCCTGCCTCAAGCTCTACGTGCGAGTGGTTTTTGTGTTGTTCT
GGATTTTTAAGTTGTTTTCGTTGTCGTTGGTTGTTTGTGATGTTGTTTTTTGTTGTTTTTGCTTTTTTTTGTGTGCGTTCATCTCCTTTTTTGTGTGTGCCTTTCCTTGTGTTGCATCCA
CGTCTTTAGTTGCAATTTGAGCATACCAACAAACATATGCACTTAACACACACGAACATGGACACGAGCACGGACACGGAGCACTCACACGGAGAAAGGATGAACGCTGACACCAATTAG
TGCCTCCTGCTGCTGCTGCTGCTGCCGCTGCTGTTGCAAGTTACTGCTGCTGCTGCAAGTTAGTTAGTTGCTGGGTTGTTTGTGCGTTGCATGTTTACACTAGCCACAAAACATAATTTC
TGTTTAGACAACTTTAGCGGCAGCCCCACTTTCCAGTTTTCCACTTTCCGTGCCGTTTGTGGCCACAGGAACGGCCCCTGTCCGTGCAGCACCTTCGCCCTCTGCTCCTGCTCCTGCTGC
TGCTGCCCCTCGACAAAGGGGAAACGTGGCAGGAAGGATACCCTGGACGAGCCAATCATTGCTTTGCTTCAGACTACCGATTGTTCCTGTGCCAGCTATATGATATTGTGATCCCATCTG
ATCCTCACTGAGAGCCAACGTGAGGCAAGCATCAGAATCCTATTACCCCGCCCCTAGGGCTTCGGTATGGGCCCATAATTATCGCAACAACAATGACACGAGTCCCCGCATCCCACATCC
GGCAGCGGTAAGCGAAGTTGGCCAAAAAGGCAGCAGGCAGGAGCAGGCAGCAGGCAGCAGTTTGCATTTTTGGTATAATTTTCACTTTTGCCAAGGAAACTTTTTCGCTGCCGCATTGAA
TTTGCAACCAACTAAAACCCGCCACACCCAGACCAGCGGTTGCCTCTGTTGCAGCTTGAAAACTTCCTGAGTTGATTAGAAAGTTGTTTTTTTAGCCGCTGTTGCTGCCACATCCTCCCT
GCAGTTGCTAATGGCAGCTTAGAGCAAAAGGAGCCGGGCATGGCAGCGCAGGGCAGGGCAGGGCAGGGCAGGAGGATGTTGCAAGGCCCCCTCGCAGCTCGCGAGCATATGCGAGGAGTG
AGACCTCAATCTGTGGTTGAGTTCCTCGTCGTTTGGTTGCTTGGTGACTTGGGATTGTGGCATGGTTGCTACTAGGGCGCGCAAAGCTTATCGCTTCGGTGGCTTGTCGTCAGGCAGCAG
GCAGCGGCAGCAACATAAACTATGCGAGCATCAACTTTTTTTGTAATTAATTTTTAATGTGTGTGCAAAAAAAAATGTTTACGTACATAAATGTTCTTGTAGTTTCTGCCTCCCCCTGGC
TCCCCCTGCCATATCAAGGGGATGTGGCTGGGAGCGAAAGGGTTTATCAAGCGCTCTAAGAGGCGGATAAGCAGCGCTTAAGTGGGTGCCACAGAGGAAGAGGAAGGGGAAGAGGAAGAG
GGTAGCTATGATTTAAGATTGTGTTACGCCCAGAGGAAAATAATTGGATTGCCTTAAACAGCGTTGGCTGTTGGATACAACAAAAAAGAACGATGCCTGACAAATGGGTTTCCCTTGTGC
GGAATATACACGCCTTTCTATCAATCCCTAATTGCATATGACAATTGCTATTGCACCCATACCCAAAGAGAGAGAGAGAGATAGAAGAAGAAGAAGAGCACATGACAGACCAGACGGGAC
GGGAAGGGAAGGGACAGGATAGGACAGGACAGACACTGGCAACTTGCTGCAATTTGCTTTGGAACCAAAAATTGATTTACCCCCCGACTGCTAAACGTGCCACATCCTCCTGCCAACCAT
CCATCCTTCCATCTACGTCCCCATGTCATCTGCCAGATAAACGATTTGCTCCATACAGCTACATCTACTGCTACATCCACTGCTACTGCTATCATGATTTCTCACTTTGTTCCTCCTCTT
TTCCGTACATTTTGCAGAGATTTGCGTTTCAATCACTTCGAGGAGGTGCCGGCAGACGCTTTCCGCGGCATGGGGCAACTGTCGACGCTGTTCCTGAACGAGAACGAGCTGGCCCACCTG
CAGGATGGGGCCTTCCAGGGGCTGCTCGCCCTGAGGTTCCTCTATCTGAACAATAATCGGCTAAGCCGCTTACCGGCGGCCATCTTCCAGGGATTGCCGCGCGTGGAGGCGAT
GTAAGTG
AAACGCGGCACAGCCCTTAATTAAGGATATGCAAAAAGGCATAAATCGCCTTAACGACGCCCACTTTTCCGCTTTTCCCCCTTTCTCCCGCCATCCACTGTTAGATATCTGGAGAACAAT
GACATTTTCCAGCTGCCTGTCGGAGTTTTTGACAATTTGCCACGTCTGAATCGCCT
GTAAGTTGGATGGATGGACGGATACGAGAGGGAGATTAACTTTTTTGGTGGGTGCATCTCCATT
TTCCAGCTTCCTTTACAATAACAAGCTCACCCAACTGCCGGTGGAGGGATTCAACAAACTGAACAGCCTGAAGCGTCTGCGATTGGATGGGAATGCCATCGACTGCAACTGCGGTGTGTA
CTCCTTATGGAGACGCTGGCATCTGGATGCCCAGCGTCAGCTGGTGACCATCTCCTTGACCTGTGCCGAGCCGCAAGCCCTGCAGCGCCAGAGCTTCGCCAGCCTCCAGGAGCAGCACTT
CAAGTGTG
GTAAGTGCGAACAGAACAGAGCTGAGAACGGAGAACTGAGAGCTGCCCTTCAATCTTTCACCCGTTGCAGCCAAGCCCAATCTCCTGGTGGCCCCACAGGACTTGCAGACCT
TCGCCGGGGAGTCCGTTCAACTCGACTGCGAGGTCACGGGTCTGCCCAAGCCCCAGATCACGTGGATGCACAACACGAACGAGGTCGGCGAGGATCAGGTCAACCGGGAAATCCTGCTAA
GCGGCAGCCTGCTCATCCGCAGCGTGGCAACCACTGACATGGGCATCTATCAGTGCCTGGCCCGCAACGAGATGGGGGAGGTACGCTCCCAGCCCATCCGCCTCGTTGTCAGCAGCAGCA
GCAGCAGCAGCAACCGGAACCCACTGGACAACCCCCACATCGACCCTAGCAGCAATCAGGTATGGGCGGATGCGGATGCAGGAGGTGCAACACCCACGCCACCGAGCTTCACCCACCAGC
CGCATGACCAAATTGTGGCCCTTCATGGCGCGGGACACGTGCTCCTCGATTGCGCCGCCTCCGGCTGGCCACAGCCGGACATACAATGGTTCGTCAATGGTCGCCAGCTCGCCCAGTCCA
CCGCCAGCCTCCAGCTGCAGGCCAACGGCAGCCTGCTCCTCCTGCAGCCCACCCAGCTGACAGCCGGCACGTATCGGTGCGAGGCGAGCAATCGCCTGGGCACTGTCCAGGCCACCGCCC
GCGTGGAGGTGAAGG
GTGAGTGTGACACAACAACTTCCAGAAGCAAGGGGGGCTGGGGGGGCACGGCACTCGTTTCGGGATTGCATTTCAGTCACTGCCAGACGACATACCATCGTCCAC
AGTCCAGAGTCCGCAGTCCGCAGTCCGCAGTCCACTGGCAACACAGTCACAGTCACAACTGTCGCGTTTTACTCAATTTGCAGTCGATTTAATTTGTTTTCGCCTGAGATGAGGATGAGG
ATGAACATGGAGCATGAAGCATGCAGCATGAAGCATGCAGCATGGACTCTGCGACTAGACACTGAGATTGAACATGGAGTCTGCTTTGGATCGGGGTGTTCGGGACTATGCGGAAGAGCT
TGTCGAGGGGTTTTCATAGATGATTGGATTATGTCAGATGTGGCGGCAAAACGGTGGCAGAAGGGTGCTCCTCCGTCAAATCAGAGTACAAAAGGACGGGACGGCACGGGTACTGCTGTA
CGAAAAACCTAACAAAAGAAGAGCATTCAAACTTTTGGTTTAACCACGAATAAATGTATGAAAACAATGTTTCGCTTGAGCATTTTTATGTTCATTCGTTATTGCTGCAATTCAAGCGTT
TGTACGTGACTGTACTTTATTGCGCAATAGAAATGGACGGGGGGCCAGCAGGGGAAAACGCCCTGATATGTCCATAAGGGAAGGGGTTCCCAGACCGACCGACCGACAGACCAACCGAAT
GCCAGAGGGAATGATAGAGTGGCAGAGTGGCAGCGCCTTGATGCAACAATGGCTCATTATAATTTGTGGTTGTCGGCACAAAATGAAGAGCAGACAGCCGGAGCAAAATTTATGCATTAT
TTTGGAAAATAAGTGCAAAAATTATAAACTATTATGTAGAAGGGGGGGCGGGTGGGGGGTATGGTACGCACAAATTGCGAAGCTGCGGTTATCCCGAAAGTGCAGAGTGCAGTGCTGCAG
AGATGTGCAGGGGACGTGCGAGTGTATGGACTGTTTAAGCAGTCAGGCGATGCGCTTGGTCAGCATAATTAACCCGGCAAACACAGTCACATACCCATAAACCGATGCACAGAGAGAGAA
AAGTTCGATTATTTTCCGAGTCCATTTCCAGTTGTGCGATATAGATCAAAGAGGCATTTTCCAAGATAGTGTTTTCATTCTTCTGTCGATGTACGGATAAAATATATGGGTTTGGTGTAG
ATTTTCTCGGAGTGTAGGGGCAAATGCATGCACTGGCGCACACACACATTCACGAGCATATGAATAAGCAAATAAATATGCTGGCACCGCTCAAAAGTATGCAATGCAAAAATTTGTATT
CCATACGCCCCAGGGGGCAGGCGGCAGGAGGCAAAGCAAAACCGTGATCAAAGCGAAAGGAGGGGCGTGCAGTGGGTAGGGAGAGGGAGAGGGATATCGAGTGGGATACAGAGTGGAACG
AAGAAAGAGTTTATGGACAAAAGGCGGAATAGAAAACGAACCGCAGGCGGCGTCGGCGTCGCCGTCGACGTCGGCTATGACCATGTGCCTTTTTTGTTGCTGCCATTTGGAGCGATAGAA
TTGCTCGAAAATCGCTCATCCGCGATTCATACCACTTGCAGATTTGCCCGAAATTTTAATGGCACCCCAAAACCAAACAATCAAACTGGGCAAAGCCTTTGTGCTGGAATGCGATGCCGA
TGGCAATCCACTGCCCACCATCGACTGGCAGTTCAATGGATCCCCGCTCGCCAGCACCCCGTCCGGAGACCTGCTGCTGGAGAACGAGAACACAGAGCTGGTGGTTAGTGCTGCCCGCCA
GGACCATGCTG
GTAAGTGGTTCAGTGCGGGGCGGGACCTCTCGGGAAAGTGATTCCAAATGGCTTACATTTCATTTCATTTCTCTCTCCCCTCCCCTCCCCTCCGCTCCCCGTGCACGTT
CCTGTTGCAGGTGTCTACCGGTGCACGGCGCGCAACGAGAATGGCGAGACGAGTGCCGAGGCAACGATTAAAGTGGAACGCTCCCAGTCCCCGCCTCGGGTGGCCATCGAACCGAGCAAT
TTGGTGGCCATTACGGGCACCACCATTGAGCTGCCCTGCCAGGCCGAGCAGCCGGAGGTGGGACTGCAG
GTAAAGTTTCCCGAACGGAATATCCCAAAAAACTTTTCTTTTTTATTTGCC
CCGCCACTTGTTGACGCTTCCTTTGGCTTTCCCACCCCCCGGCCACATCCTCTCCCCCTCTGTCTATCTCTCCCTCTCTTTCCATACAGATTTCGTGGCGCCGTGATGGTCGCCTCATCG
ATCCCAATGTCCAGCTCACGGAAAAGTATCAAATAAGCGGCGCCGGCAGTCTGTTCGTGAAGAATGTGACCATCCTCGATGGCGGTCGCTACGAGTGCCAGCTGAAGAACGAATTCGGAA
GGGCCTCCGCCTCGGCGCTGGTTACCATCAG
GTGAGTGGCGGTGGCGAAAAAACCGGGATGCGGAATCAAATAGTTCAACTTTGAGTCTCAAACCGCAACTTTAATTGCGCTCCAGAGTG
GGATGGGATGGGACGGGATGGGGGCGGCATGGCAGGGGGCGGTCTCCATAAAACTCCATTAAAATCAAAAAGGGAAAACTTTTTCTCAAAGAGAGAGAGCAGAGCAGAGCAAAGCAGAGA
GGACTCACCAAGAAAAGGCCTCGACAGGCAGACGACGACGACGACGACGACGACGACGACGCCGACGACGATGCAGTTAAAATGCGTTTAAGTGCGCGGTAAACTTGTTTAATTAATTGA
AAAATACTCGTAGTTGTGCCACAGCAGAAAAAATATGTACACAGCAGCAGTCACACAACAGTGGGAGCTACTGCTTCGGGAAGGCCTGCAAATGCCGCCAAGAAAAACGCAAAAGCACGA
TCCCCGATGAAATTATGCAAGGTGGTCCGCTCTCGCAACGCGCTCTCTTTTTGGGTCTTACTTTGCCCAGTACAACAGCAGAGCGCTCTCAGTAGAGCGTAAAATTAGACCCGAAAGAGA
GCTGATCTTGGGCTGAAGAAAACACAATATGCAAAGACAGTAAAGACAACAAGCGAAAAGGTGTCGCCTCTCCCTTACGTTTTCCTTTCCGGCACACAAATGAGGAGCCGACGATTCGCG
GTTACGTCAAGCGCGTGACGATTTAGAACGAACGAAGAAGCAAAAGGAAATCCAATAATTCACAGCAAATTCAATGAGTGCGTAGATTTTTTTTGTAGATTAATGTAAGGTGAGGACCGA
CAGAACTGAAGTAACGAGAGAGCGTGAGATCACCAAGACTTGGAATGGCTGGCCTCACCTTTGCAATGAGACATCGTTGGTACATATGTAGGCCCGTAATTACAAAATTTTCAAGATATA
TAATCCTGTCATGAAGCTGATTTGAATGCACTTCCAAAAATAGTTTTCAAGGCAGGAAGCCCTGCGAGTGCACCGACAAATGCCAGCCTCAAATGATTTTTTAATCCGGCTGTTGCTCCA
CTGTGCTAAATTGCTTGGAAAGCACTCACACTCCTGCAAAGACCCGTTGTCCGGCTGCGAGTCCGGGTCCGGGTCCGCAAAAAAGGCGGCTATGAAAAGAACATAAAACCATAAAATAAA
GCCAGCAGCTAAACTCCAGCACAGTGGCTAGAAATACATAGGAATCTTGAAAATTGAAACAGCCAAACAGTCGCGTCAGTGTGCTTTTCAGGCAGTTAAAAATTGACATAACTTGGCTAA
TAGCTTGGGACACTTTCCGCCAAATCAGAGCCCACTGTGCCGCTGGCTAAACTGCATATAAAATATGCCCCAAAAAAGAACATCAAAAGGCGGCAACGAAAGCACAAAAGTTGTCGTTGC
CGAAAACGTGCTAAGCCCCGGACAAGCTACGTGCCACATACCCCACCGTACACACAGATAGAAAGAGAAAGGCGAAAGAGACGGGGACGGGGACAGAGGCAAAGATAGACAGAGAATCTC
TCACAGAGGCAGCCGCACAAGTTATCCAAATTGCCCAAATTGAAATTGAGTTGACAAGTTGCCGGCTGGAACACGAAAGGAGTACAAGAACTAGAACTAGAAGTGGAAGTGGTAGTGGTA
GTGGTAGTGGTAGTCGTGGTGGAAATGGGACTGGAATCTTCTCCAGCTTTCATCTTCCATGTGCATCTGCGTCTGCATCTCCCACTTCAACTTTAACTTTCTTTTGGGTTCACATACATA
TATATTGGTAGTACTCCTCGAAAATAGAACTTTTCCAAATTGTTTGTTCCGCAAATATGGCAAAGCCAACAAAAAAACAGCCAGAAGATGGAAAAGAGACAAGGAATTTATTGAGCACAG
GCTCCATCCACATCCACGGCTGGCTCCCGCCTTGGGTCGTAAATCAATCTGAGGCAAGCAGAGGGAAGCAGTGGCAGGGACAGTGGCATATCTGGCCATTAACCGAGGGGTAAACGTTGG
ACCATTGATGGCCCACAAAGAGAGAACCGAACCGAACCGCATCGCAGCGGCTTAGTTTTTGCTTACACAGACAGGCAGCATTTTCCAAATGCATAATGCAGCTAAAGGGAAAACCAGAAG
GAGGAGGAGGGGGATCGGAAAATAAGGATTTCCATGTACATGTATGTGGTGCACGCACCATTTAGTGCGGCAGAGCCCGGAAGCCGAATCGGCTTACAGGGGAGCCGTCGGCATTAGAAA
CTTTACTCATTACGGTGCCAGCCGCAGTCGCCAGACCGCAGCAAAGGACCAAGAATTAAAAGAAGAAAAACAAAAAAAAGGCATAGCATAGCAGAAGAGTAAGTAGTCCGTAGTCCGCTG
TCCGTGGTCCGGAGAGAGTGTGAGAAAGCAACGCTAAAAGTGAAAAACTATGTTGAAAGACGAAAAGGAAGTGCAGTGCAGTGCAGCGCAGGGCAAGGACAGGGACAAAGATCCGGTGTG
TAGGGAAGGGAGGAACCGTGGAAGCGTCTCTCTAACAAAAAGTGAGTGAAAACCGCTGAAAGATTCCCTCCGCTCCCCTCCCCTCAGCACCTACCCACCGCCATCCAGAAGGCAGCACAC
TGAAATCCGCCTAAGTTGTGGGTAATGCCGGCGTAAAACAAAAGCTTATCCCGTTACTGCCACCGTTACTGCCCCTGTTGCTGCAGCTCCTCCTGGGGCTGCTGCTGGCGAAAAAGGCTA
ACCACGGAAATACATTGCCATACGCCGCACCGCACAGCATGTGGCAGAGCCAGAGGGCGGCAGGGCAGGGCAGGGCACGGCGGGGCAGGGAGACCAAAACCAACAAAAAACTTTAGCAAA
ATGAGGCGACTGCAAGTGGATGGAGACTAAAGGTATACCCTGACTAACATTCCCGAATCAGATCAATTACATTGATGGAATGAGGTATCAGAGGAGCCCTTAAAAAGAACTAGAATCAGG
AGAAGACTTATCATAGAAATGAGATCCATTCTCTAGCATTTGAGAGCATATAGATTCTAGAAAGATTCGCTTGACCTCCTCACAGGATTAGAAATTCCTCACATACCCTACACACAAAAA
CAGAAAAGCAAAGGAGCAACCACAGAATGGCAGAGGGAAAATATATGCACTCGGGTCCTGGCCTGGCAGTGGCCCAGGAGCAGTGGCTACCCACTAGAAGCACTACCAAACTATCCCACG
CAGCAGAGCCACTGATAGTGGCAGACTTTTGGCACGGCACAAGACGGCACAGCAGGGCACTACTTGTGGTGCAACAGGGTGTATTATGGTCGTTAAGTTATTACCTAGAACGTCGCCTCC
GTCGCTCGTTGTAGCCGCTGCCATCGTCACCCCGCACAATGCCAAAGTTTACACAGGCGAAAGTTTTCCGAGGATTCTGAGCATTCCTTGAACAGCCACGCTGCATGGCAGACAGAGAAT
GTGAGGCATGAATTGTTGTTAATGCTGCCTCCCCTCCCTTTGCAGCAGTCAGAGTTTGAGAGCGCGGATTTTCCTTTTGGCGCACAAAAAAGTGCAGCAAGATTTCCAGGGGGTGACAGG
GGGAGGACTGCCCGAAGGACACACAGACGGAGAGACGGACAGACATCTAGGCGAAGAAAGGGAAATAAACTGGCTGCCATTTTTATTAGACAACGCGGCCATTTTAACGACTCCTCGGAG
GCGTCTCTGGCGCTGGCGCTGGCGCTGGCATTATGGTAATTAAAATGTGGAAATTCCTTGAAAATATCTTGATTGTTTCTTCGCTTTGTGCCGCGTCGTCGCTTTGTGGTGGAATATCTG
CTCTAGGAATCTCGAAAGTCTAGCCCTAGGATTGTAGTCCATTGTTGTAAATTAATTGGTCCATTTTTGGGGAATATCTTCTCCTTGAATCATTACCAGAATCCAGATTCCCCTGTGAAA
TCCTTTCTTTGCAGAAACAATGTGGATCTGGCACCGGGAGATCGTTACGTGCGCATTGCCTTCGCGGAGGCGGCCAAGGAGATTGATCTGGCCATCAACAACACCCTGGACACCCTCTTC
TCGAACCGCTCGTCCACGGGGCCACCGAACTATGGGGAGCTGCTGCGGGTGTTCCGCTTCCCCACGGGCGAGGCAAGGCAGCTGGCGCGTGCCGCCGAGATATACGAGCGGACCCTGGTC
AACATCCGAAAGCACGTGCAGCGGGGAGACAACCTGAGCATGAGCAGCGAGGAGTACGAGTTCAGGGACCTGCTCTCCAGGGAGCATCTGCATCTGGTGGCGGAGCTGTCGGGCTGCATG
GAGCACCGGGAGATGCCGAACTGCACGGACATGTGCTACCACTCGCGCTATCGCAGCATCGACGGCACGTGCAACAATCTGATGCATCCCACATGGGGTGCTTCCCTTACGGCCTTCCGC
CGCCTGGCGCCGCCTATCTACGAGAACGGATTCAGCATGCCCGTGGGCTGGACAAAGGGCCAGCTGTATGCCGGCCATCCGAAGCCCAGTGCCAGGCTGGTGTCCACCTCGGTGGTGGCC
ACCAAGGAGATAACCCCGGACAGCCGGATCACACACATGGTGATGCAGTGGGGCCAGTTCCTGGACCACGATCTGGACCACGCCATACCCTCGGTGAGCTCGGAGAGCTGGGACGGCATC
GACTGCAAGAAGAGCTGCGAGATGGCCCCGCCCTGCTACCCCATCGAAGTGCCGCCGAATGACCCGCGTGTGAGGAACCGCCGCTGCATCGATGTGGTGCGCTCCAGCGCCATCTGCGGC
TCGGGCATGACCTCGCTCTTCTTTGACAGCGTCCAGCACCGCGAGCAGATCAACCAGCTGACATCCTACATCGATGCCTCGCAGGTGTACGGCTACAGCACGCCCTTCGCCCAGGAGCTG
CGCAATCTGACCGCCGACGAGGGTCTGCTCCGCGTGGGCGTCCACTTCCCCAAGCAGAAGGACATGCTGCCCTTTGCGGCCCCGCAGGACGGCATGGACTGCCGCCGCAATCTCGACGAG
AACACCATGAGCTGCTTTGTGTCCGGGGACATACGGGTTAACGAGCAGGTCGGCCTCCTGGCCATGCACACCATCTGGATGCGAGAGCACAATCGGCTGGCCACCAAGCTGCGCGAGATC
AATCCCCATTGGGACGGCGATACGCTGTACCAGGAGGCCCGCAAGATCGTCGGCGCCCAGATGCAGCATATCACCTTCAAGCAGTGGCTGCCCCTGATCATCGGCGATAGTGGCATGCAG
CTGCTCGGAGAGTACAAGGGCTACAATCCGCAGCTGAATCCGAGCATTGCCAATGAGTTTGCCACAGCTGCCCTGCGCTTCGGCCACACCATCATCAATCCCATCCTGCACCGTCTGAAC
GAGACCTTCCAGCCCATTCCGCAGGGCCATCTGCTACTCCACAAGGCCTTCTTTGCCCCCTGGCGCCTGGCCTACGAGGGCGGAGTGGATCCCCTGCTGAGAGGCATGCTGGCGGTGCCC
GCGAAGCTGAAGACCCCCGACCAGAACCTCAACACGGAGCTCACGGAGAAGCTGTTCCAGGCGACGCATGCGGTGGCCCTGGACCTGGCCGCCATCAACATTCAGCGGGGCCGTGATCAC
GGCATTCCCGGCTACAATGTCTACAGGAAGTTCTGCAACCTCAGCGTGGCCGAGGACTTTGAGGATCTCTCGGACATCAGCAACGCGGGAATTCGGCAGAAGATGAAGGAGCTGTATGGT
CATCCGGACAACGTGGACGTTTGGTTGGGCGGCATTCTGGAGGATCAGGTGGAGGGCGGCAAGGTGGGTCCGCTGTTCCAGTGTCTGCTCGTCGAGCAGTTCCGTCGCCTGCGCGACGGC
GATCGCTTGTACTACGAGAATCCGGGCGTGTTCCTGCCCGAGCAACTCGTCCAGATCAAGCAGGCCAACTTCGGACGCGTCCTGTGCGATGTGGGTGACAATTTCGACCAGGTCACCGAG
AATGTGTTCATCCTGGCCAAGCATCAGGGCGGCTACAAGAAGTGCGAGGACATTCCCGGCATCAACCTCTATCTGTGGCAGGACTGCGGCAACTGCAACAGCATGCCCACCATCTTTGAC
TCCTACATTCCACAGACGTACACCAAGAGGAGCAGTCGCCAGAAGAGAGACCTCCGACAGCCCAAGGAGAAGGAGCAGGAGGAGGTCCCAGCCACCGAGAGTTACGACAGTCCCTTGGAA
GCCCTCTACGATGTGAACGAGGAGCGCGTTAGTGGCCTGGAGGAGCTGATTGGAAGCTTCCAGAAGGAGCTAAAGAAACTGCACAAGAAGCTGCGCAAGCTCGAGGACTCCTGCAATGCC
GTAGATGCCGAGCCAGTGGCCCAGGTGGTGCAGCTCGCACCAGCACCGGCCCCCGTTGCCCCGAAGCCCAGGCGCAGTCACTGCGTGGATGACAAGGGAACAACGCGGCTGAACAACGAG
GTCTGGTCTCCGGACGTGTGCACCAAGTGCAACTGCTTCCACGGCCAGGTAAACTGTTTGCGGGAGAAGTGTGGCGAGGTGAGCTGCCCGCCCGGAATCGATCCTCTGACGCCGCCAGAG
GCCTGCTGCCCGCACTGCCCGATGCTCAAAGGAGAGCTGCCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGTGGCGAGGAGTGCTCCTGTTCCACCTGTTCCTGCTGGCGGGCTGGTCGGAGGCCGCCTACTGTCCGACGGGATGCAACTGCTACGAGCGCACCGTGCGCTGCATTCGCGCGAAG
CGCACGACCACTCCGCAAGTGCCCTACGACACCCAAGTTCT
AGATTTGCGTTTCAATCACTTCGAGGAGGTGCCGGCAGACGCTTTCCGCGGCATGGGGCAACTGTCGACGCTGTTCCTG
AACGAGAACGAGCTGGCCCACCTGCAGGATGGGGCCTTCCAGGGGCTGCTCGCCCTGAGGTTCCTCTATCTGAACAATAATCGGCTAAGCCGCTTACCGGCGGCCATCTTCCAGGGATTG
CCGCGCGTGGAGGCGAT
ATATCTGGAGAACAATGACATTTTCCAGCTGCCTGTCGGAGTTTTTGACAATTTGCCACGTCTGAATCGCCTCTTCCTTTACAATAACAAGCTCACCCAACTG
CCGGTGGAGGGATTCAACAAACTGAACAGCCTGAAGCGTCTGCGATTGGATGGGAATGCCATCGACTGCAACTGCGGTGTGTACTCCTTATGGAGACGCTGGCATCTGGATGCCCAGCGT
CAGCTGGTGACCATCTCCTTGACCTGTGCCGAGCCGCAAGCCCTGCAGCGCCAGAGCTTCGCCAGCCTCCAGGAGCAGCACTTCAAGTGTG
CCAAGCCCAATCTCCTGGTGGCCCCACAG
GACTTGCAGACCTTCGCCGGGGAGTCCGTTCAACTCGACTGCGAGGTCACGGGTCTGCCCAAGCCCCAGATCACGTGGATGCACAACACGAACGAGGTCGGCGAGGATCAGGTCAACCGG
GAAATCCTGCTAAGCGGCAGCCTGCTCATCCGCAGCGTGGCAACCACTGACATGGGCATCTATCAGTGCCTGGCCCGCAACGAGATGGGGGAGGTACGCTCCCAGCCCATCCGCCTCGTT
GTCAGCAGCAGCAGCAGCAGCAGCAACCGGAACCCACTGGACAACCCCCACATCGACCCTAGCAGCAATCAGGTATGGGCGGATGCGGATGCAGGAGGTGCAACACCCACGCCACCGAGC
TTCACCCACCAGCCGCATGACCAAATTGTGGCCCTTCATGGCGCGGGACACGTGCTCCTCGATTGCGCCGCCTCCGGCTGGCCACAGCCGGACATACAATGGTTCGTCAATGGTCGCCAG
CTCGCCCAGTCCACCGCCAGCCTCCAGCTGCAGGCCAACGGCAGCCTGCTCCTCCTGCAGCCCACCCAGCTGACAGCCGGCACGTATCGGTGCGAGGCGAGCAATCGCCTGGGCACTGTC
CAGGCCACCGCCCGCGTGGAGGTGAAGG
ATTTGCCCGAAATTTTAATGGCACCCCAAAACCAAACAATCAAACTGGGCAAAGCCTTTGTGCTGGAATGCGATGCCGATGGCAATCCACTG
CCCACCATCGACTGGCAGTTCAATGGATCCCCGCTCGCCAGCACCCCGTCCGGAGACCTGCTGCTGGAGAACGAGAACACAGAGCTGGTGGTTAGTGCTGCCCGCCAGGACCATGCTG
GT
GTCTACCGGTGCACGGCGCGCAACGAGAATGGCGAGACGAGTGCCGAGGCAACGATTAAAGTGGAACGCTCCCAGTCCCCGCCTCGGGTGGCCATCGAACCGAGCAATTTGGTGGCCATT
ACGGGCACCACCATTGAGCTGCCCTGCCAGGCCGAGCAGCCGGAGGTGGGACTGCAG
ATTTCGTGGCGCCGTGATGGTCGCCTCATCGATCCCAATGTCCAGCTCACGGAAAAGTATCAA
ATAAGCGGCGCCGGCAGTCTGTTCGTGAAGAATGTGACCATCCTCGATGGCGGTCGCTACGAGTGCCAGCTGAAGAACGAATTCGGAAGGGCCTCCGCCTCGGCGCTGGTTACCATCAG
A
AACAATGTGGATCTGGCACCGGGAGATCGTTACGTGCGCATTGCCTTCGCGGAGGCGGCCAAGGAGATTGATCTGGCCATCAACAACACCCTGGACACCCTCTTCTCGAACCGCTCGTCC
ACGGGGCCACCGAACTATGGGGAGCTGCTGCGGGTGTTCCGCTTCCCCACGGGCGAGGCAAGGCAGCTGGCGCGTGCCGCCGAGATATACGAGCGGACCCTGGTCAACATCCGAAAGCAC
GTGCAGCGGGGAGACAACCTGAGCATGAGCAGCGAGGAGTACGAGTTCAGGGACCTGCTCTCCAGGGAGCATCTGCATCTGGTGGCGGAGCTGTCGGGCTGCATGGAGCACCGGGAGATG
CCGAACTGCACGGACATGTGCTACCACTCGCGCTATCGCAGCATCGACGGCACGTGCAACAATCTGATGCATCCCACATGGGGTGCTTCCCTTACGGCCTTCCGCCGCCTGGCGCCGCCT
ATCTACGAGAACGGATTCAGCATGCCCGTGGGCTGGACAAAGGGCCAGCTGTATGCCGGCCATCCGAAGCCCAGTGCCAGGCTGGTGTCCACCTCGGTGGTGGCCACCAAGGAGATAACC
CCGGACAGCCGGATCACACACATGGTGATGCAGTGGGGCCAGTTCCTGGACCACGATCTGGACCACGCCATACCCTCGGTGAGCTCGGAGAGCTGGGACGGCATCGACTGCAAGAAGAGC
TGCGAGATGGCCCCGCCCTGCTACCCCATCGAAGTGCCGCCGAATGACCCGCGTGTGAGGAACCGCCGCTGCATCGATGTGGTGCGCTCCAGCGCCATCTGCGGCTCGGGCATGACCTCG
CTCTTCTTTGACAGCGTCCAGCACCGCGAGCAGATCAACCAGCTGACATCCTACATCGATGCCTCGCAGGTGTACGGCTACAGCACGCCCTTCGCCCAGGAGCTGCGCAATCTGACCGCC
GACGAGGGTCTGCTCCGCGTGGGCGTCCACTTCCCCAAGCAGAAGGACATGCTGCCCTTTGCGGCCCCGCAGGACGGCATGGACTGCCGCCGCAATCTCGACGAGAACACCATGAGCTGC
TTTGTGTCCGGGGACATACGGGTTAACGAGCAGGTCGGCCTCCTGGCCATGCACACCATCTGGATGCGAGAGCACAATCGGCTGGCCACCAAGCTGCGCGAGATCAATCCCCATTGGGAC
GGCGATACGCTGTACCAGGAGGCCCGCAAGATCGTCGGCGCCCAGATGCAGCATATCACCTTCAAGCAGTGGCTGCCCCTGATCATCGGCGATAGTGGCATGCAGCTGCTCGGAGAGTAC
AAGGGCTACAATCCGCAGCTGAATCCGAGCATTGCCAATGAGTTTGCCACAGCTGCCCTGCGCTTCGGCCACACCATCATCAATCCCATCCTGCACCGTCTGAACGAGACCTTCCAGCCC
ATTCCGCAGGGCCATCTGCTACTCCACAAGGCCTTCTTTGCCCCCTGGCGCCTGGCCTACGAGGGCGGAGTGGATCCCCTGCTGAGAGGCATGCTGGCGGTGCCCGCGAAGCTGAAGACC
CCCGACCAGAACCTCAACACGGAGCTCACGGAGAAGCTGTTCCAGGCGACGCATGCGGTGGCCCTGGACCTGGCCGCCATCAACATTCAGCGGGGCCGTGATCACGGCATTCCCGGCTAC
AATGTCTACAGGAAGTTCTGCAACCTCAGCGTGGCCGAGGACTTTGAGGATCTCTCGGACATCAGCAACGCGGGAATTCGGCAGAAGATGAAGGAGCTGTATGGTCATCCGGACAACGTG
GACGTTTGGTTGGGCGGCATTCTGGAGGATCAGGTGGAGGGCGGCAAGGTGGGTCCGCTGTTCCAGTGTCTGCTCGTCGAGCAGTTCCGTCGCCTGCGCGACGGCGATCGCTTGTACTAC
GAGAATCCGGGCGTGTTCCTGCCCGAGCAACTCGTCCAGATCAAGCAGGCCAACTTCGGACGCGTCCTGTGCGATGTGGGTGACAATTTCGACCAGGTCACCGAGAATGTGTTCATCCTG
GCCAAGCATCAGGGCGGCTACAAGAAGTGCGAGGACATTCCCGGCATCAACCTCTATCTGTGGCAGGACTGCGGCAACTGCAACAGCATGCCCACCATCTTTGACTCCTACATTCCACAG
ACGTACACCAAGAGGAGCAGTCGCCAGAAGAGAGACCTCCGACAGCCCAAGGAGAAGGAGCAGGAGGAGGTCCCAGCCACCGAGAGTTACGACAGTCCCTTGGAAGCCCTCTACGATGTG
AACGAGGAGCGCGTTAGTGGCCTGGAGGAGCTGATTGGAAGCTTCCAGAAGGAGCTAAAGAAACTGCACAAGAAGCTGCGCAAGCTCGAGGACTCCTGCAATGCCGTAGATGCCGAGCCA
GTGGCCCAGGTGGTGCAGCTCGCACCAGCACCGGCCCCCGTTGCCCCGAAGCCCAGGCGCAGTCACTGCGTGGATGACAAGGGAACAACGCGGCTGAACAACGAGGTCTGGTCTCCGGAC
GTGTGCACCAAGTGCAACTGCTTCCACGGCCAGGTAAACTGTTTGCGGGAGAAGTGTGGCGAGGTGAGCTGCCCGCCCGGAATCGATCCTCTGACGCCGCCAGAGGCCTGCTGCCCGCAC
TGCCCGATGCTCAAAGGAGAGCTGCCGTAG

Retrieve as FASTA