Entry information : DsiPxd01
Entry ID 7656
Creation 2010-10-25 (Marcel Zamocky)
Last sequence changes 2010-10-25 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-10-25 (Christophe Dunand)
Peroxidase information: DsiPxd01
Name DsiPxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Arthropoda Insecta Drosophilidae Drosophila
Organism Drosophila simulans    [TaxId: 7240 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DsiPxd01
start..stop
S start..stop
DmPxd-A 3046 0 18..1528 18..1527
DerPxd01 2980 0 21..1528 20..1526
DyaPxd01 2967 0 21..1528 20..1528
DmPxd 2936 0 18..1525 18..1526
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2184701..2184870 170 N° 2 2167179..2167394 216 N° 3 2167030..2167101 72 N° 4 2166708..2166949 242
N° 5 2165891..2166556 666 N° 6 2163783..2163989 207 N° 7 2163495..2163672 178 N° 8 2162917..2163102 186
N° 9 2156817..2159466 2650  
complement(join(2156817..2159466,2162917..2163102,2163495..2163672,2163783..2163 989,2165891..2166556,2166708..2166949,2167030..2167101,2167179..2167394,2184701. .2184870))


exon

Literature and cross-references DsiPxd01
Literature Drosophila 12 genomes consortium (2007) Evolution of genes and genomes on the Drosophila phylogeny. Nature 450:203-218.
Protein ref. UniProtKB:   B4QNK1
DNA ref. GenBank:   CM000363.1 (2156817..2184870)
mRNA ref. GenBank:   XM_002083343.1
Protein sequence: DsiPxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1528 (1505)
PWM (Da):   %s   170393.45 (167998.0)  
PI (pH):   %s   6.22 (6.18) Peptide Signal:   %s   cut: 24 range:24-1528
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRVPLLPLQLLGLLLLLAGGVQSVYCPAGCTCLERTVRCIRAKLSAVPKLPQDKQTLDLRFNHIEELPANAFSGLAQLTTLFLNDNELAYLQDGALNGLTALRFVYLNNNRLSRLPATIFQRMPRLEAIFLENNDIWQLPAGLFDNLPRLNRLIMYNNKLTQLPVDGFNRLNNLRRLRLDGNAIDCNCGVYSLWRRWHLDVQRQLVSISLTCAAPQLLQNQGFSSLGEHHFQAKPQFLVAPQDAQVAAGEQMELSCEVTGLPRPQITWMHNTQEVGLEEQAQAEILPSGSLLIRSADTSDMGIYQCIARNEMGELRSQPVRLVVNGGNHPLDSPIDARSNQVWADAGTPTHGATPVPSPSPSPPHFTHQPHDQIVALHGSGHVLLDCAASGWPQPDIQWFVNGRQLLQSTPSLQLQANGSLILLQPTQLSAGTYRCEARNSLGSVQATARIELKELPEILTAPQSQTIKLGKAFVLECDADGNPLPTIDWELNGVPLPGNTPDLQLENENTELVVGAARQEHAGVYRCTAHNENGETSVEATIKVERSQSPPQLAIEPSNLVAITGTTIELPCQADQPEDRLRQISWRHDGRLIDPNVQLTEKYQISGAGSLFVKNVTIPDGGRYECQVKNQYGRASASALVTIRNNVDLAPGDRYVRIAFAEAAREIDLAINNTLDMLFSNRSDKAPPNYGELLRVFRFPTGEARQLARAAEIYERTLVNIRKHVQEGDNLTMKSEEYEFRDLLSREHLHLVAELSGCMEHREMPNCTDMCFHSRYRSIDGTCNNLQHPTWGASLTAFRRLAPPIYENGFSMPVGWTKGMLYSGHAKPSARLVSTSLVATKEITPDARITHMVMQWGQFLDHDLDHAIPSVSSESWDGIDCKKSCEMAPPCYPIEVPPNDPRVRNRRCIDVVRSSAICGSGMTSLFFDSVQHREQINQLTSYIDASQVYGYSTAFAQELRNLTSQDGLLRVGVHFPRQKDMLPFAAPQDGMDCRRNLDENTMSCFVSGDIRVNEQVGLLAMHTIWMREHNRIASKLKQINSHWDGDTLYQEARKIVGAQMQHITFKQWLPLIIGESGMKMMGEYQGYNPQLNPSIANEFATAALRFGHTIINPILHRLNETFQPIPQGHLLLHKAFFAPWRLAYEGGVDPLMRGFLAVPAKLKTPDQNLNTELTEKLFLTAHAVALDLAAINIQRGRDHGMPGYNVYRKLCNLTVAQDFDDLAGEISSAEIRQKMKELYGHPDNVDVWLGGILEDQVEGGKVGPLFQCLLVEQFRRLRDGDRLYYENPGVFSPEQLTQIKQANFGRVLCDVGDNFDQVTENVFILAKHQGGYKKCEDIVGINLYLWQECGRCNSPPAIFDSYIPQTYTKRSNRQKRDLGQENDDVATADSYDSPLESLYDVNEERVSGLEELIGSFQKDLKKLHKKLRKVEESCNSADSEPVAQVVQLAAAPPQVVSKPKRSHCVDDKGTTRLNNEVWSPDVCTKCNCFHGQVNCLRERCGEVSCPPGVDPLTPPEACCPHCPMVK

Retrieve as FASTA  
Remarks Complete from genomic (chromo 3L, 8 introns), no EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGTTCCGCTGCTCCCGCTGCAGCTGCTCGGCCTGCTGCTCCTCCTCGCCGGCGGAGTGCAGTCCGTCTACTGTCCGGCCGGATGCACCTGCCTGGAGCGAACTGTGCGCTGCATT
CGCGCCAAGCTGTCCGCCGTGCCCAAACTGCCCCAGGATAAACAAACGCT
GTAAGTAATCCATGAACTTAGGATCCTCACCATACATAATATTTTTCAAAAAAAAAAAAAAAATAATAAA
ATAAAAATACTTAAACAATTGGCTAAAGATTTATAGTGCTCCTTGAATTCCAATCTTTAGTTCAAAACTTTTATACGTTGTCCAAGTTTGGCTTCTTTTCGTCGAGTGTACATAAATCAA
CGCGGGAGTTGGCTTGCAAATCCATAAATTAGTTTTTAATGTTTTCTGTGCACGCTGCGAAAAGTTGACGGCGTTAATTTGACGCCCCCCGTTTGTGCTCCTCCTTCCGTGGAATCCCCC
TCGCACCCCCATGGGGCGCTCCTGCTCCTGCGGAATCCATGAATCTTCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTCCGTGGAATCCCCCTCGCACCCCCATGGGGCGCTCCTGCTCCTGCGGAATCCATGAATCTTCCGCCGAGCTGCGCTATGTTGACTCAATTAAAC
GGATGTCTAACAGGCGAAAGCTGACTGCGATTTGTATATTTATCACGCTGCCTGTCGCGTATTTGCATGCATGTGCAATATTTCTGACGTTGCATTTATTTTCGAAAATGTCAGCAGTTT
TCGCATGAATTTTGGGCACCACAACCCTTTTCCGCATCCCACGCAAATAACTTGGCAAATGTTTGCGGAGCATATGCATATTTATGTAGGCCGTGGCATGTCCCAAGCCGGAGGAGCAAC
CTCGCATCCCGGGCAGAATGCGCCAGCTGCTGCAGCCGGTGGCAAGTTATCAGACAGAAAAACAGTCTCCACTGGAGGACAACAAGATATATCCGGACAGACGGAGCACGGTTTTCGTGG
TATTTACGGAGAATTCAATTTCCAGCGGGGTTGAGCCGCGTTCGATGGCCGGGATTCGGGGATTCGCAGCGGGAAAACGCTGCGAAGGATTTTCACACACGCCCGACAGGTGCAAATGGT
GGTCCTGGTCCTGGGAATAGGTGAAGCCACTCACTTCACGTGTCAACGAATCTGGAAGCCTTGAACAAATCGATTATATGGCGCTTTCGAAACTATAAAGTGCTCTCAACCGGCGAACAT
TATTCGCTGATTCGATGTTTTTGAAGCACTTTCGAGTTTAAACTGATACAGTTTAAATCTAAAAAAAAAATGCATTCATAGTGAAGGATTTTCCACTCTGAATGATGGATAATTCAGCGT
TTTTGGGGTGGAAAAAAGGGAATTAAATTGCTTGATTAAATTATATAAGCCGAAAGAAAATGCTCCAGCAAAGAGGTGGATTTTAAAACTGCTGACAGGTGGATAAATAAATGGGTGAAA
CCAATTACTGCAGCTGTCATCGAATTTGGAGTCCCCAAATAAATGGATTTATTATTTAACTACATCACGGTGGAATGAGGTTCACCCATTTTTGTCATTTGGAAATTTAAAGACTGCCAC
AAATTTAATAATAAATACTTTATTGCATTAAGTAGCGATTGACACAACGAAATAAATAGGTGGTGTTAGATTATGCATTTAAGCCCGCTCGACAGGTGACAAAAGCATGAAAGGTTGGCT
AAAATAAAAATAAAAAAATTCTAAAATTGAAATATGCAACTTGAAACTCTCTCTGACCGCAGTCGAATTTATAATTGAGTTAACCAACAAAACAATGCCTTTGTATTTAAATATGCCATT
GTGCAATCCGCTCCTCCATCGAATCCACATTCATTTGCAATCTCACCAGGAGGATCGCATTCTTTGCCATTTGTTTGGCTCGCCGCACAACAATTTCTCAAATGGGCGAAAGCTGTGGAA
AAATGGTAGTGGGAGCCAACAGCATTTGGCAGTACTTAAATTAATCTTCATTTTAAATAAGGTGATGGCTGCATAATTTATCATGCCTCGAGAGCAACAGCATCCGCACACAACAATAGA
AAAAAATACAAAAAAAATACGAAAAACACTGAAAACACTGAAAGTCTGAAAAAGAGCGCAACTTTTCCGTTGCCATTGCGATTCGCTTTTCATTTATTACGCAGCCGACCCGTTGCACAC
TTTTAATTAATTTGTTTCATTTATTACTGCATGTGTCTAAAAGTTGCTCTTGTTCTCCACCCCAAACAAGTGCATGTTTGTGCATTTCGCTTTTGTCTGAGGCTGTCGACTCGGATTCCA
GCTTTCTTTCCATAATTCTCGAAATGTTTCTCGGCAGTCGAGGAAAAATATGAGCACACATTTTCCCAGCCAGAGAGACACTATCATTTTATAGTCCACACATGCCGGCATTTCGGTTCA
GTCATCATGAAAATATTCTTGATTTAATTTCCTTAATGGCGAGAATTTTGTTTACAATTTCTGTCGGCAGGTCACTGAAGATAAATGTCGGGCAAACATGAAAGAAATACAAAAAATCGA
GCTTAGGTAAAATAGAAATCAATTTCGAGTTAAATTAGACAAAGAATTGTAATCAAAAAATATGATATATATTTTTTAAAAATATTCATATAATATATTGAAGAATTGCTGTTTGAATCC
AAGCATCTATATCTATCTATAGTTAGTTTAGTATATTTAACGATCTTCAAGATCAGCTCTAAGAGCTTTCCATTCAAAGATTTTCCAGCATACTTACAAAAGCCTTTTCAGTGAATTCTC
TTCTATTTTGCACACTTCAGCTGCCATTCCTCTTCAATTTGATGCTGCTGCATCTCCAGTCCTCTCAAGGCCTAAGCCACATTTCACTTCTTTCAAACTGTCCATCCATCAGGCATAAAG
TCGCTGCCTTCGCAGCCATTGAAAGTTCTCGCCGAGATGGGGCCATAAAAAATGCTGCAGCAGCTCCACATCCACGAAACATGCCTTTTATATCCTTGACTTGCCTCGAACAAAGGCCCA
AACATTTTTTGGCCCGTCCCGTGTGTATTTTAACTGGCAACTAAATGGAAGTCGAAACTGTGTAACATACGGCATCATTCATCTTGCCACGCCCCCACGCCCCCGCCTCCAACCGCCCAC
TCACATGGCAGCTTCTCCTCCCACACAGCTAAATAAATGCACTTGATTTCATTTCATGATGATGCATTTTTAGCTGACCTCCCGTAAAGCACACATCTCGACTTGCTCCGCCATGGAGGC
AGTTGCTTTGTCATTATTCCCGGGATCGAGCAGCTCGCCCAGCGGACCGCCAGTTGGCCCCCATCCATTCCGGACTCCTAAGCCAGTACTTACTTTTAAGGACCGAGAAAAAATTGCTTT
TCAATGGGGCAAAAGTGGTGAGGAAGCAATTTATGTGGCACAAAGTCAAACTAGATAAGATTTAAAACAATTATGCAATTTAAAGCGCAGAATAGTTATTATTAATTAAAAAGCTAGAGA
GTCTTAAAAAAACGCTAAAGGGAAAAGGATGTATAAGATAGATTGTACTAAATTTAATAAAAATATAAATAGAGAAACTTAGTAGGAATTAAGTAATAATATAATAAATTTGATCTTTGA
TTTCTTTGTCCCCTTTTCGCTCAGTGTATCCACAGTTGCAAAGACGAGCACATAAATCGCACATGTAGCCAAGACATATGAACTGAATCTGCTCGCCCGGCAGCATCTCTGCCACACATG
CTATCATCTAATAACTTGGCCATTATGCACATATGAAATATATCTCATAATGCCGCACCGACTTGCCACGCCCCCCTTGCCCACTTCCTGCTGCCGCCCACTTTGCGGCGGTGTGTCAAA
ACAAAAGTCGCCGCACGTTGCATGCATGGCATATTAAAAAGTTTGATTAGCGTCCAGTTCGCTGGCTCTGCCACGCCCTCCCCCACCACGCCCACTCTCGGACAACATGCCACAAATACA
AACACACACATGAGCACGAACATGAGTGTATGAATACAAATACATATACGTATACATATGGACAATATTTGGCTCGGCTTTTTTTGCGAATCAACTATTTGCGAAAACTATTTTGCTAGC
AAAAATGTTCCAACTCCCCTGTTGCTCCTGCTGCTATTTCAAATCATCCACCCTCTTTAGGCTTCCCATATATATATATAGATATATACATATATTGGGACAAGCCCCCGGAAAAGCCCC
GATTTTGCCGTCATACTTTCCTGAATTTCTCATCTCGTCGGGCGCATTTATGCGTGAGAAATGCCTTGTATTTTGTAGCTGGTCTCCATATCCTTGTTCCTGTTCCATATCCAGTTGCTG
CTGCCATGTTGTTATTAAATATGCATAAATTTCCTTTTTGCACAGGACTTTTGCATTTACATTTGCTGTTTATTTGTCGGTGGGAATATTGAAATTGTTACCAATGGATAGCAGATTCCA
GCCAGCACAGAGAACTTGTTTCCGGTGGGCCGCATGGAGTCGGAGTCGGATCTCCGGACTCAGGTGTGGATGAATATCTATTCGGTTGGGCGGTGGAGGTGGGAGTTGGAGGACTCTGTA
CCCAGATCTATCTATCTGGGTATATATACAGGATATGCAGGATATGCAGGCTGGATGCGGATAATTATAACAGCCGGCAAGTTGTCGGTTCAAGTTTCTGACCGATTTGTGAGTACTTCT
TCGCTTCGTTTGTGTCGAGTTATGAAGCTTATAGTTTTGCAAATAACTTGCTAATGAGATTTATTATTAATAACCTGAGTGCTTTTGCCATTTCTCAGAAACTCTGTGTATTTGCACATT
ATTTCTGTACATTTTATGCAGTTTCTAATGAGTTATGGCCAGCTTATTGAGTACTGTACAATTTGAAAGTATATGTTTCATTAAGACCATATTTCGATAAATCAAATTTACTAAATGCTG
CTCATTTCCTCTGGCCAAATAATAATTAATATTAGGCAAAGATGTTTTTGTGAAAACCTTAATGCGCACTATTTAAAATTATTATTCATGATATTTATGGCTTTATGGCTCTCAGCAGCT
TTTAATTAAAATGTGTCGTAAACAAACAATATTCTTAGTAATAACAACACATTAGATGCACAATACAAAAAAATAGTACAATGTTAAAGTGATTATAACAAACATAAATAATAATCATTT
ACATATTTTCTAAAGAATGAAATAAACAGGATTAATTAAAACTAATCCGGGGTTTTCTTTTGTTTGGTATTAAATGAGATTTAATTTTAAAAACTAGTTCGTTCAGTAATCACCCCACCT
AAGTTCATTTAATTACGCATTTCCGTTGGGTTTAATTTCCGTAAGTGGCACTTGCAATTGAAAAACTCATTCTTCTAACATCGCAGTGCCATCAATCAAAGCTGTCTGCGTTTGTCTAGT
GATAAATCCTCTAAGTGCATTCCGAATCCAATTACCAATCAATCAAAGAGCATCCAATCGTCGCTGTCTCATCCGTCTCCTTTTTATGCAGACTGCCACGCCCCCAAAAAAGCGTCGCCC
CTTTTTGTGAAATATAATATTATTGTTGTTACGCTTTTTGCCCTTGCCGTTCAGTCTGGTTTGACTTTTCAATTGTTGCCATATTTTTGCAAAAAAAAGGGAATGCATGGAAATAAAATT
AAATTGCGTGTGTGAACAATGCGGATGGAATGCTTACCATGCCGCCACCCAATCAATAATATGATTTGTAATTATGCAAATGAAGCGGTAGACCAGCGAATGGGCCACCACTTGAATGGG
CGATGCAGTTTCCATTGATTAAAGCTGAACGCTGGCGAAATATTCACTTTTTACATGGCGAACGTCAAAGGGAAATCCCCGAAGGCAAAGTTTTTGCCAATCAAAGCGTATGCATTTTTA
ATTCACTGTCACAGCCAGAAGTGGAAATGGAGCTGCAAAATCGAGTGGCGTCTCTCGGGTGGGGGATTCCCGATTCGAGAATCGAGATTCGAGATTCGAGATTCCAGGCTCAAGTCTCCG
AGGGGCGAGATTACGGATTCCGCCAAGGAATCTGTCTGCCGCCAGTCAGCCAGGCTTCGCTTCACTTTGACATAGAAAAATCTTCTATTGATTTCCCGAAACTCCCCCTCAATTTGCATT
TAAAGTTGGACGCTTCCATTTCGCCCACCTCTCGCTCTCGTCCCGCTTTAATGCTACAAAGTGCCACTTGGTTCATTTGCCAGCAGTTCTCCTGCTCCTTCGGATCATGCCACTGGCCCA
TGCCACTGCCCCTGCCACTGCCACGCCCACCAGCTTTGTCATTTCGCATGCTCGTTAGTGCGGAGCAAAGAATGCAAAGTAGCAAGATAGCAAGAGCTGTGTGGAAAATACAGCAGCAGT
AGCAGCAGCAGCAACATCATCGCTGCACAAACACATGCCACAATTTATAAGCAAAGTTATTCTGCCACCGAGAAAGGGGTGGCCGGGGGGGCGGGGCTGTGGCATCTAGCAACATGTCAA
AGTGGAGCAATCGGCATGTGCAACGGACACAGAACAGGACACTGAACACGGAAAACAGGCGTGCACTGCGGCAAAAATGGGTAACAAGTTGCGGCTTTCCAAGGCAATATTAAGATGTTC
TGGCGCCCACTGAAAGTTTCCCATCGATTCATGCAAATGTTGCAAAACTACAGAATCATGAAAGTAAATATACTTTATTGTATCCAGCTTTAAAGAAGTCTGCGTTGTGAGGAAGCCGAG
CTATTTAATGGCGTCTCTGAAATTCGCATAATAATAATCCCTCTCTTTCGATAATGGCACAATAGCGCCAGGGATAGATTACAGTGCAGTCCTGGCAACTGGCGGTCAAGCATAAGAAAC
AAGCAGCATCAGCAGCAGAAGAATTGCAGCCGAAGAGGAGCTGCAGCCCATAAGTATGCTATGGCAACGGAGCGAAGCCCAAAAGCGAAGGAATAAGAGCGCAAATAAAAGCGGTGGACG
GCGACTGCTGGATGCGGAGGAGCCCTCCTCCTCAACGGCGCTCCTTGCCAGGTGAGATGCCACCGCCATGTGGCACGAACTACAGTCAACAGCAGGCGATGGCCAAGCCAAGAAAAAACA
AGTCAGCAAGACGAATGTGGCTTAGTAAAATGGGAGATGCTCTTTCGATGAATCAACTAACGATTTAAAATAGCGAACACATCTAAATCAAATATTTCGTTTATAAGAAATCAATTAAGC
AAGGAGCTGATCAGTTTATTTTTGACCCTATATTAGTTGGCTTAAAACGCAAAGGGTATTTCCGTGCGTCAAAGAAAAAGGAGCTCGCTCACTGCTCAACCAGGCGGCAAACCAAGTGGG
AACGGGGTTCGGGGTCCAAGGAGTCCGAGTCCGAGCCAAGTGGCACACCACGTAACCAGCAGATAGCAGATACAAGATTGCTGGTCCGGGTACGGAACTTGCCCCAGACAGATGCATAAT
AATGTTAATGTAAGCGCCAGCGACTTTGGGCTGTGGGTGGACTATGGGTTACCATGGCGTATGCGTAATGTGCAAGCAAATTTGAAGCCATTCTCGGGCGTGTGAGTTGAAGGCCAAGCC
GTAAAGTGAACATGAAATATTTGTATGTATTATACTATTATTATATTATATTATAATTATGTAGTTACTCATCTCAAAATTGGTAAATTAGCTTTAAATTTCTTTAAGAAATTAATAGCT
ATCCTCTATGCGATTCTCTTTAATTTCTCTTGGGTAAAAACCCTTGAACAATTTTCATAAATTTAGAAATGCTTTGTTTTTTCATTTGCCCGGAATATTTATCAATTTTCATCCGACCCA
GCCAAATATATTTATCCCCAGGAAAGCCGAAATAGAATACTGCATCAAGAGGGCTTTGGGTAATATTCGCCTTTTATACGCATATTAAACCGTTTCCACTTGAATGGCGAACTGATTTCA
TTGCATTTTTATAACGCATATATGTTGCATGTGGGCTGAGTGTGCCTCCTCAAATAAAAACGAAGAGCTGCTCATGCACCCAGCTCCATGCTCGACATATAAATCTGCTGTATAATTGAA
TTTCACACGTTGCAGGCGAAAAAAAAATAATACCAAAATGGTGCACAGAAAATAAGAAAAAGTGCATAACCAGCGGCAGCGAAAGTTTAAATAAAATTTATTTCAACAAAAATACACACT
CGTTGGGCAAATGTGTGTGCAGAGATGGCAGTTGCCTGGAAATGTGAGAATTATATATTGAAGGGCGCGTGGGTTGGGAGCTGGTGCAGCTCCTCCAGGTGGCCACTTTTAACCATGAAG
GTGTTTGCCTGGCCAAGCTGGAAGCAGCTTAAGCATGCCACAACGAGCAGCCAGGATGACGAGGGCGGGCTCCTGCGATCGAGGATCTTGAAGCGAGGACTCCCTTAGACAGCCGGCAAT
CGCATGTGTGTGGAGTGCACTTGTGAGACATTTACACCTGTAGAAGCGTCGATGGGGGGGGCGGCCCTACGAGGAGCATTCTGAGCTGGGATATGAGCCACGGCTGAAGGAGCTTTTCAG
GCACAACACATTAGCAGTCCGACAAAACTGGAGAGCAAGGCTGGAAAAGTATTCGCTCCAGCATACGAGCAGTTCTCACGAACTAAAAATTCAACTTTGTTTTATATTTATCCTTATTGC
AAGAGATGCTAACAGGACTTTAAAAGGGTTATTCTCATGAGTGACAGTGAAACGAAGCTCAGAGTAAAAGGCTAACAGAAATAAATTGAGTTATAAAGGTGTCTGAAAGTATGAAACCTT
TTTTTATCACTTTTGGTTTCTTATTTAATCTACTGCACATCAACCACACCACAGATTCTTTTGATTAGTGGCTCTGATAAAATACACCAATCTTGGTGATAGGTTTTCGGTTTTTCTGGA
AAAACTTGAGAATGGGTCAGTCAAAAAACGGCGAAGTGAGACAGCAGTTTTAAGTAAGAGAAAATTTGTAGCCCGGGCATTTCTTTGGCCTTCTACCATTTTGTTTTCCTTTGCTCCGAG
GGCTTTTCCACCCTTTGCCTCTCCTTTTGATTTTCCTCCGCTGTCAGGAGTTTTTCTTTCGGTGGCAGCCCAAAAGTATGCAATGCAAGTTTAGATGCCTCTTGTTCTTGCAGCGTCCTT
TTCGCTCAAGAGTGTGAGTGCCAGTGTGTGTGTGTGAGTGTGTGTGTGGGACGGAAGTGAATTTTCTGCACGTGGCTTAACTTTTGCTGCCTGCTCTGGCGTGTCATGCAGTCAGCAATC
TTTATCCAACCCAACCCAAGCCAAAACCAAGCAGCTGGAGTGGGCGCCTTTCATTCTTTTCTTGCGGATTTCGCTCAAGGATTGCATTTAACGCAGGAACAGGAAGGAAGGAAATGCCAT
GTCGACGCTAAAACTGGGTTAGCTTACATAACGACAACATTAACGACAACGTTTTCCTTCCGGTGGGCGGGGCTCCGGGGGTGGAAAATGGTTGGGATGGCGTTGGCTTCACGCTTCGTC
GCTTATTGGACATAATTACTGAATATAACATTTCTGCGGTGGCCCACCAAAATGGGTAGGAAGTCGCATGTGGCACTTGGAAAAATGCCCAGCAGGAACTTTGAGAAGTTTCCTATTGCA
TCACAAAACATCTAGCATTTTATTCGAGAATTCTTTCTTTATTGAAAATTCAAAAATTTTCATAGCTGCCAAATTATTTGTTAAAAATGCAAGTCTAAAGTATGCAGTGAATATTAAATT
TGACTTTTGCATTCAAAAAATGTGCTTGCACACTTCTAGAGCACCTTCTTGATACTCTTGAGATGCATCCTTGATTTCGCCTAGTGCATATCCTTTCGCCATAGCCACTTGTGCGTAACG
GCAGCGCCAGATAAGTGCAACAAAAGCCACGGCGGCGGATGCAGCCAAGCCAGGCCACATATCAATTCCATGTGAGCGGACTAACTGGTGGTCCTGGTGCAGTCCCAGTTCCGGAATGTC
CTGCTTGCCGGTGGTCAGTCGGAGTGGTTGGCGATGGGGATGGTGCTTTGGATCCCTTATCGCTTACACTTGGCCAAAGGCTAGTCACCCGCACACAGTTCACTAGTCGCACTGGTTTTT
TGTTCGCCTGCCAAATCCTTAAAGTATCGCAGCTTTGGCCCAAGGATTTGTCGAAGCAAACTTTTGTTCTTTGTCAGTTCGGGGAAACAATGTTAATTGCTTTGCAGTTTACTTTGCGCA
ATCCGGTTGACTGACTCAACTGTTGGACTTTTCGGTACAGGTGAAATCCGCTAAGCCGTAAACTGCGGCTCTCAAGTGCTTGGCTTAATTCGTCGAAAGTCCGCTGTTAGCTTTACTTGA
GATTTTGGAAGATTTTTAATTGCCACACTAAGGATTCCAATTACTCTGCAGCTTCCTTAGCCGATGTCATTGCACTTTGCCGTAGCAGGTGAAATTCATTAAGCCCTGATCTACAGCTGC
AAACTCTTCTTCCAAAATCTTTTGTTGTTCCATCTGGGCTAAACAAAGCGTTTTATGCATGCACACTCCGAGCCAATTACGCAAAGTGCTCTAAGTATCTCAAACAGTCCTAACTGGACA
CAATTACATTAACAGTTTAGCACACACGTAGCACGGAGATATCGGGGATTTGCGGGGGATAACGGGTTAGATATAGCCATCGCCAGAAGTGAGCGAAATTGGGGGTAGGCAAACAGGACG
AAAATTAAATCACAGCCCCAGCTGCAAAGGCTCGAAAATAAGTCCTGGCGAAAAGGAGCAGAGGCAATGAAACTACTACGAGTGCTGCCACTACGGTAACTAACTTTAACCCCGGGATCT
TGTAACCCGTAACGCCCATCTCCATTAACCCACACACACACTGGCAGGCGGACAAAGTGACTGGCTGACTGACAGCTGAACTTTTACGCACACAGATAAACAGTGTCAAGGGTTAACGGC
GATGGGAGGTCGGGCTGAGCGGGTGGCCTTTGTTTAATAATAATAAAATGTCACTGGGCAAAAATAAACGGTTGAGGAGCCGACTGGCTGAAGGATTACATTGCCAAGTGCTCCCCACAA
GCACACACACACGTACAGTCAGGAAGTCAGTCAGAGCAATTGTCATGAGTCCTTTGGACTATCGTCACTGGCAAATCACCTGGGCAACCCAATGGCAAACAGGATACTTGGCTGCGAGAA
TGTGAGTCCTGGCATGCAAGGATGCGACCGCCCCGCCCCGCCGGTGCAGGCACTTTTATTCCTTTGGTTGTTATTGCTGGCCATGTTGCTGCTGCTATTTCTGCTGCTGCCGGCGTGTTT
GTAAGCCATGTTATTACAATAATGTGCAATCCGAGTCTGAGATGCAGCACTGAGAGAAATATCTATGAGGAAAATGAATGGCCTGCAAGTGTATTCCTACCATTGTATACTTATAGACAC
CTCTTTAACAGCTTTGAGGCACCAGCAATGATTTATACATTTGCATTTGGGCTATCTCAACTATGAGGAACGAAACTATTTGCACCCGGATATGAGCAAATCCTTTAACATATGGCACTT
TTTTCCCTCTGCTGGCGAGTGCGGTCTCTGTGGTGGCTTGCTGTGGATGCGAGTGTGCGGCAGGCCAAAGTTAAATCATGTTTTTATTGTCACATTTGCCATAAAGGCAGCCGAGGGACC
GCCAGACCGTAAAAGGACTTATACTCGCACAGGCGGGGGAGGAGGAGCAAGAGGCGTCATAAGATGCTGCCTAAGCTGCAGGCGCACGTGGAATGGGTAGGCGGGCTGGTGGGCAGGTGG
GCAGGTGGGTAAGCCAGACAAATCATAATCAGAGCACAAGGCAACAAGCTCAACAAAGCCGGAATCACCTTAACAACCAGGTGGGCTGCTCTCATCCGGGGTGTTGGCTTGGGGGCGGTG
GTAGGTGCTGATGCCACTGATAAGGCAGCGCATAGGTGGCCCTTCCCTTCCTTTCTTTCACCTACGGTTATGGCCTTGTTTACGTTGCATACTTTATGGCGCAAAGCCGAGGCAAAGGAA
AGCGTGTGTGCAAGCGCGGAAAAAAGCGAAGCGTAAGCGTTAACTCTAATGAAAATGCAGTGAACTGGAAAATATACTGACTGCATGATAAAAACTAACTGACGCTGAAAGCTGGCAGAA
ACCAATTTCAGGGGGAGAAAATGAAACCCTTAATTCATTTAGAACAGCCACAAAGGACCAAAGGCTTTGGAATCAGCAATCAAACGATTTCGAAACAGAAATTAGAGAGGCTAATGAAAA
TATGATATTTACTAAACTGCATTTAATTGTGTTTCTTTATGATGTCTGCCATGATTTTCACTTAGTGCAATTGCCAAATTCCAGTTGAGTGAAATTTCGCTGTAATAGGGCGCTCGGATT
AGCCCAAAAACCGCAATCGAGGCAAAATAATCAAACTGAAATCTCAAAGCGGACACCACAAACATACACTTGTCGAAATTGCGTGGTCCCCTTGGCATTTCGCTCGTACCCCCAGGAAAT
CCCCACTAATTTACTTGCTGCGGTTTTTCCTTCACTAATTGTGACAACTAATTGAAATCAAATTAGTGAAGCCACTAAACAGCTTAATGCTCGCTGAGCACGAACCAGATTTTCCACCTC
GGCGATGGGGAAATTCGGTGGGCGGGAAGGGTGGTGAGCGGTTGTCCAGTGGGTTAACCATAAACCCTACACAATGCTAATTGTTTTCATTCAATTTACTGTCTGCACGCCGCTTTAAAA
TATCGCTCTTGGCTTCAGTTTTGGCTAACCATAAATTTTCGTCATGGACATCAAAGCGTATACGCAATATGGGTGCGCCAATGCGCGTGTGTGTGCGTATGGCATGTCCTGCTAGCAAGA
ATGTGTGTGTGCTGTAGTGTGGGTGTGCAGGCATGCGTGAATAGACAAACATGCCTTTGTCAATAATATGCATTAATTAAGTGCAGACATGGATGCGAGAGGAATCAAACCAAGGATATC
CGAGGTGCATCAATGGATACCCAATCCCGCGCCACACGACACACGGACGTACGGACATACGTATAAGCGGACACACAGCCATACGGACACACGGACACGCAGGACTCACCATCAACACTG
CGCATTGCAAATTTAATTGAAAATATCGAATAATGCGAAAATGCAAATGTCATTATCAAAATTCAGGCCGGCGGAAGTGTCACAAGCGCTGAAAAGAAGTTTCAAGATTCAATTTCCGTT
TCCGCACACATGACGTGCATCGCAGCAGGTGGGCATTAGGGCGTGGCTGGAGGGGGCGTGGCAAAGTGGCGGTACGGGCACAACGCCCCACAGCATCCCAGTTATTTATGTCTCCGTTAG
GGTCCTTTTTTAGCAGCTCCGTAAATAGTTGCGCAACTGACACGACGCCATCCACGTCTATGAGGCCATTGCATTGGCGCCCCGCTGAATCCCCATTTAACCAGAGAGCAACTCCAGCAC
GCACTTGGTCAGGAGTGGGTTCATAATCACTGGGAAAAATCGTGGCTCACATTTGAGTGCAACTTATTTCAAGGAGAATTCACGTTTAGGATGATTCTTTGCTTTAAAGCCGAGGGAAGA
TTGCATACCTACTCCCATTTTTTCCCAGTGCAGCACATTTGGGTAGGCTCGATGAGGCATTGGTCTGGGAATTCCGGCTGTCCGGAGTCCCAGTCCGAAGTCCGGAACCCGGACACGCAC
TGAGCGTGTGTGCACATTGAAGTGGACCATCGTTTGTCACTCGAGGTGGGTGTGGAAGTGGGTGCGGCAGGGGCATTAAAAGAAGAGTAGGAGGAGGACACGGGCACAGTGGTGCAAAGT
GGAGAGGAGTTGGCTATGCAGAAAGAGACTCGCCAAGTGGCTGGGAATTTTAAAGTACTCTCCGGCTGAGCAAATACGATAGCGGTGTGCGAGTCAAAGGGCAAAGAAGGCCAGTTCCTT
GTGGATTCAAATTAGACCGATCCATCTGGCGGCACCACTCGGCTTGACCCACTGTGGTCTGAATCTCAATCCGAATGTGAGTGTGGATGTGGCTGTGGTTGTGGTGCAGCCTCTGGATGT
GGTGGTATTCCTTGTTGACTGTTGGTGGCGGGGCTAATGGAGTTTGCAAGAAGTGGGCAAAAATGTGGATCAAGCAGCCGCACATGCACAAAGACCCCCACCAATCTCCGTTCCGCATTC
TCCGGCGCTCCTTCCTTGCGGGAGAAATGCGAGCAACTTTGCAAATTGTTGCCGCCACCCGAATCCCAGCCTGCGTATCGCTGGCCCACTTCCTTGGACCCACGGCAGCTGCATGAGGTT
GCCAAGTTGGTCCACCAGGAAAAATATTTACCACAACTTTGAAGGCACTACAAAAATTCAGAGGATTACATTTCAATTAACTGAAGTGCAGCTTGGCTATGAAAAACTAGTTCCAGACTT
AAGCTTATTAACAACGAAAAACAAATAAAAATATATTTTTTGAAGAAGACTTTCAAATATTCCTTCATAATAAAGTTTGTTCTAATAGTCTTTATTGCACGAACAACTTTTAAACAATCT
ATAATAAAGTAGGGCAGAAGTTCTGACTGTAAAGTTGTAAATTTTTTTTCGAGTGCAGCTCTATAAGCGGGGTTACCACATGGACACCAGTGGGTCGACCGGCCTCGGGCCGTGGCTCTT
TCATCAGCCAGAACCATAGTCGTAGCCATAGCCATAGCCGGAGCATAAGAGCCGGAGCCAAGACCGAAACCGAAACCCGGAGTGGAAAGTGAAGGAGGAGGGTGCTGCTTTGTTTATGTG
GCTCCATTTGGGCATATGCATGACCCACTCAACCACCCATCAGAGGCACCCGCCACCGTCCTGTGGTTGCTGCTATTGTTGGGCGGGGGCCTCAAGCTCCACGTGTGAGTGGTTTTAGTG
TTGTTCTGGATTCCTGTACCTCTTACTTGCAGGGCGGAAGGGTATATTCAGTTTATGGAAGTGCAGAAATTGAGGACTAATTAGTGATCTGCAGATAACACTCTTTCTAAAACAAAAGGC
TTAAAACTTAGATTAAATTACAAATTTAATATCTGCTGTCCAAATATGCAATTTAATATATGAAATAAAAATATTTCAAATTAATACCAAACATTCCCTGCATACCTAAAAGGTGTGTCA
CCTGGTCGGGACTACAGGGTATCGCTTAGTCGCACCCCTTGACTTAAGCGCTCTATCTTGTTCTGGATTTTTAAGTTGTTTTCGTTGTCGTAGCTTGTTTGTGTTGCCTTTTTTGTTGTC
CTGTGTGCGAGGTTTTGCCTTTTTCCTATGTGTTGCATCCTCGTCTTTAGTTGCAATTTGAGCACAGACACAGAAACAGCCAGGATTGCACTTGGCCAACACACACGCACGCACACTCAC
ACACTCGCAGTGAAATGCTGACACCAATTAGGGCTGCAGGTTGTTGTTGGTGTTGCGCTGCTGCCGTTAGTTGCTGTTGGTAGTTAGTTAGTTCGGTTGCACTTTGTGCGTTGCATGTTT
ACAGTGGCCACAAAACATAATTTCTGTTTAGACAACTTTAGCCCCAGCTCCAATTGCAGTGGCTTCTGGCCAAAAGCTTTGCGAAGAGTGGTGGAAAAATACAAAACAGAAAAGGGTTAA
ACAAAACAGGGTCATAATTATTGCGCCAACAAAGACAGCAAGGCAGCTGCAACATCGGCTAGCGGTAAACGATGTTGCCAGCAGGCAGAGGAAGAGGCAGAGGCACCATCACCAGCTGAA
TTTTCGGTATAATTTTCACTTTGGCCAAGAAACTTTTTCGCTGCCGCATTGAATTTGCAACCAGCGAGCGGCTAAAACCCGACCAAAAGCAACAGCAACAAAGTTCATGAGTTGATTAGA
AAGTTTTTTAACCGCTGTTGCAGCTACATCCTTAACCCGCTGCAATCCTATAGCCATGCCCCCAGCGTATCCTGCACTAGAATAAATATTATGTTATCTGCTTAAGCTTACACATAAATA
CGTTATTAAATATTCAGTATATATATGGAAGTTTAAATATAGCATTAATAAATCAGCAACTTTATTTTATAGACATTTTTGGAAAGCCCTATCAAACTGGCACTACAAAGTGATAGTGGC
GTTCTATGATGATTTTGCAGTTCCAATCATTTTCTTGTAGAATTTCTTTGAGTGAACTGTTGCTAATGGCAGCTCGTGAGCTTGGCATATACGAAAAGACCTCAATCCGCGGCTTAGGTT
CCCAACTCCGCACTGCATGCCACATGCCGTATGGCGTATGCCACATGGGTAGTACGAGTTGGTTGCCGGGGTTGCTGGCTTATCGCTTGGCTGCTTTGTCGCCGGGCAGGGGCATAAACT
ATGCGAGCATCAACTTTTTGTAATTAATTTTTAATGTGTGCAAAATGTTTGAGTAAACGAGCATGTTGTTGTTTGCCGAGCACCGCCATATCAAGCGGATGTCGTTAGAACGGTTTATCA
AGCGCTCTAAGAGGCGGATAAACTGCGGCTTCGGCGAGGGGATCTACTCCACACTATATACTATATACTATTTAAGTTTGTGCTTAGCCGGGGTAAATAATTGGATTGCGCTTAAAAGTG
GCGGCTGCTGGAAGCCAAGACTGCCAGGCTTCTGGTTATTCAAACGGAATTTCTTTGCACTAATTGCATATGACAAAGCTGCAAAACATCCATACATCCCCACCTGACGCTCCAAAAAAC
CACCTAACACCCATTGAACACCCTCCTAGTGTGCGAGAGAGAGAGGAAAGAAGGAGCAACGCAGACCGCATGACGAGAATTGGCAACTTGCTGCAATTTGCCAGAACCAAAAATTGATTT
ACCCTCAAATGCAAGTCTTCCCGCTTTCACACAGCTTTCAAGGCACTTGAAAAAATGTCGTGTTGCTACTAAAAGCCGATGTACGATGGCAATCTGCATCTCAAACTTCAGTATTTATCA
GAATTTGCAGCACTGGCAAGCATGCGTACTTTGCAGAGTTGGCATCATTGACAGTCTTGCAGTGTTTTCATTTCAGATAAAACTATGTAGGATAACTAGGCAATATTTAAGAAAATTTAA
ATATAATACGTTAGATTTGTTCAAATGTTGGCAGGCAACTATGTGGTTATTGGAATTTTAGAGTCTGAATAATTGGCATCTTTGACAGTCGTTTAAATTTGACATCACGCAGTGAAATAC
TAAATTGCATAGGTAGTTTTTTCCCAGTGTGGTAAGCCCAACTCCCCTTTCGTTATTCACCCGACTCGCATCCATCCATCAGATAAACGTTTTGCTATCTGCAATCTGGGAATCGCATTC
TGTCCCTTTGTCCACGCTATCCGCATCCACTCACGCTATGTTCGTTGTTCTTGTTTTTCCGGCAACATTTTTGCAGAGATTTGCGTTTCAATCACATCGAGGAGCTGCCGGCCAACGCGT
TCAGTGGTCTCGCCCAGCTGACTACGCTTTTCCTGAACGACAACGAGCTGGCTTACCTGCAGGATGGAGCTCTCAATGGACTGACGGCGCTGAGGTTCGTCTATCTGAACAATAATCGGC
TAAGCCGCTTACCGGCGACCATCTTCCAGCGGATGCCGCGCCTGGAGGCGAT
GTAAGTGAACCCTCCTTAATTAAGGATCCCCTCGAGCAATCGCCTTACTTAACATCCTCCTCCTGCGC
CTTCTGCAGTTTCCTGGAAAACAATGACATTTGGCAGCTGCCCGCCGGGCTCTTTGACAACTTGCCGCGTCTGAACCGCCTGTAAGTCGATGATGGTTCGATTCCCCTTCTTTTTGGGTG
GCCTTCCACTACATTTCTGCATTGTCTTCCCCTGCGTCCAGGATCATGTACAACAACAAGCTGACCCAACTGCCAGTGGACGGATTTAATCGGCTGAACAACCTGAGGCGCCTGCGACTG
GACGGCAACGCCATCGATTGCAATTGTGGCGTCTACTCGCTCTGGCGTCGCTGGCACCTGGATGTCCAGCGCCAGTTGGTGTCCATCTCGCTCACCTGTGCCGCTCCCCAGCTACTACAA
AACCAGGGCTTTTCCAGCCTGGGCGAGCATCACTTCCAATGCG
GTAAATTGAAATTTCCATTTAAGTAACACATAGAGCATGAACCAAGTTTATGTTTAAGTACACTTTCCATCACATTG
AAAGCACGATTTCTGATGTGCGGCACAGATCCATTTTAATACCGAATTGATGGCCTGGTTAAAATTACTTGCAGCCAAGCCGCAGTTCCTGGTGGCACCCCAAGACGCCCAAGTCGCTGC
CGGGGAGCAGATGGAGCTGAGCTGCGAGGTCACCGGCCTGCCCCGCCCCCAGATCACGTGGATGCACAACACGCAGGAGGTGGGCCTGGAGGAGCAGGCACAGGCGGAGATCCTGCCCAG
CGGCAGTCTGCTCATCCGCAGTGCGGACACCAGCGACATGGGCATCTACCAGTGCATCGCTCGCAACGAGATGGGCGAGCTGCGTTCCCAGCCCGTTCGCCTGGTAGTTAATGGCGGTAA
CCACCCACTCGATTCGCCCATCGACGCCCGCAGCAATCAGGTGTGGGCGGATGCCGGAACACCCACACACGGAGCAACGCCAGTGCCATCGCCATCGCCATCGCCACCGCACTTTACCCA
CCAGCCGCACGACCAAATTGTGGCCCTTCACGGCTCTGGACACGTGCTGCTCGATTGCGCCGCCTCCGGCTGGCCACAGCCGGACATACAATGGTTCGTCAATGGCCGCCAACTCCTGCA
GTCGACCCCCAGCCTCCAACTGCAGGCCAATGGCAGCCTCATCCTGCTGCAGCCCACCCAGCTCTCTGCCGGCACGTATCGCTGCGAGGCTCGCAATTCTTTGGGCAGCGTCCAGGCCAC
CGCCCGCATCGAGCTGAAGG
GTGAGTAAATGCCAGTGATGCTCAATGTTGAGTGGGAATTTATTCCACTCCCCAGGTACATATGTAAAACCGCCAATAAAAGTATCTAAAGGTATGGATA
TATATATAAAGGCTGGATATATTATTATAATCACATCAAAAGAACATTATACTTTAAGATATCTTTTTGAATTATGTCTCTGGTAAAAAGTTCCTTTTACATCTACCAAGTTTTGCACCC
AAGTACTGCCCATCTCTGGTGCAGTCCTGGTGCAGTACCCACATAGAGTCCCCTTTCTGGCCACACTCCATCGCCCTGTGACAGCCACACAGTTGCACCCGGAATACGAGTTACAACTGT
CGCGCTTTACTCAATTTGCAGTCGATTTAATTTGTTTTCGTCTGGGAAAAGGGCGAATGGGGAGTGACATGGACGCTGACCAGGATGCTGGCCAGGGCAACTCAACTGATATCGGGGCAT
TGGGACTTTGCGGATGAGTTTGGCCGGCGGGAGAAGGAGCCGACTGCCCGTTAGAAATATTGCGACAACTTTGACAGCAGGTGGTGCCGGTGATTGGATGCAACTTCATGTAGACAAATC
AAATCACAAAAGTTTGTGTTTTTGCACTCGGCAAATTTGGCAATTTGTTCAAGCAAAAAAAAGTTAGGTGTGCGTTTTTTATGTAGAAAAGTTCTCAGCAATATTTCCAATAATTAACGA
TTTATAGTCAAAAGCAAAAAATATATTTTTTAAAATTGTGCGGAAAATAAATCAAAAAGAGATTCTATAAATTAGGTCTACAACATATTCCGCCTTATTTATTATAGGTTGCAGTGGATT
TAATCCGCTTAGGTTTTTTTTTTCAGTGCACTTACTTTATGCGGTAGTAAGTAAATGGCTCTGGGTTTGATTGGAGCACATTAAGCACTCCCGCCTCGTAGCTTCTTGCCCATTAAATAA
CCGATGAAGTGCATCCCGGCAGGAGGTTAACCCCGAAACAACTTGGCACTTGAGCTTTTTATGTTTTTCCATTCGTTATTGCCGTATTTCGAGCGTTTGTACGTGACTGTACTTTATTGC
GCAATAGAAGCGGCCAACGGGGAGTGAAATTTATAAATATATCCTCTGGGGCATGGGTATCACAGACGGCGAAAAGTGCAACCACCGCCTTGATGCAGCACAATGGCTCATTATAATTTG
TGGTTGTCGGCACAAAATGAAGTGCGAAATTTATGCATTATTTGGCTGAATTAAGTGCAAAAATTATAAACTATTATGTGCGGCGAGGGCACGCACAAATTGTGCGCTGTGGCTTTAAAA
AAGCGAGGGAACGGGAAGTGGGGAGCGGCGAAAAGGGAACTGGGGCTTAGGGGGATCACGGGGACCACGGGGCGGATGAACTGTTTAAGCAGTCAGGCGTGGCGCCTGGTCAGCATAATT
AACCCGCCAAACGCATAAACAGACACGGGCAAACACTCCAACAAACACAAATATACGTACACAAGTAAATATGGCGGCCACGCTGAAAAGTATGCAGGGAGAATTCATATTTAATATTAC
GCATACGCCCCCTGGACATCGAGCAACGCACAGTGGTGCAAATTGTGCAAATTGCGCATATTACGATATGTTTTAAATGTGGTTTAAGTATTGATTAAAAATATAGCGTGTTTTTTCTTT
TAAAAATATAAATATTTGGCTTTGTATGTCAGATTTTAAACATGACTTACCACGGCACAGCGCTTAAAGCGGGTCAAAAGGCGAGCGTTTCTGTGTTGGTGGTGCTGCGGCAACAAAAGA
CTCATAGAAAGCGAACCAAAAAGCCAGGCCTCGCTTTAGTCGCTTGTTGCTGCCATTTGGAGCAGTAAAATTGCTCGAAAATCACTCATTCGCCCCGTTGCACCGCTTGCCACTCTTGCA
GAGCTGCCCGAAATTTTAACTGCACCGCAAAGCCAAACAATCAAACTGGGCAAGGCCTTTGTGCTGGAGTGTGATGCCGATGGCAACCCGCTGCCCACCATCGACTGGGAGTTAAATGGA
GTCCCCCTGCCCGGAAATACGCCCGACTTGCAGCTGGAGAACGAGAACACCGAGCTGGTGGTGGGCGCTGCCCGGCAGGAGCATGCCG
GTAAGTAGGAGAAGTGATTGCCAAAACGGTTT
ACATTGCATTCCATTCGATACCTTGGACATAATCCCGTGAATCCTGTCCAATCTGCTCCCCCATCCCCTCATTCGCAGGTGTCTATCGCTGCACGGCGCACAACGAGAACGGGGAGACGA
GCGTGGAGGCCACCATCAAGGTGGAACGGTCGCAGTCGCCGCCGCAACTCGCCATCGAGCCGAGCAATTTGGTGGCCATTACGGGCACCACCATCGAGCTGCCATGCCAGGCCGACCAGC
CGGAGGACAGACTGCG
GTAAACTCACTTACCGGGATTGGCCACAGAATCGGAAACTTTTTATTTACCCGCCACTTGTTGACGTTCCCTTTTGGCCTCATTTTCCGCTTGGCCACCGGAAA
AAGTGTGCCCAAAAACTGCATTCATTTGAAAGTATATTTTTATGAAAGTTAAAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAAAGTTATATTTTTATGAAAGTTAAAGTTCTTTCATAGGTGGCTCAAAGATTCCTCTATTTGAAACCCCGCTTACAAAGTGACCAATTTT
TAAATGGAATATAAAAGATATATAAATTATTTTTTTCACTGCAACTCCTCAGATTTCGTGGCGCCACGATGGCCGACTCATTGATCCGAATGTGCAGCTGACGGAGAAATATCAAATAAG
CGGCGCCGGCAGTCTGTTCGTCAAGAATGTGACCATCCCGGATGGCGGACGGTACGAGTGTCAGGTGAAGAACCAGTATGGCCGGGCTTCCGCCTCCGCACTGGTAACCATCAG
GTGAGC
GAACGGAGGATTCCGAATCAAAATCAAAATCAAATAGCTCAACTTGGGCGCCGACCGCAACTTTAATTGCGCTGTCGGCGGCGTGAAGGGCGGATTGCATAAAACTCCATTAAAATCAAA
GGGAAAACTTTTGCTCAAAGGCGAAAGAACGGTGGAAACTGGCAAGAAAAGGCCTCTGCCCACAGAGGACGCACTTAAAATGCGTTTAAGTGCGCAGTAAAGTTGCTTAATTAATTGAAA
AACAGTTGAGCCGCAGAAAAACTGAACATTAAGTCGGAAAAAAGTTGGCGTATATTTTGACATTTTTATGAAGAAAGCTTGGTGAAGTCACTTTAAAAACCTGGAGGGTGCCTTACTTCA
TTATGAATTTCAAATCAAATAAAAATGCAGACTTGAACTCTGTACGCGTAAAATGATTTTCACTGAACTAAATTGCTGGGAAACCACTGCCGCAAACGATGAAAAGAACATAAGACCGTA
AAATAAAGCTGCTGGCTAAGCTGCAGCACAGTGGCCAGAAAACGGGTAAAAACTGCGGGAAAATCTAGGGGATAAACATCAAACTCCGACTGGCTGTTATCAAAAGCAGTTAGCAGCTGG
GCAAACTTGCTAATCCTCTCCAGTTGCCAAGGCACTGGGATCCACTGTGTTGTCAGCTAAACTGCAAATAAAATATGCACCCAGGCTCCAACTGCAACATGAACATCAAAAGGCGGCGAA
GGAAAGCACAAAAGTTGTCGTCGCCCTCGTCAGTTGCCAGTTGCCAGTTACCAGTTTTCAGTTACCAGCTTTCTGTTGCCAGTTGCCAAACTGAAAAACGTGCTAAGCCCGGAAAAGCTA
CGTGCCACACTCACACTTACATGCCTTCTGATTCGGGGGTGGGGGGAGGGGAGGGGGAAAATGGCAAAAGACACAGGCAGTGGAAATTCCTCGCTGAGGCAACCGCACAAGTTATCCAAA
TTGCCCAAATTGAAATTGAGTTGACAAGTTGCTGGCTGCGACAAGAAAAATAAGTGCTGCACACCAAATAAAATGTATCTTTTCTTTGGAAAGGAATTTAAGGCGGAAGAATAACCATAA
GAATTAATATAGATTATTAAATACTAAATTACTTATACATTGAACAGGTTATCTGAATTTTAAGCTCAGCTTCTTATTATAGAAATTTCACATGAATTTCACTTATTTTTCTTGAGGTGC
ACAAAGACTAGAACTAGTGCCCATCTTGTACCTCAACTTTTACACTCCTTTTGCGGCCTTAGAAGTTTTCGAATTGTTTGTCCCGAAAAAAGCGACACGACGTGAATTTATTGAGCAAAT
GGTCTCTGCATCCATCCGCCACAAGCCGTAAATCAATTTGAGGCTGCAAAAAAGGGAGCCGTGGATGCGGACTTGGCCATTAACCACCGACTGGCGAGCTGGAGACCAATGATGGGCCAC
AAAAGAACCGCCGGAGCGGCTTACTTTCTGCTTACACAGCCATTTTGCCGATGCATAATGCAGCAGAAAAGCGGGTGGATAATGGTGCCAGTCGGTGGATTTCCATGTGTGGCTCCCACG
GAGCATTTAGTGCCCAGGGAGGACGGGGTCGAGGCAACGACGGGACGGAAGCTGAATCGGCTTACAGTTCTGTGCCGGCAGCATTAGAAACTTTACTCATTACGCCGGGAAAACCCAGTC
GCCAGACCGCAGCAAAGCAGCGGGGGCGGAAAATTATAAAGAAAAATCCAGAAAAAGGGTGCGAGAAAGCCGGGCGCCGCCAAAAGTGAAAAACTATGTTGGAAGAACGCAGGAGTCGCT
GGCATCCAGGAGCAGATATCCTGGCCCATAATGGGTGTGAGTGAAAACCGCTGAAAGACCTCGACGAAACCAGTGCAACAAAAATGGGAAAAATAACAAAAATACCAAAACACCCAGAAA
TCCGCCTAAGTTGTGGGTAATGCTGGGCGTAAAACAAAAGCTTATCCTGTTACTGCCACTTTTGTTGTTGCCACCGCTCCTGTGATCCTGCTGCTGGCAAAAAGGCTAACCACGGAAATA
CATTGCCGTGCGCCACAGCATGTGGCAAGTGGGGAGTGAGCGAGACGGCAGCCAGGACCAAACGGAGAAACTTTACACCGAATTGGGCACCCGACAGTGCTGACTACAGGATACCCTTAC
TAAAGGTCTAAAAATAAATTAATTTTAAAGAGAATATTTAAATTTAAAGAGTATAGTTAATTTTACTTAATTTACTTTTTTAACTTGAAAGTATTAATGTTTTAAAGTTACCAACTTAAT
TATAAACTTAAAACAATTGAATAATATTAAAGGATATACCAACATGAATCCTGCGTTATAAGCTATTTTGGTAGTCTCCTTGTTAGTTTTCCCTTCTTCACTGAACTTTGTAAAAACAAT
TAATTTTTATTAAATTTAATTGGTTAAACTATTAGCGCAAAGAATAAGAAGCATGTAAAATGAATAGCATTTGCCAGAGATAATGTTTATAATTCCGTTGAGGTACTTATACACTGCGAA
CTCTTTTACTATGGCTTTCCCACTTTTAAATACACTTTAAGTCACCAGAAAATATGCCTTATATGCTGAAATAGTAGACCGAGTGATGCACAAACTTTAGCCAAAAACTATCAATGTCCA
AAAATACCGTGGGCAATTGTCGGCTATAGAACAACGGACAACCCGCCGAGTCGCCCCAGGAAAAGGACATCGCAAGAGGGCAGCCGCAGAATGGCAGCGTGGAAATATGTAGTCCTTGGC
GCCGCAATATCCACTGGCACTGGAGCAGGAGCAGCAAGACCCGCAGCACTGGCAACTGGCAACCGATAGTGGCAGACTCTGGTGCAACAGGGTGTATTATGGTCGTTAAGTTATTACCTA
CAGCAGCGCCTCCGCCGCACAATGCCAAAGTTTACACAGTCGAAAGTTTCCTAGAGGAGCATTCCTTGCCAGCAGAATGCCGGGCATGAATTGTTGTTAATGCTGCCCTCCATGCTGCTC
CTCCATTCAGAGTCAAGGCAAGGCGATAGGCAAGGCGCGGATTTTTCCGACGATTTTTTCCGCTGCACAGAGAATGCAGCATAATTTGGTTGGGAAGACAGGCGCAGAAAGGGGAAATGG
ACTGGCTGGCATTTTTATTAGACAGCGCGGCCATTTGGGCGACTCCTGCCACTGGCATTATGGTAATTAAAATGTGCAAATGCCCTGGGATATCTTGATTGTTTGCGCGCTTTGTGTTCT
TTATGTGCGTGTCAACTCTAGGCCTCCAGGCATTTAATAAAGATTAATAACAATTTAAGCCGAAAACTTGGGAGGTAATGTACTTTATAGTGCACAAACCCAGGCTTGGGGTCACCAAAT
GCTATGGTTTGGATCACCAATTCTCTTTTATCAATCAAACTATCAGCTTATGTTAACTAATCTTTTGTTTTATACCCCACTTAGAAACAACGTGGATTTGGCTCCAGGCGATCGGTATGT
GCGCATCGCGTTTGCCGAGGCAGCCAGGGAGATTGACCTGGCCATCAACAACACCCTGGACATGCTCTTCTCCAACCGATCCGACAAGGCGCCGCCCAACTATGGCGAACTACTGCGGGT
CTTCCGCTTTCCCACTGGCGAAGCTAGGCAGTTGGCCCGTGCGGCGGAGATCTACGAGAGGACTCTGGTCAATATCCGGAAACACGTCCAGGAGGGCGACAACCTGACCATGAAGAGCGA
GGAGTACGAGTTCCGGGATCTGCTGTCGCGAGAGCACTTGCATCTGGTGGCGGAGCTATCGGGCTGCATGGAGCACCGTGAAATGCCCAACTGCACGGACATGTGCTTCCACTCGAGGTA
CAGGAGTATCGATGGCACGTGCAACAACCTGCAGCATCCCACTTGGGGAGCTTCACTCACCGCCTTCCGGAGATTGGCGCCACCGATTTACGAGAACGGATTCAGCATGCCCGTGGGCTG
GACCAAGGGCATGTTGTACTCGGGTCATGCCAAGCCCAGTGCAAGATTGGTATCCACCTCGCTAGTAGCCACCAAGGAGATCACACCGGATGCCAGGATAACGCACATGGTGATGCAGTG
GGGTCAGTTCCTGGACCACGATCTGGATCATGCCATTCCTTCCGTGAGTTCGGAGAGCTGGGATGGAATCGATTGCAAAAAGAGCTGCGAGATGGCTCCACCCTGCTATCCCATTGAAGT
GCCTCCGAATGATCCTCGTGTCCGCAACCGCCGATGCATCGATGTGGTGCGATCCAGCGCCATTTGTGGATCCGGCATGACGTCCCTCTTCTTCGACAGTGTGCAGCATCGCGAGCAGAT
CAACCAACTGACCTCCTACATAGATGCATCGCAAGTGTATGGCTACAGTACTGCATTCGCCCAGGAGCTGCGCAATCTGACATCCCAGGATGGATTACTCCGAGTGGGTGTCCACTTCCC
GCGGCAGAAGGACATGCTGCCCTTTGCTGCTCCCCAGGATGGGATGGATTGCCGCAGGAATCTCGATGAGAACACCATGAGCTGCTTTGTTTCGGGCGACATTCGTGTGAACGAGCAGGT
CGGTCTTCTGGCCATGCACACCATTTGGATGAGGGAGCACAACAGGATAGCCAGCAAGCTGAAGCAGATCAATTCCCATTGGGATGGGGACACCTTGTACCAGGAGGCTCGCAAGATAGT
GGGTGCCCAGATGCAGCACATCACCTTCAAGCAGTGGCTGCCACTGATTATTGGCGAAAGTGGAATGAAGATGATGGGCGAGTACCAGGGCTACAATCCCCAACTGAATCCCAGCATAGC
CAACGAGTTTGCCACGGCAGCCCTGCGATTCGGACACACCATCATAAACCCCATTCTCCACCGCTTGAACGAGACCTTCCAGCCGATACCCCAGGGCCATCTACTGCTCCACAAGGCCTT
CTTTGCTCCCTGGCGTCTGGCCTACGAGGGTGGAGTGGATCCCCTTATGAGAGGCTTCCTGGCCGTGCCCGCCAAGCTGAAGACCCCCGATCAGAACCTCAACACTGAGCTCACAGAGAA
ACTGTTCCTGACAGCCCATGCTGTAGCATTGGATCTGGCTGCCATTAACATCCAGAGGGGCAGGGATCACGGAATGCCCGGCTATAATGTCTACAGGAAGCTATGCAATCTCACGGTGGC
GCAGGACTTTGATGATCTGGCCGGCGAGATCAGTAGTGCCGAGATACGCCAGAAGATGAAGGAACTGTATGGACATCCGGATAACGTGGATGTTTGGTTGGGTGGCATCCTAGAGGATCA
GGTGGAGGGCGGCAAAGTGGGTCCTCTCTTCCAGTGCTTGCTGGTTGAACAGTTCCGTAGACTTCGTGATGGCGATCGCTTGTACTACGAGAACCCCGGTGTCTTCTCACCCGAACAACT
GACCCAAATCAAGCAGGCTAACTTTGGTCGAGTGCTCTGCGATGTGGGTGACAACTTCGACCAGGTCACCGAGAACGTGTTCATTTTGGCCAAGCACCAGGGTGGCTACAAGAAGTGCGA
GGATATAGTAGGCATTAATCTGTATCTGTGGCAGGAGTGCGGCAGGTGCAACAGTCCACCCGCCATCTTCGATTCGTACATACCGCAAACCTACACCAAGCGGAGCAACAGGCAGAAGCG
AGATCTCGGCCAGGAAAACGATGACGTGGCCACCGCCGATAGCTATGACAGTCCACTGGAATCCCTCTACGATGTGAACGAAGAAAGGGTCAGTGGTCTGGAGGAACTGATTGGCAGCTT
CCAGAAGGATCTGAAAAAGCTGCACAAGAAGCTGCGCAAGGTGGAGGAATCCTGCAACTCCGCCGACTCCGAGCCGGTGGCTCAGGTGGTGCAGTTGGCGGCGGCACCGCCCCAGGTGGT
TTCCAAGCCCAAGCGGAGCCACTGCGTCGACGACAAGGGCACCACCCGGCTGAACAACGAGGTCTGGTCACCGGACGTCTGCACCAAGTGCAACTGCTTCCACGGCCAGGTCAACTGCCT
GAGGGAGCGGTGCGGCGAGGTCAGCTGTCCGCCGGGCGTGGATCCACTGACGCCTCCGGAGGCCTGCTGCCCACACTGCCCGATGGTCAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGTTCCGCTGCTCCCGCTGCAGCTGCTCGGCCTGCTGCTCCTCCTCGCCGGCGGAGTGCAGTCCGTCTACTGTCCGGCCGGATGCACCTGCCTGGAGCGAACTGTGCGCTGCATT
CGCGCCAAGCTGTCCGCCGTGCCCAAACTGCCCCAGGATAAACAAACGCT
AGATTTGCGTTTCAATCACATCGAGGAGCTGCCGGCCAACGCGTTCAGTGGTCTCGCCCAGCTGACTACG
CTTTTCCTGAACGACAACGAGCTGGCTTACCTGCAGGATGGAGCTCTCAATGGACTGACGGCGCTGAGGTTCGTCTATCTGAACAATAATCGGCTAAGCCGCTTACCGGCGACCATCTTC
CAGCGGATGCCGCGCCTGGAGGCGAT
TTTCCTGGAAAACAATGACATTTGGCAGCTGCCCGCCGGGCTCTTTGACAACTTGCCGCGTCTGAACCGCCTGATCATGTACAACAACAAGCTG
ACCCAACTGCCAGTGGACGGATTTAATCGGCTGAACAACCTGAGGCGCCTGCGACTGGACGGCAACGCCATCGATTGCAATTGTGGCGTCTACTCGCTCTGGCGTCGCTGGCACCTGGAT
GTCCAGCGCCAGTTGGTGTCCATCTCGCTCACCTGTGCCGCTCCCCAGCTACTACAAAACCAGGGCTTTTCCAGCCTGGGCGAGCATCACTTCCAATGCG
CCAAGCCGCAGTTCCTGGTG
GCACCCCAAGACGCCCAAGTCGCTGCCGGGGAGCAGATGGAGCTGAGCTGCGAGGTCACCGGCCTGCCCCGCCCCCAGATCACGTGGATGCACAACACGCAGGAGGTGGGCCTGGAGGAG
CAGGCACAGGCGGAGATCCTGCCCAGCGGCAGTCTGCTCATCCGCAGTGCGGACACCAGCGACATGGGCATCTACCAGTGCATCGCTCGCAACGAGATGGGCGAGCTGCGTTCCCAGCCC
GTTCGCCTGGTAGTTAATGGCGGTAACCACCCACTCGATTCGCCCATCGACGCCCGCAGCAATCAGGTGTGGGCGGATGCCGGAACACCCACACACGGAGCAACGCCAGTGCCATCGCCA
TCGCCATCGCCACCGCACTTTACCCACCAGCCGCACGACCAAATTGTGGCCCTTCACGGCTCTGGACACGTGCTGCTCGATTGCGCCGCCTCCGGCTGGCCACAGCCGGACATACAATGG
TTCGTCAATGGCCGCCAACTCCTGCAGTCGACCCCCAGCCTCCAACTGCAGGCCAATGGCAGCCTCATCCTGCTGCAGCCCACCCAGCTCTCTGCCGGCACGTATCGCTGCGAGGCTCGC
AATTCTTTGGGCAGCGTCCAGGCCACCGCCCGCATCGAGCTGAAGG
AGCTGCCCGAAATTTTAACTGCACCGCAAAGCCAAACAATCAAACTGGGCAAGGCCTTTGTGCTGGAGTGTGAT
GCCGATGGCAACCCGCTGCCCACCATCGACTGGGAGTTAAATGGAGTCCCCCTGCCCGGAAATACGCCCGACTTGCAGCTGGAGAACGAGAACACCGAGCTGGTGGTGGGCGCTGCCCGG
CAGGAGCATGCCG
GTGTCTATCGCTGCACGGCGCACAACGAGAACGGGGAGACGAGCGTGGAGGCCACCATCAAGGTGGAACGGTCGCAGTCGCCGCCGCAACTCGCCATCGAGCCGAGC
AATTTGGTGGCCATTACGGGCACCACCATCGAGCTGCCATGCCAGGCCGACCAGCCGGAGGACAGACTGCG
TCAGATTTCGTGGCGCCACGATGGCCGACTCATTGATCCGAATGTGCAG
CTGACGGAGAAATATCAAATAAGCGGCGCCGGCAGTCTGTTCGTCAAGAATGTGACCATCCCGGATGGCGGACGGTACGAGTGTCAGGTGAAGAACCAGTATGGCCGGGCTTCCGCCTCC
GCACTGGTAACCATCAG
AAACAACGTGGATTTGGCTCCAGGCGATCGGTATGTGCGCATCGCGTTTGCCGAGGCAGCCAGGGAGATTGACCTGGCCATCAACAACACCCTGGACATGCTC
TTCTCCAACCGATCCGACAAGGCGCCGCCCAACTATGGCGAACTACTGCGGGTCTTCCGCTTTCCCACTGGCGAAGCTAGGCAGTTGGCCCGTGCGGCGGAGATCTACGAGAGGACTCTG
GTCAATATCCGGAAACACGTCCAGGAGGGCGACAACCTGACCATGAAGAGCGAGGAGTACGAGTTCCGGGATCTGCTGTCGCGAGAGCACTTGCATCTGGTGGCGGAGCTATCGGGCTGC
ATGGAGCACCGTGAAATGCCCAACTGCACGGACATGTGCTTCCACTCGAGGTACAGGAGTATCGATGGCACGTGCAACAACCTGCAGCATCCCACTTGGGGAGCTTCACTCACCGCCTTC
CGGAGATTGGCGCCACCGATTTACGAGAACGGATTCAGCATGCCCGTGGGCTGGACCAAGGGCATGTTGTACTCGGGTCATGCCAAGCCCAGTGCAAGATTGGTATCCACCTCGCTAGTA
GCCACCAAGGAGATCACACCGGATGCCAGGATAACGCACATGGTGATGCAGTGGGGTCAGTTCCTGGACCACGATCTGGATCATGCCATTCCTTCCGTGAGTTCGGAGAGCTGGGATGGA
ATCGATTGCAAAAAGAGCTGCGAGATGGCTCCACCCTGCTATCCCATTGAAGTGCCTCCGAATGATCCTCGTGTCCGCAACCGCCGATGCATCGATGTGGTGCGATCCAGCGCCATTTGT
GGATCCGGCATGACGTCCCTCTTCTTCGACAGTGTGCAGCATCGCGAGCAGATCAACCAACTGACCTCCTACATAGATGCATCGCAAGTGTATGGCTACAGTACTGCATTCGCCCAGGAG
CTGCGCAATCTGACATCCCAGGATGGATTACTCCGAGTGGGTGTCCACTTCCCGCGGCAGAAGGACATGCTGCCCTTTGCTGCTCCCCAGGATGGGATGGATTGCCGCAGGAATCTCGAT
GAGAACACCATGAGCTGCTTTGTTTCGGGCGACATTCGTGTGAACGAGCAGGTCGGTCTTCTGGCCATGCACACCATTTGGATGAGGGAGCACAACAGGATAGCCAGCAAGCTGAAGCAG
ATCAATTCCCATTGGGATGGGGACACCTTGTACCAGGAGGCTCGCAAGATAGTGGGTGCCCAGATGCAGCACATCACCTTCAAGCAGTGGCTGCCACTGATTATTGGCGAAAGTGGAATG
AAGATGATGGGCGAGTACCAGGGCTACAATCCCCAACTGAATCCCAGCATAGCCAACGAGTTTGCCACGGCAGCCCTGCGATTCGGACACACCATCATAAACCCCATTCTCCACCGCTTG
AACGAGACCTTCCAGCCGATACCCCAGGGCCATCTACTGCTCCACAAGGCCTTCTTTGCTCCCTGGCGTCTGGCCTACGAGGGTGGAGTGGATCCCCTTATGAGAGGCTTCCTGGCCGTG
CCCGCCAAGCTGAAGACCCCCGATCAGAACCTCAACACTGAGCTCACAGAGAAACTGTTCCTGACAGCCCATGCTGTAGCATTGGATCTGGCTGCCATTAACATCCAGAGGGGCAGGGAT
CACGGAATGCCCGGCTATAATGTCTACAGGAAGCTATGCAATCTCACGGTGGCGCAGGACTTTGATGATCTGGCCGGCGAGATCAGTAGTGCCGAGATACGCCAGAAGATGAAGGAACTG
TATGGACATCCGGATAACGTGGATGTTTGGTTGGGTGGCATCCTAGAGGATCAGGTGGAGGGCGGCAAAGTGGGTCCTCTCTTCCAGTGCTTGCTGGTTGAACAGTTCCGTAGACTTCGT
GATGGCGATCGCTTGTACTACGAGAACCCCGGTGTCTTCTCACCCGAACAACTGACCCAAATCAAGCAGGCTAACTTTGGTCGAGTGCTCTGCGATGTGGGTGACAACTTCGACCAGGTC
ACCGAGAACGTGTTCATTTTGGCCAAGCACCAGGGTGGCTACAAGAAGTGCGAGGATATAGTAGGCATTAATCTGTATCTGTGGCAGGAGTGCGGCAGGTGCAACAGTCCACCCGCCATC
TTCGATTCGTACATACCGCAAACCTACACCAAGCGGAGCAACAGGCAGAAGCGAGATCTCGGCCAGGAAAACGATGACGTGGCCACCGCCGATAGCTATGACAGTCCACTGGAATCCCTC
TACGATGTGAACGAAGAAAGGGTCAGTGGTCTGGAGGAACTGATTGGCAGCTTCCAGAAGGATCTGAAAAAGCTGCACAAGAAGCTGCGCAAGGTGGAGGAATCCTGCAACTCCGCCGAC
TCCGAGCCGGTGGCTCAGGTGGTGCAGTTGGCGGCGGCACCGCCCCAGGTGGTTTCCAAGCCCAAGCGGAGCCACTGCGTCGACGACAAGGGCACCACCCGGCTGAACAACGAGGTCTGG
TCACCGGACGTCTGCACCAAGTGCAACTGCTTCCACGGCCAGGTCAACTGCCTGAGGGAGCGGTGCGGCGAGGTCAGCTGTCCGCCGGGCGTGGATCCACTGACGCCTCCGGAGGCCTGC
TGCCCACACTGCCCGATGGTCAAGTGA

Retrieve as FASTA