Entry information : DyaPxd01
Entry ID 7659
Creation 2010-10-25 (Marcel Zamocky)
Last sequence changes 2010-10-25 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2010-10-25 (Marcel Zamocky)
Peroxidase information: DyaPxd01
Name DyaPxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Arthropoda Insecta Drosophilidae Drosophila
Organism Drosophila yakuba    [TaxId: 7245 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DyaPxd01
start..stop
S start..stop
DmPxd-A 3013 0 17..1528 18..1527
DerPxd01 2998 0 1..1528 1..1526
DsiPxd01 2970 0 17..1528 18..1528
DmPxd 2911 0 17..1525 18..1526
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9307651..9307817 167 N° 2 9325640..9325855 216 N° 3 9325921..9325992 72 N° 4 9326079..9326320 242
N° 5 9326481..9327152 672 N° 6 9329090..9329296 207 N° 7 9329392..9329570 179 N° 8 9329855..9330036 182
N° 9 9334879..9337528 2650  
join(9307651..9307817,9325640..9325855,9325921..9325992,9326079..9326320,9326481 ..9327152,9329090..9329296,9329392..9329570,9329855..9330036,9334879..9337528)


exon

Literature and cross-references DyaPxd01
Literature Drosophila 12 genomes consortium (2007) Evolution of genes and genomes on the Drosophila phylogeny. Nature 450:203-218.
Protein ref. UniProtKB:   B4PDD3
DNA ref. GenBank:   CM000159.2 (9307651..9337528)
mRNA ref. GenBank:   XM_002094165.1
Protein sequence: DyaPxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1528 (1506)
PWM (Da):   %s   170349.52 (168035.1)  
PI (pH):   %s   6.25 (6.21) Peptide Signal:   %s   cut: 23 range:23-1528
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRVPLLLLQLLGLLLLSGGVQSIYCPAGCTCLERTVRCIRAKLTAVPKLPQDTQTLDLRFNHIEELPANAFSGLAQLTTLFLNDNELAYLQDGALNGLTALRFLYLNNNRLSRLPAAIFQRLPRLEAIFLENNDIWQLPAGLFDNLPRLNRLIMYNNKLSQLPVDGFNRLNNLKRLRLDGNNIDCNCGVYSLWRRWHLDVQRQLVSISLTCAAPQLLQNQGFSSLGEHHFKAKPQFLVAAQDAQAAAGEQVELSCEVTGLPRPQITWMHNTQEVGLEEQARAEILPSGSLLIRSVEPSDMGIYQCIARNEMGELHSQPVRLVVNGGNHPLDSPLDARSNQVWADAGTPTHGATPSPSSTPLPSPPHFTHQPHDQIVALHGSGHVLLDCAASGWPQPDIQWFVNGRQLLQSTPSLQLQANGSLILLQPTQLSAGTYRCEARNSLGSVQATARIEVKELPEILTAPQSQTIKLGKAFVLECDADGNPLPTIDWQFNGVPLPGNTPDLQLENENTELLVGAARHEHAGVYRCTARNENGETSMEATIKVERSQSPPQLAIEPSNLVAITGTTIELPCQADQPEDGLQITWRHDGRLIDPNVQLAEKYQISGAGSLFVKNVTIPDGGRYECQLKNQFGRISASALVTRNNVDLAPGDRYVRIAFAEAAKEIDLAINNTLDMLFSNRSDKAPPNYGELLRVFRFPTGEARQLARAAEIYERTLVNIRKHVQEGDNLTMKSEEYEFRDLLSREHLHLVAELSGCMEHREMPNCTDMCFHSRYRSIDGTCNNLQHPTWGASLTAFRRLAPPIYENGFSMPVGWTKGMLYSGHAKPSARLVSTSLVATKEITPDARITHMVMQWGQFLDHDLDHAIPSVSSESWDGIDCKKSCEMAPPCYPIEVPPNDPRVRNRRCIDVVRSSAICGSGMTSLFFDSVQHREQINQLTSYIDASQMYGYSTAFAQELRNLTSQDGLLRVGVHFPRQKDMLPFAAPQDGMDCRRNLDENTMSCFVSGDIRVNEQVGLLAMHTVWMREHNRIASKLKQINGHWDGDTLYQEARKIVGAQMQHITFKQWLPLIIGESGMKMMGEYSGYNPQVNPSIANEFATAALRFGHTIINPILHRLNETFQPIPQGHLLLHKAFFAPWRLAYEGGVDPLMRGFLAVPAKLKTPDQNLNTELTEKLFQTAHAVALDLAAINIQRGRDHGMPGYNVYRKLCNLTVAQDFEDLADEISNAEIRQKMKELYGHPDNVDVWLGGILEDQVEGGKVGPLFQCLLVEQFRRLRDGDRLYYENPGVFSPEQLTQIKQANFGRVLCDVGDNFDQVTENVFILAKHQGGYKKCEDIAGINLYLWQECGRCNSPPAIFDSYIPQTYTKRSNRQKRDLGKVDEEVATAESYDSPLESLYDVNEERVSGLEELIGSFQKELKKLHKKLRKLEDSCNSADVEPVAQVVQLAAAPPQVVTKPKRSHCVDDKGTTRLNNEVWSPDVCTKCNCFHGQVNCLRERCGEVSCPPGVDPLTPPEACCPHCPMVK

Retrieve as FASTA  
Remarks Complete from genomic (chromo 3L, 8 introns), no EST found. Strain="Tai18E2".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGTTCCGCTGCTGCTGCTGCAGCTGCTCGGCTTGCTGCTCCTCTCCGGCGGAGTCCAGTCCATCTACTGCCCGGCCGGATGCACCTGCTTAGAGCGCACTGTGCGCTGCATCCGC
GCCAAGCTGACCGCTGTGCCCAAACTGCCCCAGGATACCCAAACGCT
GTAAGTACTCTATGCCATATACTTAAAACTCAACAAGCAACATGCATCGATTCAATACTTAAATAATTAAAGA
TAATCAATCAATTTAAAGAACTTTTATGGTGCTCCTGGAATTCCAGTTTCACAGGCTTAAGTTCGAAATGGACTTTTAATAGTTATTCTTGTCCAAGTTCGGCTTCCAGTTGCCTTTCGT
CGAGTGTACATAAATCAACGCGGGAGTTGGCTTGCAAATCCATAAATTAGTTTTTAATGTTTTCTGTGCACGCTGCGAAAAGTTGACGGCGTTAATTTGACGCCCCCCTTTTCTGCTCCT
CCTCCTTCCATGGAGTCCTACTACTCCTCCTCCTCCTCCTTCCATGGAGTCCTCCTACTCCTCCTCCTCCTCCTCCCAAGGGAGCCAGCTCCAGCTGAATCCATGAATCTTCCGCCAAGC
GGCGCTATGTTGACTCAATTAAACGGATGTCTAACCGGCAAAAGCTGACTGCGATTTGTATATTTATCACGCTGCCTGTCGCGTATTTGCATGCATGTGCAATATTTCTGACGTTGCATT
TATTTTCGAAAATGTCAGCAGTTTTCGCATGAATTTCGGGCACCACAACCATTCCGCATCCAACGCATACAACTTGGCAAATGTTTGCGGAGCATATGCATATTTATGTAGGCCGTGGCG
TGTCCCAAGCCGTAGGAACAACCTCCCAAACTCGCATCCTGGCAGAGTGCAGCAGCTGCTGCAGCCGATGGCAAGTTATCAGCAGACAGAAAAACAGAAAACAGTCTCCACTGGGGGACA
ACAAGATATCCGGACAGACGGAGGAGCACGGTTTTCGTGGTATTTACGGAGAATTCAATTTCCAGCGGGGTTGACGGCGCTTGAGCCGCGTTTGATGGCCGGGATTCGCTGATTCGCAGC
GGGGAAAAGCTGCAAAGGATTTTCACACACACACACCCGTCAGGTGGAAAGCCAGGACCATCGTGGTCCTGGGAATAGGTGAAGCCACTCACTTCACGTGTCAACGAATTTGAAAGCCTT
GAACAAATCGATTATATGGTGCTTCAAAAACTATAAAGTGCTCTCTCAACTGGGGCACATTATTCGCTGATTCGCCGTTTCCGAAGCACTTTTAAGTTGAATCTGATACATTTTAAATCT
GAAAAAAATCATTGGATAATTGAATGTTCCTGAGTTGGAAAAAACGGTTTTAAATAGCTTCATTAAATTATACAAGCCGAAGGAAAATGCTCCAGCCAAGCGGCGGATTTCAAAACTCCT
GACAGGTGGATAAATTCCACCTGTCCGTTGAATGGGTGAAACCAATTACTGCAGCTGTCATCGAATTTTGGGTCCCCAAATACATGGATTTATTATTTCATTTTCGCCATTGAACGAGTG
AGTTATGGGAAAGTACAGTTTGGTTCATTTGGCATTTTAAAGACTGCTTCCAAATTTAAATGAATATTTTAGCGACATCAAAAGCTGGTATTAGATTATGAATTTAAGGTCGCCCGACAG
GTGACAAAAGCATGAATGGTTGGCAAAAAACAAAATTCCAAAACTGAAAAATAATATGGAACTAAAAACTTCTCTGACCGCGGCAGAGTTAATAATTGAGTTAACCAACATATCAGACCA
AAGCAAAACGGCAAAACTACAAAACTATACAACTATGTGCAACCAACAATGCCTTTTGTATTTAAATATTCTATTGTGCAATCCGCAACGCCATCGAATCCACATCCATTTGCAATCTCA
ACAGGAGGATCACATTCTTTGCCATTTGTTTGGCTTGCCGCACAACAATTTCTCAAATGGGTGAAAGCTGTGGAAAACTGGTAGTGGGAGCCAACAGCATTTGGCAGTACTTAAATTAAT
CTTCATTTTAAATAAGGTGATGGCTGCATAATTTATCATGCCTCGAGAGCAACAGCATCCGCACACAACAATAGAACAAAAAAAAACTGAAAAATATTAAAAAACACAGAAAAACACTGA
GAAAGACTGAACAAGACTGCAAAAAAAGTGAGCAACTTTTGCGTTGTCATTGCGATTCGCTTTTCATTTATTACGCAGCCGACCCGTTGCACACTTTTAATTAATTTGTTTCATTTATTA
CTGCATGTGTCTAAAAGTTGCTCTTGTTTTCCCCCATACAAGCGCATGTTTGTGCATTTCGCTCTTGTCTGAGGCTGTCGACTCAGATTCCAGCTTTCTTTCCATAATTCTCGAAATGTT
TCTCGGCAGTCTGTGAAAAATATGAGCACACATTTTCCCAACCAGAGAGACACTATTATTTTATAGCTCACACATGCCGACATTTCGGTTTTCGGTCTTCATGAAAATATTCTTGATTTA
ATTTCCTTAATGGCGAAAATTTTGTTTACAATTTCTGTCGGAAGGTCGCTGCAGATAAATGTCGAGCAAACATAAAAGAAACTACGTCGAAAAACTACGTAAATACAGACAAATTTTAGT
AGAGGTAAAAGCAAAGTCAATTTCTAGTTAAATTGGACACAGAATTAAAGTCAAAAAGGCAGAAAAGATGTGTAGAATTACTGACTATATATGCTTATAATCAAATAGGTGCACAAGCAT
TTTTAGGGAAATATTAAAATAATGAATAGTAAGTTCGATAGCATAACGATCTTCAAGATCACCTCCTAGAGGTTTCCATTCAAGCATTTCCTGGCAAACTTACAAAAGCCTTTTCAGTGA
GCTCTCTCCTATTTTGCACACTTCAGCTGCCATTCCTCTTCAATTTAATGCTGCTTACAGCTCCAGTCTTCTCAAGGCCTAAGCCACATTTCACTTCTTTCAAACTGTCCATCCATCAGG
CATAAAGTCGCTGCCTGCGCAGCCATTGAAACTTCTCGCCGGGATGGGGCCATAAAAAACGGATGCAGCAGCTCCACATCCACATCCACGAAACATGCCTCTCACATCCTTGACTTGCCT
CGAACAAAGGCCCAAGCATTTTTTGGCCCGACCCGTGTGTATTTAAACTGGCAACTAAATGGAAGTCGAAACTGTGTAACATACGGCATCATTCATTTTGCCACACCCCCACCTCTTACG
CCTCCAAACGCCCACTCACAAGGCAGCTGCCAAAGGAGGGGGTGGGGCTCTCTTTCCTTCAGAGCTAAATAAATGCACTTGATTTCATTTCATGATGATGCATTTTTAGCTGACCTCCCA
TAAGCACACATCTCGACTTGCTCCGCCGTGGAGGCAGTTGCTTTGTCATTATTCCCCGGATCGTGGAGCTCGTCCAGTGGATTTACCCCATCCATTCCGGACTCGTGAGCCAGTACTTAC
TTTTAAGGACCGAGAGAAATTGCTTTTCGATAGAAGAAAAAGTGGTGAGGTTGAAATTTATGTTGCCTAGGTCAAGCTTATTGGATTTAAAACAATTAGGCAATTTAAAGTGTAGAATAG
CTTTTATTTATAACAGAAATTGAGAGTCTTAAAAGAAAGGGATTTACTTGAAATTAGTTACGAAATATATAAATATAAATATATAAAATATGTATAATAAATACATATCTAAGCAATTTC
ATATTTCTTTGCTGTCTATGCCCCCTTTTCGCTCACTGTATCCTCAGTTGAAAAGACGAGCACATAAAACGCACATGCAGCCAAGACATATGAACTAAATCTGCTCGCCGGCAGCCACTC
GGCCACACATGCTATCATCTAATAACTCGGGCATTATGCACATATGAAATATATCTCATAATGCCGCACCGACTTGCCACGCCCCCCGCATGGCCACTGCCACCCGCTGCCGCCCACTTT
GCGGCGGTGTGTCAAAACAAAAGTCGCCGCACGTTGCATGCATGGCATATTAAAAAGTTTGATTAGCGTCCAGTTCGCTGCCTCTGCTTCTGCCACGCCCACTTGCCACCCGCCCACTGG
CCGACAATATGCCACACCGTCCGGCAAATACACACAAACACACACACACAGAAATATGAGCATGAACATGAATATGAATACGTATACATATATGGACAATATTTGGTTCGGTTTTTTTTG
CGAATCAACTATTTGCGAAAACTATTTTGCTAGCAAAAATGTTCCAACTCCCCTGCTTGCTCCCGCTGCTGTTTCACTTCGACCCCCAAATCATCCATCCTCTTTAGGCTACCCCTATAT
ATATATATGTATATGTATGTATAGAGGGACAAGCCCCCGGAAAAAGCCCGATTTTGCCGTCATACTTTCCTGAATTTCTCATCTCGTCGGGTGCATTTATGCGTGAGAAATGCCTTGTAT
TTTGTAGCTAGTCGTCGTGGCCATATCCTTGTTCCTGCTGCTGTTCCATATCCAGTTGCTTCTGCCATGTTGTTATTAAATATGCATAAATTTCCTTTTTGCACAGGACTTTTGCATTTA
CATTTGCTGTTTATTTGTCGGTGGGAATATTGAAATTGTTACCAATGGATAGCAGATTCCAGCCCAGAGAACTGGTTTCCGGTGGGCATGGATTCGCATGGATTCCAAACTCCAGACTCA
CCTGTGCATGAATATCTACCTAGTAGGATGGGAGGTGGGAGTTGGGAGTTGGAGGGGTATATACCTAGATCTATCTATCTGGGAATATATGCAGGATATGCAGCCTGGATGCGGATAATT
ATAATTATAGTAGTCGGCAAGTTGTCGGTTCAAGTTTCTGGCCGATTTGTGAGTATTTCGATTCGCCTGTGTCGAGTTATGGTGGGTTTATGAAGCTCGTACTATTGCAAATAACTTGCT
AATGAGATTTATAATTGATAAGCAGAGAACTTTCAACGTTTTCTCAGAATCTCTGTGTATTTGCAAACTAGTTCTATACATTTTATGCAGTTAAGTATATGTTTCATTTAGACCACATTT
AGATAAATCAAATTTATTAAATGCTGCTTATTTCCTCTGGCTAAATAATTATTAATAATAGGAAATATGTTTTTGTGGACAGTTTTATTCAGTGACTTGTAACTATTAAAAATTATTTAT
GACATTTTTGGCTTTATGCTGCTTTTAATTAAAATGTGCCGTAAACAAACAATATTCTTAGTAATAACAACAAATTAGATGTGTGTACAAAAGAATTCAGATTGCAATGCTAAAAAATGG
AATAATGTAAAAGTGATTATAACGAACAAAAATAATAATTTACATAATTTCTAGGTGAATGAAACAAAAAGGATTAATTAAAATTTATGTCAGTTTTCTTATGTTCCATTTAAAATGGTT
ATATTTATTTTAAAATTAGTTATGTGTTTTTACAATGCGTTATTTAATTTAATTGCTTACCTTCATTGCATTTAATTTCCTTAAATGGCGCTTGCAATTGAAAAACTCATTATCCTAATA
TCGCAGTGCCATCAATCACAGCTGTCTGCGTTTGTCTAGTGATAAATCCTCTTACTGCATTCCGCATCCAATTACCAATCAATCAAAGAGCATCCAATCGTCGCTGTCTCATCCGTCTTC
CTTTTATGTAGACTGCCACGCCCCCAAAAAAGGCTCCGCCCCCGTTTGTGAAATATAATATTATTGTTGGTACGCTTTTTGCCCTTGCAGTTCAGTCTGGTTTGACTTTTCAATTGTTGC
CATATTTTCGCAGACCGAAAAAATTGACTACATGGAAATACAATTAAATTGTATGTATGGTATATGTATGGAATTCCTACCATTCCGCCACCCAATCAGTAATATGATTTGTAATTATGC
AAATGAAGCGGTAGACCGTAGACCAGCGAACGCACTTGAATGGCTGAATGCAGTTCTCATTGATTAAAGCTGAACGTTTGGGAAATGTTCACTTTTTACATTGGCGCACCTCAAAGGGAA
ATCCCCGAAGGCAAAGTTTTTGCCAATCAAAGCGTATGCATTTTTAATTCACTGTCACAAGCAGAAGTGGAAATGGAGCTGCAATATCGACTGGCATCTCGGGGTGGGGCATTCCCGATT
CGAGATTTTATATTCCAGTTTCCAGGCTCAAGACTCGAGGGTCGAGACTGGGTACACGAGATTACAGATTCCGCCAAGGAATCTGTCTGCCAGTCAGCCGAGCTTCGCTTCACTTTGACA
TAGAAAAATCTTCTATTGATTTCCCAAAACTCCCCCTCAATTTGCATTTAAAGTTGGACGCTTTCATTTCTCCCATTTCTTGCTGCTCTCACTCGCGCCCCTCTTTAATGCTACAAAGTG
CCACTTGGTTCATTTGCCAGCAGTTCTCCTGCTCCTTTGGATCATGCCACTGCCCCCGCCCCTGCCACTGCCACGCCCACCAGCTTTGTCATTTCGCATGCTCGTTAGTGCGGAGCAAAG
AATGCAAAGTAGCAAGATAGCAAGAGCTGTGTGGAAAATACAGCAGCAGCAGCAACATCATCGCTGCACAAACACATGCCACAATTTATAAGCAAAGTTATTCTGCCACCGAGAAACGGT
TGGTGGCAAGTCGGCCAGGGGGGCGGGGCTGTGGCAACTAGCAACATGTCAAAGTGGAGCAATCGGCATGTGCAACGGACACAGAACAGGACACTGAACACGGAAAACAGGCGTGCACTG
CGGGAAAAAACAGGCAAAAGTTGCCGATATTAAGATGTTCTGGCTGCCACAAAAGGTTTTCTATCAATCAATACAGATGTTGCAAAATGACTCAACCTTGAAACTGAATACCACCTAGAG
AGCAAGTACATAGAGAAAAGAAATATACTTCATCACATCTAGTTTTCAATAAGTGTGCGTTTTCAGCAAGGCGAGCTCCTTTTAATGTAATGATTTAGCAAATGGAATTCCACTGAAATT
CGCCTCATAAACCCTCTGTCCATAAAGAAGTGATAGAGTTGAGAATAGATTGCAGTGCAGTCCTGGCAACTGGCGGTCAAGCATAAGAAACGGCAGCATCAGCAGCAGAAGAAGAATTGC
AGCAGCAGAAGAGGAGCTGCAGCCCATAAGTATGCTATGGCTATGGCAACGGAGCGAAGCCCAAAAGCGAAGGAATAAGTGCGCAAATAAAAGCGTTGCAGGGCGACTGCTGGATGCGGA
AACCTCCTCCTCGTCAGCGCCGCCTGGCCAGGTGAGATGCCACCGCCATGTGGCACGAACTACAGTCAACAGCAGGCGATGGCCGAGTCAACAAAAAAACAACAAGACAGCAAGACCAAT
GTGGCTTAGTTAAATGGGAAATACTCTTACACTGAATCAAATACAGATGACATGTGCTTACTCTTAAAGTCAGTATGGCCTACAAAATCATAGATATTCAAATGAAATATATCATCTATA
AAATAACAATTAGGCAAAGACTTCATCGGCTTATTTGTGACACCATATCAGTTGGTCAGGACCTCCTTAAAGGGTATTTCCGGACGCCAAAGGAAAAGAAACTCACTGCTCAACCAGGCG
GCAAACCAAGTGAGTGAGTGGGTTTGGGGTCCAAGGAGTCCGAGTCCGAGTCCCAGCCAAGTGGCACGCCACGTAGCCAGCAGATAGCAAATACAAGATTGCTGCTCCGGGTACGGAACT
TGCCCCAGACAGATGCATAATAATGTTAATGTAAGCGCCTGCGACTTTGGGCTGTGGGGTCGAGTATGGGGCAACCACGGCGTATGCGTAATATGCCAGCAAATTTGAAGCTATTCTCGG
TCGTGTAAGTTGAAGGCCACATCGTAAAATGAGCATTAGATATTTGTAAGCTAGGTAGTTAAAATTAGCTTTTACCTTCTTTCAAAACTAAACAGCTATTTTATATCCACCTTTGCTTTA
TTCCCTTTGGCTACAAACACTTGAACACTTTCATACATTTAGGAAATAGTTCGTAATTTAATTTCCTCGGCATATTTATCAATTTCCATCCACCTAGGCCAAATACATTTATCCCTCGGA
AAGCCGAAATAGAACACTGCATCAGAAGGGCTTTGGGTAATATTCGCCTTTTATACGCATATTAAACCGTTTCCACTTGAATGGCGAACTGATTTCATTGCATTTTTATAACGCATATAT
GTTGCATGGCTGCATGATTGTATGGGTGGTGTGTGTGGGCTGAGTGTGTGCCTCCTCAAATAAAAACGAAGAGCTGCTCATGCACCCAGCTCCATGCTCGACATATAAATCTGCTGTATA
ATTGAATTTCACACGTTGCAAGGAAAAAAAATAATACCAAAATGGTGCAGAAAAAATACGAAAAAAAAAAAAAGAAAGTGCATAACCAGCGGCAGCGAAAGTTTAAATAAAATTTATTTC
AACAAAAATACACACACTCGTTGGGCAAATGTGTGTGTTCAGAGATGGCAGTTGCCTGAAAATGTGAGCATTATATATTGAAGGGCGCACGAGTGGGGCGATGGGAGATGGTGCTGCTCC
TCCAGGTGGCCACTTTTAACCATGAAGGTGTTTGCCTGGCCAAACTGGAAGCAGCTTAAGCATGCCACAACGAGCAGCCGGGATGATGAGGGTGGTCTCCTTGCGTTGGTCTCCTTGCGT
TCGCAGGACGACGAGGAGCACGAGGACTCCCATAGACAGGCGGCAATTGCATGTGTGTAGAGTGCACTTGTGAGACATTTACACCTGTAGAAACGTCGATGGGAGGGGCGGCTTTACGAA
GAGCATTCTGAGCTGGGATATGAGGCACGGCTGAAGGAGCTTTTGAGGCACAACACATTAGCAGTCAGCACAACAGAACAGAGGAGTGACGCTGCAAATGCAACATAAGAGCAGTCGTCA
CGAACCAAAAATTAAACTTTGTAAGACATAACTATTTCGTTTTTATATTTTACCTTTATTATTAGAGATGCTTACAGCATTTTTATGCTCATGTTCACATGAGTGACAAAGAAAGGAAGC
AGCTCATAGCCAACAGAAATAAATTGAGTTACAAAGGTGTCTGAAAGTATGCAACCTTTTTAATTATTTTCTTCTTTAAACAGCTCGTTTTGATTAGAAGCTCTGATAAAATACACCAAT
CTGGGTGATAGGTTTTGGGTTTTCCTGGAAAAACTTGAGAGAGCGGGTCAGTCAAAAAACGGCGAAGTGAGACAGCAATTTTAAGTAAGAGGAAATTTGTAGCCCGGGCATTTCTTTGGC
CTTCTAACATTTCGTTTTTTCTATGCTCCTAGGACTTTTGCACCCTTTTCCTCTCCGCTCTTTGATTTTCCAACGCTGTCAGGAGTTTTTCTTTCGCTGGCAGCCCAAAAGTATGCAATG
CAAGTTTAGATGCCTCTTGTTCTTGCAGCGTCCTTTTTTGCTCAAGACCGTGAGTGCCAGTGTGTGTGTGTGTGTGAGTGTATGAGTGTGAGTGTGTGTGTGTGTGGGACGGAAGTGAAT
TTTCTGCACGTGGCTTAACTTCTGCTGCCTGCTCTGGCGTGTCATGCAGTCAGCAATCTTTATCCAACCCAAACGCAAGCAGCTCGAGTGGGCGCCTTTCATTCTTTTCTTGCGGATTCC
GCTCAAGGATTGCATTTAACGCAGGAACAGGAAGGAAGGAAATGCCATGTCGACGCTAAAACTGGGTTAGCTTACATAACGACAACATTAACGACAACGCCTTCCTTCCGGTGGGCGGCG
TTCGGGTGGGCGGCGCATGGGTGGTATGGCGTTGGCTTCACGCTTCGTCGCTTATTGGACATAATTACTGAATATAACCATTCTGTGGTGGCTCCACAAAACGGGGCACTCAGAAAAATG
CCCGCCAGGAATTTTAAGAATTTCTCTCATATTTTTGTGAACAATTCTATATTACATAACATTCTACTGGTAAATTCTTTCTTTAATCAAAATTCGAATAACTTCTTCACTGCCAAACTA
TTTCATTTAAACTGCAAGGTGTTTAGAAGTATGCAGTGAATTTAAGCTGTCAAAAAATGTGCTTGCATACCCTTAGAGCACCTTCGATATATTCTTGAGATGCATCCTTGATTTCGCCGA
GTGCATATCCTTTCGCCAAAGCCACTTGTGCGTAACGGCAGCGCCAGATAAGTGCAACAAAAGCCACGGCGGCGGATGCAGCCAAGCCAGGCCACATATCAATTCCATGTGAGCGGACTA
ACTGCTCCTGGTGGTGCAGTCCTAGTTCCGGAATGTCCTGCTTGCTGCTGGTCAGTTGGAGGAGGGGGATTTTGGTTCCCTTATCGCTTACACTTGGCAAAAGGAGAGTCACCCTCACCC
GCACACAGTTCACTATTCGCACTGATTTTTTGCTCGCCTGCCAAATCCTTAAAGTAGCACAGCTTTGGCCCAAGGATTTGTCGTAGCAAAGTTTCGTTCTTTGTCAGTTGGGGAAAACAA
TGTTAATTGCTTTGCAGTTTACTTTGCGCAATCCGGTTGACTGGCTCAACTGTTGGACTTTCTTGGTACAGGTGACATCCGCTAAGCCGTAAACTGCGGCTCTCAAGTGCTTACAAATCC
GCTGTTAACTTTATGGCTTAAATGTACATTTACTCCTTCTTGAGATTTAAGTGCATAGCAATTTAAATAATTTATTTAATGATTTTAATGATCTTAAAGGAACATGTTCTCATACTAGAG
ATTAAACTACATAGTTAATTACCAATTTAAATAGTTTATTAAAAGGAACATTTACTCATACAAGAGATTTAACTACATAGTTACATAACTACCCATTTAAATAGTTTTGTAAATGATTTG
ATTTTCCCGAGATATTCACTTACACACTAAGGATTCAAATTACTCTGCAGCTTCCTTTTGCTAATGTCATTGCCACTTTCCCGGGCAGGAGAAATTCATTAAGCCCCGATCTACAGCTCT
AAACTCTTTGGCCAAAATCTTTTGTTGTTCCATCTGGGCTAAACAAAGCGTTTTATGCATGCACACTCCGAGCCAATTACGCAAAGTGCTCTAAGTATCTCAAACAGTCCTAACTGGACA
CAATTACATTAACAGTTTAGCACACACACGTATGTATGTATGCGTGTAGTTGGCAGATATCGGGGATTTCCGGAGGATAACGGGTTAGATATAGCCATCATCGTCAGAAGTGAGCGAAAT
TGGGGGTAGGCAAACAGGACGAAAATTAAATCACAGCCACAGCTGCAAAGGCTCGAAAATAAGTCCTGGCGAAAAGGAGCGGAGGCAATGAAACTGCTGCTGCTACTGCAACTGCTGCCA
CTACGGTAACTAACTTTAACCCCGGAATCTTGTAGTCCGTAACGCCCATCTCCATTAACCCACACACATACAGACACTCATACACTCGCACACACACACACACACTGTCAGGCACACAGA
CAAAGTGACTGGCTGACTGGCAGCTGAAGTTTTACGCTCACAGATAAACAGTGTCAAGGGTTAACAGCAATGGGATGGAGGGGCGGTGGGAGTGGCCTTTGTTTAATAATAATAAAATGT
CACTGGGCAAAAATAAACGGCTGAGGAGCCGAGCGGCTGACGGATTACATTGCCAAGTGCTCCCCACAAGCACACACACATAGTAACACACACACAGTAACACATAGTAACACACACACA
GTAACACACACACACACTCATGCAGCAAGTCAGTCAGAGCAATTGTCATGCATCCTTTGGACTATCGTCACTGGCAAATCACCTGGGCAACCCGACAGCACACAGGCGGATACTTGGCTG
CGAGAATGTGAGTCCTGGCATCCAAGGATGCGCCCGCCTTGTGGGTGCAGGCACTTTTATTCCTTTGGTTGTTCTTGCTGGCCATGTTGCTGCTGCTATTTGTGCTGCTGCTGCCGGCGT
GTTTGTAAGCCATGTTATTACAATAATGTGCAATCTGAGTCTGAGATGCAGCACTGCAAGAAACATCTGTAGGGAAAATGAATGTGTGTCTTTAATAGGTGTCTTAGTGTATATTGCGCA
TTCTGGAGGAAAGCAAGCCACTTGAAAGCTATCTATCTATCTATTATGACAACCACACAACACGAAACTATTTGCATCAGCATAGGAGTACATCCTTAAATGTATAATCTTTTTCTTGCT
CTGCTGGCGAATGCGGTCTCTGTGGTGGCTTGTTGCGAGTGTTTGTGTGTGTGTGAGTGTGAGTGTGCGGCAGGCCAAAGTTAAATCATGTTTTTATTGTCACATTTGCCATAAAGGCAG
CCGAGGGACCGTCAGACCGTAAAAGGACTTATACTGGCACAGGAGCAGGTTTAGGATCAGGAGTAGGAGTAGAATCAGGAGAAGGAGTAGAAGCAGGAGCAAGAGGCGTCATAAGATGCT
GCCTAAGCTGCAGGCAAAGGTGGGGTGGCCAGGTGGCCAGGTGGGCAGGCAGGTGGGTAAGCCAGACAAATCATAATCAGAGCACAAGGCAACAAGCTCAACAAAGCCGGAATCACCTTA
ACAACCAGGTGGTGGGCTGCTCTTAACCGGGGGTGTTGGTTTGGGGGCGTGGCCGATGCCACTGATAAGGCAGCGCATAGGTGGCCTTTTCCTTCCTTCTTTCAAACGCGCTTATGGCCT
TGTTTACGTTGCATACTTTATGGCGCAAAGCGAAAGGGGGAGAAGTGGGTGGTCCTGCGGAAAAGCGAAGGAAAACGTGTGTGTGCGGAACGCGGAAAAAAGCGAAGCGTAAGCGTTAAC
TCTAATAAAAATGCAGTGAACTGGAAAATATACTGACTGCATGATAAAAACTAACTGGCGCTGAAAGCTGGCAGAAACCAATTCCAGCGAGAAAATGAAACCTTTAATTCATTTAGAACA
CCCACAAAAGGTCCAAAACGTTTTCAAAATCAGCAATCAAAGTGACTTGTATCAAAGAGTTTTGATCGTGGAGGCTAATGAAAATAGATAACTAGGTGTGGATTAAACAGCATTTAATTT
GTATTTATTTGTGCATTACAAATGGGTTTACTTCACGATGTCTGTCATGATTTTTCACTTAGGGAAATTGCGAAATTCCAGTTGACTGACATTGCTCGTTAATAAGGCTCTCAAAAACCG
CAATCGTGGCCAAATAATCAAACTGAAATCTCAAAGGGGACACCGCAAACATACACTTGTCGAAATTGCATGGCATGTACCCCCAGAAAATGCGCACTAATTTACTTGCTGCGGTTTTTC
CTTCACTAATTGTGACAGCTAATTGAAATCAAATTAGTGAAGCCACTAAACAGCTTAATGCTCGCTGAGCACGAACCAGATTTTCCACCTCGGCGATGAGGGGGGAAATGGGTTAACCAT
AAACCCTACACAATGCTAATTGTTTTCATTCAATTTACTGTCTGCGCGCCGCTTTAAAATATCGCTCTTGGCTTCAGTTTTGGCTAACCATAAATTTTCGTCATGGACATCAAAGCGTAT
ACGCAATATGCGAGTGTGTGTGCGAGTGGCATGTCCTGTTTGCAAGAATGTGTGTGTGGAGTGGTGTGGGTGTGCAGACATGCGTGAATAGACAAACATGCCTTTGTCAATAATATGCAT
TAATTAAGTGCAGACATGGATGCCAGAGGAATCAAACCAAGGATATCCGAGGTGCATCAATGGATTCCCAATCCCGCGCCACAGGACATACATACATACGTACATGCGGACACACAGGCA
TACACACGTACATACGTACACTCACTGACACGCAGGACTCAACACCAACACGGCGGCATTGCAAATTTAATTGAAAATATCGAATAATGCGAAAATGCAAATGTCATTATCAAAATTCAG
GCCGGCGGAAGTGTCACAAGCGCTGAAAAGAAGTTTCAAGATTCAATTTCCGTTTCCGCACACATCACGTGCCTCGCAGCAGGTGGGCATTAGGGCGTGGCCGTAGGGGGCGTGGCAGCG
GGGCGGTGCGCGGATACCGCCCCATCAGCAACCCAGTTATTTATGCCTCCGTTTGGTTCCCATTTTTTTTTTTAGCAGCTCCGTAAATAGTTGCGCAACTGACACGACGCCATGAGATGA
GGCCATTGCATCGGCGCCCCGCTGAATCCCCCATTTAGCCGGAGAGCAACTCCAGCACGCACTTGGTCAGGAGTGGGTTCTGTTCCGGCACATAAGCACTGAGAGAAATTGTGGCTAACA
CATGATCCATCATTCAAAAGAATGCCTTGCAAACAAGTGTTGGAGAAAAACTCTCTTTAAGAAGAACTAATTTGCAGGATGACTTACTGCTCTAAAGTCAAGGAAAGATGGGAAGACCTA
CTGCCATTTTCTCACAGTGCACCACATTTTGGGTAGGCTCGATGAGGCATTGGTCCGGGGAAGCCGGCTGTCCGGAATCCACAGTCCGAAGTCCGGAACCCGGACACGCACTCAGCGTGT
GTGCACATTGAAGTGGACCATCGTTTGTCACTCGAGGTGGGTGTGGAAGTGGGTGCAGCAGGGGCAGTGGATGTAGAAGTGGCAGAGGAAGAGGAAGAAGAGGAGGACACGGGCACAGTG
GTGCAAAGTGGTGGAGAGGTGTTGGCTATGCAGAAAGAGAATCGGCAAGTGGCTGGGAATTTTAAAGCACTCTACGGCTGGGCAAATACGATAGCGGTGTGTGTGGGTCAAAGGGCAGAA
AAGACCGCTTCCTTGTTGATTCAAATTAGAGCGATCCAACTGGCGGCACCACTCGGCTTGACCCACTGTGAATCTGAATCTGAATCTCAATCTGAGTGTGAGTGTGGCTGTGGCTGTGGT
TGTGGTGCAGGGCTCTGGATGGTGGCCCTATTCCTTGTTGACTGTTGGTGGCGGGGCTAATGGAGTTTGCAAGAAGTGGGCAAAAATGTGGATCAAGCAGCCGTACTTGCACACAAAGAC
CCCACCAATCTTCGTTCCGCATTCTCCGGCTACTCCGGTGCTCCTTCCTGGCGGGAGAAATGCGAGCAACTTTGGCAAATTGTTGCCAGCGTATCGCTGCCCCACTTCCTTGGATTCGCC
GCAGCTGCATGAGGTTGCCAAGTTGGTCCACCAGGAAAAATATTTACCAGAACTTTGAAGGCACTACAAAAATTTTCGGGATTACATTTCAATTAACTGAAGTGCAACGTGGCTATGGAA
AACTAGTTTGCGGACTTGAGCTTATTAAAAACAAAAAACAAATAAAAACATATTTTGTAGCGAACTTTGGAAAATTCCTTCATAATAAAGTTTGCTGTAATAGTCTTTATGGCACAAAGA
ACTTTGAAAAAATCTACAATAAAGGAGGGTAGTCGTAATATTTTTTTGAGTGCAGCTCTGAGAGCGGGGTTACCACATGGACACCAGTGGGTCGACCTGCCTCGGGCCGTGAGTCTTTCA
TCAGACCAGAGCCGTAGTCATAGCCATAGCCATAGCCATAGCCGTAGCCATAGCCGTAGCCGGAGTATAAGAGCCGGAGCCAAGACCGAAACCAAAACCCGGAGTGGAATTTCATGGATG
GGCGGAGGAGGGGGGTGCTGCTGCTTTGTTTATGTGGCTCCATTTGGGCATATGCATGACCCACTCAACCACCCATCAGTGGCACCCACCACCATCCTGTGGTTGCTGCTATTGTTGGGC
TGGGGCCTCAAGCTCCACGTGAGAGTGGTTTTAGTGTTGTTTTGGATTCGCGTACCTCCTAGTTGCATAGCTAAAGGGTATATTCGTTTTAAGCAAATGTAGGAATAGATGGACCAATTA
AAGGTGTTGCTGAAACTAAAGATTAAAAATCTATATTAAGTTATAGATTTATTCTAAAGGCATGCTGTGTACTTACTGTCTAAAAATGCATATTAAAAGTAATAAATAGCTAGCTTAGGT
ATGCAATACATCAAATAACAAAGCATGTACTACAGGGTATCATCTAGTCGCACCCCTCGACTTAAGTGCTCTATCTTGTTCTGGATTTTTAAGTTGTTTTCGTTGTCGTAGCTTGTTTGT
GTTGCCTTTTTTGTTGTCCTGTGTGCGAGGTTTTGCCTTTTTCCCGTGTGTTGCATCCTCGTCTTTAGTTGCAATTTGAGCACAGACACAGCAACAGCCAGTATTGCACTTGGCCAACAC
ACACTCACGCACACACTCACACACTCATACTCACACTCACACTCACACTTACATTCACAGTGAAATGCTGACACCAATTAGGGTGCAGGTTGTTGGTGTTGCTGCCGTTAGTTGCTGTTG
GTAGTTAGTTAGTTCGGTTGCACTTTGTGCGTTGCATGTTTACAGTGGCCACAAAACATAATTTCTGTTTAGACAACTTTAGCCCCAGCTCCAATTGCAGTGGCTTCTGGCCAAAAGCTT
TGCGAGCAGGGCTGGAAAAAAAAAATACAAAACAAAAAGGCGGAAAACAAAACAGGGTCATAATTATTGCGCCAACAAAGACAGCAAAGCAGCTGCCACATTGGCCAGCGGTAAACGATG
TTGCCAGCAGGCAGAGGCACCACCAGCTGAATTTTCGGTATAATTTTCACTTTTGCCAAGTGAAACTTTTTCGCTGCCGCATTGAATTTGCAGCCAGCGAGCAGCTAAAACCCGAGCAAT
AGCAAAAGCAAAAGCAACAGCAACAAAGTTCATGAGTTGATTAGAAAGTTTTTTAACCGCTGTTGCAGCTACATCCTTAACCCGCTGAAATCCTACAGCCATGCCCCCCAGCACATCATG
CACTCAGATAAACTACTATGGCTTTTACCGCATGCAAGGTAATAATACTTATGTATGAATATGTAACCAGATACTCCTTCACTCAATTTCTCATCGTTGTCCTGGGGAATTTCTTTAAGT
GAACCGTTGCTAATGGCAGCTCGTGAGCTTGGCATATGCGAAAAGACCTCAATCCGTGGCTTAGGCTCCCAACTCCGCACTGCATGCCACATGTTATATGCCACATGGGTAGATGGGTAG
ATGGGTAGTACGAGTAGTGGTGGCTTATCGCTTGGCTGCTTTGTCGCCGGGCAGGGGCATAAACTATGCGAGCGCGAGCATCAACTTTTTGTAATTAATTTTTAATGTGTGCAAAATGTT
TGAGTAAACGAGCATGTTGTTGTTTGCCATAGCGAGCGCCGCCATATCAAGCGGATGTCGTTAGAACGGTTTATCAAGCGCTCTAAGAGGCGAATAAGCTGCGGCTATATATACTATATA
CTCTATACTCTATACTCTATACTATTTAAGTTTGTGCTTAGCTGGTGTAAATAATTGGATTGCGTTTCAAAACGGGCGGTTGCCAGAAGCCAAGACTGCCAGGCTTCTGGTTACCCAAAC
GGAATTTCTTTGCACTAATTGCATATGACAATGCTGCAAAACATCCATACATCCCCACCTGACGCCCCCAAAAAACCACCTTACACCCCTACACCCTTGCAACACCCACCCATGGTGTGC
GAGCGAGAGGGAGGAAGGAGCAACGCAGACCGCATGACGAGAATTGGCAACTTGCTGCAATTTGCTAGAACCAAAAATTGATTTACCCTCAACTGCAAGTCTTCCCGCTTCGCACAGCTT
TCAAGGCACTTGAAAAAAATGCTGTTCGCTGGCAATTTGCATCTCGAACTTCGGAATTCAGCAGAATTTGCAGCACTGGCCAGCTTGCGTATTATGCAGAGTTGGCATCATTGACTGCCA
CGCATACTGGGCATCATTGATTTCATTGTAGAGCTTGAAATATAATATATATAATACTTTAAATGCTGAAATGGTTATTGGAATTTAAGAGTGTGACGTTTGACACCTTTGAGAGTCCTT
TTAATTTGCCATCATGCACTGAAATACAAAACTTAAGAGTAGTTTTTCCCGCAGTGTTGAGCCCAACTCCCCTTTCAATCTTTAACCGACTCGCATCCATCCATCAGATAAACGTTTTGC
TATCTGCAATCTGCGAATCGCATTCTGTCTCTTTGTCCATGCCATGCCATCCGCATCCACTCACGCTGTGTCCGTTCTTGTTCTTGTTTTTCCGGCAACATTTTTGCAGAGATTTGCGTT
TCAATCACATCGAGGAGCTGCCGGCCAACGCGTTCAGTGGTCTCGCCCAGCTGACTACGCTTTTCCTGAACGACAACGAGCTGGCTTACCTGCAGGATGGGGCACTCAATGGACTGACGG
CGCTGAGGTTCCTCTATCTGAACAATAATCGGCTAAGCCGCTTACCGGCGGCCATCTTCCAGCGGTTGCCACGCCTGGAGGCGAT
GTAAGTGAACCCTCCTTAATTAAGGATCCCCGCGT
GCAATCGCCTTACTCAATATCCTTCTGCAGTTTCCTCGAGAACAATGACATTTGGCAGCTGCCCGCCGGCCTCTTTGACAACTTGCCGCGCCTGAACCGCCTGTAAGTCGATGATGGTTC
GATTCCACTTTTCGTCTTTTTTTTTTGTGAGGAGACTAACATTCTGTCCTCCTTCCTCCACCATCCAGGATCATGTACAACAACAAGCTGAGCCAACTGCCAGTGGACGGATTTAATCGG
CTGAACAACCTGAAGCGCCTGCGACTGGACGGCAACAACATCGACTGCAATTGTGGCGTCTACTCGCTCTGGCGCCGCTGGCACCTGGATGTGCAGCGCCAGCTGGTGTCCATCTCGCTC
ACCTGCGCTGCTCCTCAGCTGCTCCAGAACCAGGGCTTTTCCAGCCTGGGAGAGCATCACTTCAAATGCG
GTAAGTTTTCAATTTCCATTTAAGTCACACACGGAACATGAAGCAACTTT
ATGCTTAAGTACGCTTGCCATCAAATGGATTGAAAGCACGATATCTGATGAGCGCCGCAGATGCATTTTAATACCGAATTGATGGCCACTCCACTTGAAATTACTTGCAGCAAAGCCGCA
GTTCCTGGTGGCAGCCCAAGATGCCCAAGCCGCTGCCGGCGAGCAGGTGGAGCTGAGCTGCGAGGTCACCGGCCTGCCCCGTCCGCAGATCACGTGGATGCACAACACGCAGGAGGTGGG
CCTGGAGGAGCAGGCGCGGGCAGAGATCCTGCCCAGCGGCAGTCTGCTCATCCGCAGCGTGGAGCCCAGCGACATGGGCATCTACCAGTGCATTGCGCGCAACGAGATGGGCGAACTGCA
TTCCCAGCCCGTACGCCTCGTAGTTAATGGCGGTAACCACCCACTCGATTCGCCCCTCGATGCCCGCAGCAATCAGGTGTGGGCGGATGCCGGAACACCCACGCACGGAGCAACGCCATC
GCCATCGTCAACGCCATTGCCATCGCCACCGCACTTCACCCACCAGCCGCATGACCAAATTGTGGCCCTTCACGGCTCTGGACACGTGCTGCTCGATTGCGCCGCCTCCGGCTGGCCACA
GCCGGACATACAATGGTTCGTCAATGGCCGCCAACTCTTGCAGTCGACCCCCAGTCTCCAGCTGCAGGCCAATGGCAGCCTCATCCTGCTGCAGCCCACCCAGCTCTCTGCCGGCACGTA
TCGCTGCGAGGCTCGCAATTCTTTGGGCAGCGTCCAGGCCACCGCCCGCATCGAAGTGAAGG
GTGAGTAAGTGCCAGAGATGCTCCATGTTGAGTGGGAAACTTTGTTTCCAGTCCAGGT
ACAGATGTGTCTATCTATGAATCTATATATTTTTGCTTTTATCGCAAACGCACGGCGTAATGTTGAACAACCTTATGAATTATGGTGTTGTTATCCTTAGTGCCTCATATATTTACCCAT
ATGTGCACCCAGCTACTGACCATCTCTGGTGCAGTACCCACACAGAGTCAGTGTTTATGCCACACACCATCGCCCTGTGACTGCCACACAGTTGCTGCTGCAGGAATAAGAGTCACAACT
GTCGCGCTTTACTCAATTTGCAGTCGATTTAATTTGTTTTCGTCTGGGAAAAGGGCAAATGGGGAGTGGCATTTGAGACTGACCAGGATGCAGCTGCCTGGCGAGGCCAACTCAACTGAA
CTGATATCGGGGCGTTGGGACTTTGCAGATGAGTTTGGCCGGCGGGAAAAGGGCCTCACTGTCCGTTAGAAATATTGCGACAACTTTGACAGCAGGTGGTGCCGGTGATTGGATGCAACT
TCATATAGACAAATCAAATCACAAAAGTTTGTGTTTTTGCACTCGCCAAATTTAACAATTTGTTCAAGCAAAAAAAAGTTTGGGATTCCGTTTTTTCGGAAAAATATTGTTTCCCACGAA
AAGTTCACGGCAATGTTTGCAATAATTAACTTTTAAAGGTCAACAGCATATATTGTGATTTTTGAAATTGTACAAAAAATTAAAAAAATGAGAGAAGCTTTAATTTTAGACTTACTATAT
TCTTACTATTATTATAGGTAGCTGTGGCCGCTTAGGTTTTTTTCCAGTGCACTGACGTTATGCGGTGTGTAAGTAAATGGCTCTGGGTTTGATTGGCGCCCATTAAGCGCTCTCGCTTCG
CAGCTTCTTGCCCATTAAATAACCGATGAAGTGCATCCCGGCAGGAGGTTTAACCCGAAACAACTTGGCACTTGAGCTTTTTATGTTTTTCCATTCGTTATTGCCGTATTTCGAGCGCTT
GTACGTGACTGTACTTTATTGCGCAATAGAAACGGCCAACGGAAACGGGGAGTGAAATTTATAAATATATATATATATATATCCACTGGGGAATGGGGATCACAGACGGCGAAAAGTGCA
TCCACCGCCTTGGCTGCAGCACAATGGCTCATTATAATTTGTGGTTGTCGGCACAAAATGAAGTGCGAAATTTATGCATTATTTTGCTGAATTAAGTGCAAAAATTATAAACTATTATGT
GCGGCGGGGGCACGCACAAATGGCGCGCTGTGGCTTTAAAAATGTGCACTGCGGCTTAGGGGGTATCACGGGGTATGCGGGGCACACGGGTACCACCAGGCGGATGAACTGTTTAAGCAG
TCAGGCATGGCGCCTGGTCAGCATAATTAACCCACCAAACGCATAAACAGACACACGGGCAAACACTCAACCAAATACAAACACACACACTCGTACACAAGTAAATATGGCGGCCACGCC
GAAAAGTATGCAGCAGAAATTTCATATTTTATATTACGCATACGCCCCATGGGCATTGACCAACGCACAGTGGTGTTAGCAACGGCAACACGTGCAGATTGTGCTCAATAAGATATGTTT
AAAATGCAGCTTCTAAGCACTGTGTATCATAAATATAGTTTGTTGTTGGACATATAAGATTTGCTTTTCAAATGTATATATTAGCTGGCATATCAGATTTTAAACATGAATTCCCACTGC
GCAGCGCTTAAAGCGGGTCAAAAGGCGGGGGGTTTTTGGGGAGTGGACTTTTGGTGTTGCTGCGGCAACAAAAGACTCATAGAAACCGAACCGAAAAGCCAGGCCTCGCTTTAGTCGCTT
GTTGCTGCCATTTGGAGCAGTAAAATTGGAGCTCGAAAATCACTCATTCGCCCCGTTGCACCGCTTGCCACTCTTGCAGAACTGCCCGAAATTTTAACAGCACCGCAAAGCCAAACAATC
AAACTTGGCAAGGCCTTTGTGCTGGAGTGTGATGCCGATGGCAACCCGCTGCCCACCATCGACTGGCAGTTCAATGGCGTTCCCCTGCCCGGAAATACGCCCGACTTGCAATTGGAGAAC
GAGAACACCGAGCTGCTGGTGGGTGCCGCACGGCATGAGCATGCCG
GTAAGTAGGAGAAGTGATTGCCAAAACGGTTTACATTGCATTTTCATTCGATACCTTGGACATAATACCGTGAA
TCCTGCCCCCCTCCATCGCAGGTGTCTATCGCTGCACGGCGCGCAACGAAAATGGAGAGACGAGCATGGAGGCCACCATCAAGGTGGAACGGTCGCAGTCGCCACCGCAACTCGCCATCG
AGCCAAGCAATTTGGTGGCCATTACGGGCACCACCATTGAGCTGCCCTGCCAGGCCGACCAGCCGGAGGATGGACTGCAG
GTAAACTCACTTACCGGGATTGGCCACGGAATCGGAAACT
TTTTATTTACCCGCCACTTGTTGACGTTCCCTTTTGGCCTCATTTTCCGCTTGGCCACCGGAAAAAATGAACCCAAAAATTGCATACATTTAAAGTTTGCTTTTGAAGAAAGTAGAAATT
GTAATATAGACAACTTTACACATTATTTAAACACACGCGTTGTGTTTTTCTTACAGAATAACATATTTTTAATGGAAATTATAATATAAAATATTATTATATTTTTTTCACTGCAACTCC
TCAGATTACGTGGCGCCACGATGGGCGACTCATTGATCCGAATGTGCAGCTGGCGGAGAAATATCAAATAAGCGGCGCCGGCAGTCTGTTCGTCAAGAATGTGACCATCCCGGATGGCGG
ACGCTACGAGTGTCAGCTGAAGAACCAGTTTGGTCGCATTTCCGCCTCCGCACTGGTTACCATCAG
GTGAGCGGAAAGGGGGGGATGCTGAATCAAAATCAAATAGCTCAACTTTGGGCG
ACGACCGCAACTTTAATTGCGCTGTCGGCGTTGAGAGGAGGGTGGATTGCATAAAACTCCATTAAAATCAAAGGGAAAACTTTTGCTCAAAGGCGAAAGAACTGTGGGTAGCTGGCAAGA
AAAGGCCTCTGCCAACAGAGGATGCACTTAAAATGCGTTTAAGTGCGCGGTAAAGTTGCTTAATTAATTGAAAAACAGTTGGTCTGCAGAAAAACTGCACATTAACTTAACGACGCTGCG
ATGCCGGAAAGAAGTTGTCGTATATCTTGACATTTTTATATAAAGACCTAAAGTCATTTTAAAAACCCCGGGGGTAGCGTACATCATTATGTACTTCAAATTGTGTTTAATGAAATCAAA
ATGCTTTACAATTATTGCCAGCAGACTTGAACCTTGCACGGCTGAAATGATTTTCGAGTCCTTGCAGAGTTCCAGTGAAGTAAATTGCTTGGAAACCACTGCCGCAAACTATGAAAAGAA
CATAAAACCATAAAGTAAAGCTGCTGGCTAAACTACAGCACAGTGGCCAGAAAACGAGGAAAAATTCTGGGAAAATCTAGGGGATAAACATCAAACTGCGACTGGCTGTTATCAAAAGCA
GTTAGCAGCTGGGCAAACTTGCTAATCCTCTCCAAGTTGCCAAGGCACTGGGATCCACTGTGTTGTCAGCTAAACTGCAAATAAAATATGCGCCGAGGCTCCAGCAAGTGCAACATGAAC
ATCAAAAGGCGGCGAAAGAAAGCACAAAAGTTGTCGCCGCCATCGCCAGTTGCCAGTTGCCAGTTACCAGCTACCAACTACCAGCTACCAGTTACCAGTTTTCAGTTACCAGCTTTCTGT
TGCCAGTTGCCAAACTGGAAAACGTGCTAAGCCCGGAAAAGCTACGTGCCACACTCACACTTACATCGGTCGGGGAAAATGGCAAAAGACACAGGCAGTGGAAATTCCTCACTGAGGCAA
CCGCACAAGTTATCCAAATTGCCCAAATTGAAATTGAGTTGACAAGTTGCTGGCTGCGACAAGAAAAAGAAGGGCTACACACTAAATAAAATGTATGTCTTCTTTGAAGGGAAATTTAAT
GCGGAATTATTAACTATTACCTCAGAATATTACTTTCTTTTAAAGCTGGATTTAGATTACTTAGCAAACAAATACAAATAGGTTTCCTTCGAACAATTGTAATGCATGAACCTAAATATC
TATAAATCGAACAATTTATCTGCACCTAAAACTCAGCTACTTCTAATTGCAATTGCCTATGAATTTTGGTTATTTTTCTAAAGGTGCACAGAAACTGAAACTAGCGCCCATCTTGTACCT
CAACTTTTACACTCCACTTGCGGCCTTAGAAGTTTTCAAATTGTTTGTACCGAAAAAAAGCGACACGACGTGAATTTATTGAGCAAATGGTCTCTGCATCATCCGCCACAAGCCGTAAAT
CAATTTGAGGCGACAAAAACGGAGTCGTGGAGGATGCGGACTTGGCCATTAACCACCGACTGGCGAACTGGAGACCAATGATGGGCCACAAAAGAACCGCCGGAGCGGCTTACTTTCTGC
TTACACAGCCATTTTCCCTGATGCATAATGCAGCAGAAAAGCGGGTGGATTTCCATGTGTGGCACCCACGGAGCATTTAGTGCCAGGAATGGGGGGCACGGAAGCTGAATCGGCTTACAG
TTCTGTGCCGGCAGCATTAGAAACTTTACTCATTACGCCGGGTTTTCCCAGTTTTCCCCGTTTTCCAGTCGCCCACTCGCCCAGACCGCAGCAAAGCAGCGGGGGCGGCAAATTATAAAG
AAAAAATCCAGAAAATGGGTGCGAGAAAGCCGGGCGCCAAAAGTGAAAAACTATGTTGGAAGAATGCAGGAGTCGCAGGAGCAGCCATCCTGCCCCTTGAAGAGTGTGAGTGAAAACCGC
TGAAAGACCCCGACGAAACCAGTGCAACAAAAATGGCAAAAATAAAAAAAAAACAAGAGAGAACGCTATAGTCGAGTTCCCCGACTATCTGATACCCGTTACTCAGCTAGTGGAAGGGAG
AAGGAGAATCTTAAACACAGTTTTTGCCGGTTTGTAGGCGTTATAGTGGGCGTGGCAGAAAGTTTTTTGGCAAATCGATAGAAGTTTACAAGACCAATACAAAAATGAAAAAATATCAAA
ACATTTTTCAAAAGTGTGGGCGTAGCAGCTTTGGGCGGTTTGTGGGCGTTAGAGTGGGCGTGGCAAAAAGTTTGTTGGCAAATCGATAGAAATTTACAAGACCAATACAAAAATGAAAAA
ATATCAAAACATTTTTCAAAAGTGTGGGCGTGACAGCTTTGGGCGGTTTGTGGGCGTTAGAGTGGGCGTGGCAAAAAGTTTTTTTGNNNNNNNNNNGATAGAAGTTTTACAAGACCAATA
CAAAAATGAAAAAATATCAAAACATTTTTCAAAAGTGTGGGCGTAGCAGCTTTGGGCGGTTTGTGGGCGTTAGAGTGGGCGTGGCAAAAAGTTTGTTGGCAAATCGATAGAAATTTACAA
GACCAATACAAAAATGAAAAAATATCAAAACATTTTTCAAAAGTGTGGGCGTGACAGCTTTGGGCGGTTTGTGGGCGTTAGAGTGGGCGTGGCAAAAAGTTTTTTTGCAAATCGATAGAA
ATTTACAAGACCAATACAAAAATGAAAAAATATTAAAACATTTTCCAAAAATGTGGGCGTGGCAGTTTTGGGCGGTTTGTGGGCGTTAGAGTGGGCGTGGCAACCTGAATCGACAAACTT
GCGCTGCGTCTATGTCCCTGGAGTCTGTATACTTAATCTCAACTTTCTAGCTTTTGTAGTTCCTGAGATCTCGACGTTCATACGGACAGACGGACAGACGGACAGACGGACAGACGGACG
GACAGACGGACATGGCCAGATCGACTCGGCTACTGATCCTGATCAAGAATATATATACTTTATATGGTCGGAAACGCTTCCTTCTGCCTGTTACATACTTTTCAACGAATCTAGTATACC
CTTTTACTCTACGAGTAACGGGTATAAATATACCAAAACACCCAGAAATCCGCCTAAGTTGTGGGTAATGCTGGGCGTAAAACAAAAGCTTATCCTGTTACGGCCACTTTTGTTGTTGCC
GCCCGACTCCTGTGATCCTGCTGCTGGCAAAAAGGCTAACCACGGAAATACATTGCCGTGCGCCACAGCGTGTGGCAAGTGAGGAGTGAGTGAGACGGCAGTTGGGTGCCACAGAGAAAC
TTTACACCAAATGGGGCACTCGCAAGTGCTGACTGCAGGATACCCTTACTATGGAAAAAGGATTTATAATAAATTAATTTCAAAGAGCAAAACTATAGTTCATTTTATAAAGATAGAAAG
TTTTATTTATAAGCAAGGCAATGACTTAAAAATATTAATTTCTTAATGGTATAAACTTAATTATAAACCTGAAAAAATTTAAAAGACTTATATACCACTAAGAGAAATTATTTTTAAAAC
CAGGCTAATTAGTTTTCTGGTAGCCTCGTTGTACTTCTTCCCCTTTTCATTGCACTTTGTGCAAACAATGAATTTGTATTAAACTTAATTGAGTAAACTATTACTGCAAAGAATAAGAAA
CAAGTATAATTAATATCTTTTGCCAGAGATAACGTTCATAATTCTCCAGAGGTAACTCTACCCTACGAACTTTTACACTGTGACTTTTCTACTTTTAAGCACTCTTTGAGGCACCCCGAA
AAGATGCATTATCTGCTGAAATAATTGTCCGAGTGTTGCACAAACTTTTTCCAAAAACTATCAATGTCCAAAATACCGTGGGCAATTGTCAGCTATAGAATAGAACAACGGACACCCCAT
CGAGTGGCCCGGGGAAAAGGACACTGCCAGGAGGGCAGCCACAGAATGGCAGCGTGGAAATATGTAGTTCCTGGCGCCGCAATATCCACTGACTGGAGCCGGAGCACCAGAAACAGGAGC
AGTGGCTGTGGCAGCTGGCAACTGGCAACCGATAGTGGCAGACACTGGTGCAACAGGGTGTATTATGGTCGTTAAGTTATTACCTACAGCAGCGCCACCGCCAGCGGCACACAATGCCAA
AGTTTACACAGTCGAAAGTTTCCTAAAGGAGCATTCCTTGCCAGCAGAATGCCAGGCATGAATTGTTGTTAATGCTGCCCTCCACATCCGCTCCTCCATCTGCTCCTCCATTCAGATTCA
AGAAAGGCGAAAAAAGCAAGGCGCGGATTTTTCCTATGACTTTTCTCCGCTGCAAACAGAATGCAGCATAATTTCGTGAGGCAGAAAAAAAAAGGGGAAAATGGAGTGGCTGGCATTTTT
ATTAGACAACGCGGCCATTTGGGCGACTCCTGCCACTGGCATTATGGTAATTAAAATGTGCAAATTCCCTGCGATATCTTGATTGTTTCCGCGCTTTGTGTTCTTTATGTGCGTGTCAAC
TGTTGCCTCTGGGCATTAAATAAAGATTTATAAGAAAGTAACCCGACAACTTGGGGAGTAATGCACGGTATACCATCTTTTGGGTCACCAAATGCTATGCCCTGGGTCACCAAACTTCCT
TTGCTTATTTAAAGCTATCAGCTTATGTTAACTAATCGCCCTTTGTTTCGTTTCCACATTAGTTTTATAAGAAAATAAGCCGACAACTTGGGGACTTATGCACTGTATGGCGCACAAACC
AAGTCTTGGGGTCACCAACTACTTAGCCTGGGTCACCAAACTTCCTTTGACTATTCAAAACCATCAGCTTATGTTAACTTATCGCCCTTTATTTCGTTTCCACATTAGAAACAACGTGGA
TTTGGCTCCAGGGGATCGGTATGTGCGCATCGCCTTCGCCGAGGCAGCCAAGGAGATTGACCTGGCCATCAACAACACCCTGGACATGCTCTTCTCCAACCGATCCGACAAGGCGCCGCC
CAACTATGGCGAACTGCTGCGCGTCTTCCGCTTCCCCACCGGAGAAGCTAGGCAGCTGGCCCGCGCGGCGGAGATCTACGAGCGGACGCTGGTCAATATACGGAAACACGTCCAGGAGGG
CGACAACCTGACCATGAAGAGCGAGGAGTACGAGTTCCGGGATCTGCTGTCACGCGAGCATTTGCATCTGGTGGCGGAGCTGTCGGGCTGCATGGAACACCGCGAGATGCCCAACTGCAC
GGACATGTGCTTCCACTCGCGGTACAGGAGCATCGATGGCACCTGCAACAACCTGCAGCATCCCACCTGGGGTGCGTCACTCACCGCCTTCCGCAGATTGGCGCCACCGATTTACGAGAA
CGGTTTCAGTATGCCCGTGGGCTGGACGAAGGGCATGTTGTACTCGGGTCATGCCAAGCCCAGTGCGAGATTGGTGTCCACCTCACTGGTGGCCACCAAGGAGATCACACCGGATGCCCG
GATAACACACATGGTGATGCAGTGGGGTCAGTTCCTGGATCACGATCTGGATCATGCCATACCATCCGTGAGTTCGGAAAGCTGGGACGGCATCGATTGCAAGAAGAGCTGCGAGATGGC
ACCACCATGTTATCCCATTGAAGTGCCCCCAAATGATCCGCGCGTCCGAAACCGTCGTTGCATTGATGTGGTGCGTTCCAGCGCCATCTGTGGCTCCGGCATGACCTCCCTCTTCTTCGA
CAGCGTCCAGCATCGCGAGCAGATCAACCAACTGACCTCCTACATAGATGCTTCCCAGATGTATGGCTACAGCACTGCATTCGCCCAGGAGCTGCGCAATCTGACATCCCAGGACGGACT
ACTCCGTGTGGGTGTCCACTTTCCGCGGCAGAAGGACATGCTGCCCTTTGCTGCTCCCCAGGATGGCATGGATTGCCGCAGGAATCTCGACGAGAACACCATGAGCTGCTTTGTTTCGGG
CGATATCCGGGTGAACGAGCAGGTGGGTCTTCTGGCCATGCACACCGTTTGGATGAGGGAGCACAACAGGATCGCCAGCAAACTGAAGCAAATCAATGGCCATTGGGATGGGGACACCTT
GTACCAGGAAGCTCGTAAGATAGTGGGTGCCCAGATGCAGCACATCACCTTCAAGCAGTGGTTGCCCCTGATTATTGGCGAAAGTGGCATGAAGATGATGGGCGAGTACTCGGGTTACAA
TCCCCAAGTGAATCCCAGCATAGCCAACGAGTTTGCCACAGCTGCCCTGCGATTTGGCCACACCATCATCAACCCAATACTCCATCGCTTGAACGAGACCTTCCAGCCGATACCCCAGGG
CCATCTGCTCCTCCACAAGGCCTTCTTTGCTCCCTGGCGTCTGGCCTACGAGGGTGGAGTGGATCCCCTGATGCGCGGCTTCCTGGCCGTGCCCGCCAAGCTAAAGACCCCCGATCAGAA
TCTCAACACTGAGCTCACAGAGAAACTGTTCCAGACGGCCCATGCTGTGGCACTGGATCTGGCTGCCATCAACATTCAGAGGGGCAGGGATCACGGCATGCCCGGCTATAATGTCTACAG
GAAGCTATGCAATCTCACAGTGGCCCAGGACTTTGAGGATCTAGCCGACGAGATCAGCAATGCCGAGATACGCCAGAAGATGAAAGAACTGTATGGGCATCCGGATAACGTGGATGTTTG
GTTGGGCGGCATTCTCGAGGATCAGGTGGAGGGCGGCAAGGTGGGTCCCCTATTCCAGTGCTTGCTGGTGGAACAGTTCCGCAGACTTCGGGATGGCGATCGCCTGTACTACGAGAATCC
CGGTGTCTTCTCACCCGAGCAACTGACCCAAATCAAGCAGGCAAACTTCGGTCGAGTGCTCTGCGATGTGGGTGACAACTTCGACCAGGTCACCGAGAACGTGTTCATCTTGGCCAAGCA
CCAGGGTGGCTACAAGAAGTGCGAAGATATAGCTGGCATTAATTTGTATTTGTGGCAGGAGTGTGGCAGGTGCAACAGTCCACCGGCCATCTTCGATTCGTACATACCGCAAACGTACAC
CAAGCGGAGCAACAGGCAGAAGAGAGATCTCGGCAAGGTGGACGAGGAGGTGGCCACCGCCGAGAGCTATGACAGTCCGCTGGAATCCCTCTACGATGTGAACGAAGAAAGGGTCAGTGG
TCTGGAGGAGCTGATTGGCAGCTTCCAGAAGGAACTGAAAAAGCTGCACAAGAAGCTGCGCAAGCTGGAGGACTCCTGCAATTCCGCCGACGTCGAGCCGGTGGCTCAGGTGGTACAGTT
GGCGGCGGCACCGCCCCAGGTGGTTACGAAGCCCAAGAGGAGCCACTGCGTCGACGACAAGGGCACCACCCGGCTGAACAACGAGGTCTGGTCTCCGGACGTCTGCACCAAGTGCAACTG
CTTCCACGGCCAAGTCAACTGCCTGCGGGAGCGGTGCGGCGAGGTCAGCTGTCCGCCGGGAGTGGACCCACTGACGCCTCCGGAGGCCTGCTGCCCACACTGCCCGATGGTCAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGTTCCGCTGCTGCTGCTGCAGCTGCTCGGCTTGCTGCTCCTCTCCGGCGGAGTCCAGTCCATCTACTGCCCGGCCGGATGCACCTGCTTAGAGCGCACTGTGCGCTGCATCCGC
GCCAAGCTGACCGCTGTGCCCAAACTGCCCCAGGATACCCAAACGCT
AGATTTGCGTTTCAATCACATCGAGGAGCTGCCGGCCAACGCGTTCAGTGGTCTCGCCCAGCTGACTACGCTT
TTCCTGAACGACAACGAGCTGGCTTACCTGCAGGATGGGGCACTCAATGGACTGACGGCGCTGAGGTTCCTCTATCTGAACAATAATCGGCTAAGCCGCTTACCGGCGGCCATCTTCCAG
CGGTTGCCACGCCTGGAGGCGAT
TTTCCTCGAGAACAATGACATTTGGCAGCTGCCCGCCGGCCTCTTTGACAACTTGCCGCGCCTGAACCGCCTGATCATGTACAACAACAAGCTGAGC
CAACTGCCAGTGGACGGATTTAATCGGCTGAACAACCTGAAGCGCCTGCGACTGGACGGCAACAACATCGACTGCAATTGTGGCGTCTACTCGCTCTGGCGCCGCTGGCACCTGGATGTG
CAGCGCCAGCTGGTGTCCATCTCGCTCACCTGCGCTGCTCCTCAGCTGCTCCAGAACCAGGGCTTTTCCAGCCTGGGAGAGCATCACTTCAAATGCG
CAAAGCCGCAGTTCCTGGTGGCA
GCCCAAGATGCCCAAGCCGCTGCCGGCGAGCAGGTGGAGCTGAGCTGCGAGGTCACCGGCCTGCCCCGTCCGCAGATCACGTGGATGCACAACACGCAGGAGGTGGGCCTGGAGGAGCAG
GCGCGGGCAGAGATCCTGCCCAGCGGCAGTCTGCTCATCCGCAGCGTGGAGCCCAGCGACATGGGCATCTACCAGTGCATTGCGCGCAACGAGATGGGCGAACTGCATTCCCAGCCCGTA
CGCCTCGTAGTTAATGGCGGTAACCACCCACTCGATTCGCCCCTCGATGCCCGCAGCAATCAGGTGTGGGCGGATGCCGGAACACCCACGCACGGAGCAACGCCATCGCCATCGTCAACG
CCATTGCCATCGCCACCGCACTTCACCCACCAGCCGCATGACCAAATTGTGGCCCTTCACGGCTCTGGACACGTGCTGCTCGATTGCGCCGCCTCCGGCTGGCCACAGCCGGACATACAA
TGGTTCGTCAATGGCCGCCAACTCTTGCAGTCGACCCCCAGTCTCCAGCTGCAGGCCAATGGCAGCCTCATCCTGCTGCAGCCCACCCAGCTCTCTGCCGGCACGTATCGCTGCGAGGCT
CGCAATTCTTTGGGCAGCGTCCAGGCCACCGCCCGCATCGAAGTGAAGG
AACTGCCCGAAATTTTAACAGCACCGCAAAGCCAAACAATCAAACTTGGCAAGGCCTTTGTGCTGGAGTGT
GATGCCGATGGCAACCCGCTGCCCACCATCGACTGGCAGTTCAATGGCGTTCCCCTGCCCGGAAATACGCCCGACTTGCAATTGGAGAACGAGAACACCGAGCTGCTGGTGGGTGCCGCA
CGGCATGAGCATGCCG
GTGTCTATCGCTGCACGGCGCGCAACGAAAATGGAGAGACGAGCATGGAGGCCACCATCAAGGTGGAACGGTCGCAGTCGCCACCGCAACTCGCCATCGAGCCA
AGCAATTTGGTGGCCATTACGGGCACCACCATTGAGCTGCCCTGCCAGGCCGACCAGCCGGAGGATGGACTGCAG
ATTACGTGGCGCCACGATGGGCGACTCATTGATCCGAATGTGCAG
CTGGCGGAGAAATATCAAATAAGCGGCGCCGGCAGTCTGTTCGTCAAGAATGTGACCATCCCGGATGGCGGACGCTACGAGTGTCAGCTGAAGAACCAGTTTGGTCGCATTTCCGCCTCC
GCACTGGTTACCATCAG
AAACAACGTGGATTTGGCTCCAGGGGATCGGTATGTGCGCATCGCCTTCGCCGAGGCAGCCAAGGAGATTGACCTGGCCATCAACAACACCCTGGACATGCTC
TTCTCCAACCGATCCGACAAGGCGCCGCCCAACTATGGCGAACTGCTGCGCGTCTTCCGCTTCCCCACCGGAGAAGCTAGGCAGCTGGCCCGCGCGGCGGAGATCTACGAGCGGACGCTG
GTCAATATACGGAAACACGTCCAGGAGGGCGACAACCTGACCATGAAGAGCGAGGAGTACGAGTTCCGGGATCTGCTGTCACGCGAGCATTTGCATCTGGTGGCGGAGCTGTCGGGCTGC
ATGGAACACCGCGAGATGCCCAACTGCACGGACATGTGCTTCCACTCGCGGTACAGGAGCATCGATGGCACCTGCAACAACCTGCAGCATCCCACCTGGGGTGCGTCACTCACCGCCTTC
CGCAGATTGGCGCCACCGATTTACGAGAACGGTTTCAGTATGCCCGTGGGCTGGACGAAGGGCATGTTGTACTCGGGTCATGCCAAGCCCAGTGCGAGATTGGTGTCCACCTCACTGGTG
GCCACCAAGGAGATCACACCGGATGCCCGGATAACACACATGGTGATGCAGTGGGGTCAGTTCCTGGATCACGATCTGGATCATGCCATACCATCCGTGAGTTCGGAAAGCTGGGACGGC
ATCGATTGCAAGAAGAGCTGCGAGATGGCACCACCATGTTATCCCATTGAAGTGCCCCCAAATGATCCGCGCGTCCGAAACCGTCGTTGCATTGATGTGGTGCGTTCCAGCGCCATCTGT
GGCTCCGGCATGACCTCCCTCTTCTTCGACAGCGTCCAGCATCGCGAGCAGATCAACCAACTGACCTCCTACATAGATGCTTCCCAGATGTATGGCTACAGCACTGCATTCGCCCAGGAG
CTGCGCAATCTGACATCCCAGGACGGACTACTCCGTGTGGGTGTCCACTTTCCGCGGCAGAAGGACATGCTGCCCTTTGCTGCTCCCCAGGATGGCATGGATTGCCGCAGGAATCTCGAC
GAGAACACCATGAGCTGCTTTGTTTCGGGCGATATCCGGGTGAACGAGCAGGTGGGTCTTCTGGCCATGCACACCGTTTGGATGAGGGAGCACAACAGGATCGCCAGCAAACTGAAGCAA
ATCAATGGCCATTGGGATGGGGACACCTTGTACCAGGAAGCTCGTAAGATAGTGGGTGCCCAGATGCAGCACATCACCTTCAAGCAGTGGTTGCCCCTGATTATTGGCGAAAGTGGCATG
AAGATGATGGGCGAGTACTCGGGTTACAATCCCCAAGTGAATCCCAGCATAGCCAACGAGTTTGCCACAGCTGCCCTGCGATTTGGCCACACCATCATCAACCCAATACTCCATCGCTTG
AACGAGACCTTCCAGCCGATACCCCAGGGCCATCTGCTCCTCCACAAGGCCTTCTTTGCTCCCTGGCGTCTGGCCTACGAGGGTGGAGTGGATCCCCTGATGCGCGGCTTCCTGGCCGTG
CCCGCCAAGCTAAAGACCCCCGATCAGAATCTCAACACTGAGCTCACAGAGAAACTGTTCCAGACGGCCCATGCTGTGGCACTGGATCTGGCTGCCATCAACATTCAGAGGGGCAGGGAT
CACGGCATGCCCGGCTATAATGTCTACAGGAAGCTATGCAATCTCACAGTGGCCCAGGACTTTGAGGATCTAGCCGACGAGATCAGCAATGCCGAGATACGCCAGAAGATGAAAGAACTG
TATGGGCATCCGGATAACGTGGATGTTTGGTTGGGCGGCATTCTCGAGGATCAGGTGGAGGGCGGCAAGGTGGGTCCCCTATTCCAGTGCTTGCTGGTGGAACAGTTCCGCAGACTTCGG
GATGGCGATCGCCTGTACTACGAGAATCCCGGTGTCTTCTCACCCGAGCAACTGACCCAAATCAAGCAGGCAAACTTCGGTCGAGTGCTCTGCGATGTGGGTGACAACTTCGACCAGGTC
ACCGAGAACGTGTTCATCTTGGCCAAGCACCAGGGTGGCTACAAGAAGTGCGAAGATATAGCTGGCATTAATTTGTATTTGTGGCAGGAGTGTGGCAGGTGCAACAGTCCACCGGCCATC
TTCGATTCGTACATACCGCAAACGTACACCAAGCGGAGCAACAGGCAGAAGAGAGATCTCGGCAAGGTGGACGAGGAGGTGGCCACCGCCGAGAGCTATGACAGTCCGCTGGAATCCCTC
TACGATGTGAACGAAGAAAGGGTCAGTGGTCTGGAGGAGCTGATTGGCAGCTTCCAGAAGGAACTGAAAAAGCTGCACAAGAAGCTGCGCAAGCTGGAGGACTCCTGCAATTCCGCCGAC
GTCGAGCCGGTGGCTCAGGTGGTACAGTTGGCGGCGGCACCGCCCCAGGTGGTTACGAAGCCCAAGAGGAGCCACTGCGTCGACGACAAGGGCACCACCCGGCTGAACAACGAGGTCTGG
TCTCCGGACGTCTGCACCAAGTGCAACTGCTTCCACGGCCAAGTCAACTGCCTGCGGGAGCGGTGCGGCGAGGTCAGCTGTCCGCCGGGAGTGGACCCACTGACGCCTCCGGAGGCCTGC
TGCCCACACTGCCCGATGGTCAAGTGA

Retrieve as FASTA