Entry information : IsPxd01
Entry ID 7663
Creation 2010-10-27 (Marcel Zamocky)
Last sequence changes 2016-02-16 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-17 (Achraf Jemmat)
Peroxidase information: IsPxd01
Name IsPxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Arthropoda Arachnida Ixodidae Ixodes
Organism Ixodes scapularis    [TaxId: 6945 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value IsPxd01
start..stop
S start..stop
RnoPxd01 982 0 10..1100 214..1311
TguPxd01 981 0 10..1100 168..1265
MmPxd01 979 0 10..1100 214..1311
AImePxd01 979 0 10..1100 204..1301
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..109 109 N° 2 6065..6182 118 N° 3 11216..11390 175 N° 4 14294..14561 268
N° 5 17674..17790 117 N° 6 18488..18652 165 N° 7 22669..22938 270 N° 8 24614..24886 273
N° 9 26739..26972 234 N° 10 28597..28841 245 N° 11 33353..33759 407 N° 12 36611..37019 409
N° 13 37749..37938 190 N° 14 38452..38569 118 N° 15 48746..48983 238  
join(1..109,6065..6182,11216..11390,14294..14561,17674..17790,18488..18652,22669 ..22938,24614..24886,26739..26972,28597..28841,33353..33759,36611..37019,37749.. 37938,38452..38569,48746..48983)


exon

Literature and cross-references IsPxd01
Literature Caler E., Hannick L.I., Bidwell S. et al. Annotation of Ixodes scapularis. (unpublished since 2008)
Protein ref. UniProtKB:   B7QCX2
DNA ref. GenBank:   DS909780.1 (827430..876412)
Protein sequence: IsPxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1111
PWM (Da):   %s   123599.82  
PI (pH):   %s   6.6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLQEKQTITQATGHCSLPASLAGKPLTSLVESDFACERPSLTEEPYDVEAAFGVKVNFSCKAEGEPRPSITWQHDGDEVSTDQDNRVEILDDGTLVIHSSRIEDIGTYKCRAENAAGHVVSRTAYLRFTSPTLPRIVTKPSDVSVTAGRSVTMRCQAAGRPTPQVTWTRDGLPLFQNPRYHVSRTAGTLIITATDLSDSGKYMCTASSLLGEESAAAVLRVELAPYFIESPREQDVLEGDNVEFICHAGGFPAPQLSWYKDGQRLKADGVHVKNLHGGKVIKLYDVRRQEQGVYTCHAQNSLGYAESHADLLVSSKAMPHLMTAPSNTEADQGSTVEVFCVAEGHPTPTVSWRREGKVIGDTPRRKITRDGSLVVIGLRPEDEGQYECVVENEMGQLVTPFYILVRDTIAEGQPHPGDRYFLSALQEAEESVDKAINSTLQNLLNSSSSGHNHHQLLRIFRYPDSEAQRTARAAEIFERALGLIQEQVSSGAKFNLSQFAFRNLLSPSYLDLLAEKSGCLQHRRIPDCTDDCFHSRYRTYDGTCNNKEHPMWGASLTPFQRLLPAQYENGFNTPIGWTANLPVNGHVLPLARTVSTGLISTQVVEEDSEHSHMLMQWGQFLDHDMDFSVPAISHERFIDTVDCSESCENAMPCFPIEVPADDRRVRGHRCIEFVRSSTACGSGRTSMFYGGLMPREQTNQLTSFIDASNVYGSRPKQAVHLRNLTSDLGLLRVGPRMPSGKFLLPFNDGQPNDCKRNSEVKGYSPLPHFDNQAVKVFTLYGYKHPSCAFPSASPLLVSQETRKIVGAQMQHITYSHWLPKILGPVGMAAMGPYRGYNPETNPSIVNVFATAALRFGHFLINPVLLRLDERFQPVPEGPVPLRRAFFAPHLLLREGGIDPLMRGLFVASAKLRKADQLLNSELTDHLFEPALVVAQDLASFNIQRGRDHGLPGYNRWRQFCNLTKASNFHDLRHEITSDDLREKLERLYKTDNIDTWVGAISEEPVPGSKVGPTLLCLLSGQFARVRDGDRLWYENKGSFTKDQLNELRRASLARVLCDNGDNITRVTEDVFMVPRRQNPAFVNCDTVPSIDLTPWKDDQKGIRQTIPR

Retrieve as FASTA  
Remarks complete from genomic (14 introns), no EST found. Strain="Wikel colony"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCCAAGAGAAGCAGACCATTACGCAGGCTACAGGACACTGCAGCCTTCCGGCGTCTCTCGCTGGGAAACCGCTGACGTCGCTCGTCGAAAGTGACTTCGCCTGCGGTAACTGGTCC
CACTTAGTAACATAAGTATGATAGTATTCCGATGACTCGGAAATGGAGCTGGGCGCCGATTGAAAATCTCAAACGGATTAATCGCCACAATTTAATCGATTAATTAATCGGTTAGTCAGT
TCTGTTCATTTCCGCAGATAATATCTTAAACTATATATAAATATATATTCCTATATATATATATATATATCAGGGTGTCGAACTGGAACCGAACAGAACCGAAAACCGGAACTGAACCGG
TATTTTTTCCGGAACTGAACCCGAACCCGAACCGTTATATTGTTATCCCGATGAACCCGAACCGGAACTGAACCGCAAAAAAATAACGGTTACCGGCTCATGTCAAAACGGTTCGGCCAC
GCGCTGTTGACAATGAATGTGCTATCAATGCCATTTGTTTTTTAAGTGCAGTCAACTGACACACACCTCGCTTACATATTTTTCTTCTCCACTCAGTCTTAGGAATATAAACGCTGCATC
CATGAATCTTGAAAAACGCTGCATCCATGTATCTTGACATAGGAACCAGTATTGCGCTGGTCGCGGCTTGCACGGAAAAAAAAAATTGAAAGGCTGTGCAAAAAAAAAAAAAAAAAAATC
ACGTCACGGGATTTCATTTTCCTACAATCTCGTAAATCCTAAATGTTGCTGTGTGCTCATTTCATAACACGTTTCTAGAACGCGCGAGTTCTTGAAGCTTCCTTCTATCGGAATGAGAAA
AGAAAAGGCTGTGGAGTTTGATGATAAGNNNNNNNNNNNNNNNNNNNNTAATTTATTTTGACGTTGCAATTTGTCATTTATAATTTCCGAACCGGTTCGCGAACCGGTTCAGCGCCCCGA
ACCGGTTCGCGAACCGGTTCGCGGATCGAATTAATCGAACCGGAACTGAACCGGAACAAAATAAATTTACCTGAACCTGAACCGTAACCGAACCCGTATTTTTTTCGGTTCGACACACTG
ATATATATATATATATATATATGAATATCTCAATACCTCGCACAGACTTGAGGTGAACGAGACATGTGTAACCTTCTGCACTTGTCTGAAGTTACAGACCTTGCCCCTACAGTTCCCTTT
AGCTGAAAATTTCACCCAGTTTCTCTTTATACTTGTGTTCTCCTCCTTTTTGAGTGGTGAAAGCCTGTAATTTTTACATTATTTTGGTTCGTTAAAATGTTGCGTATTAACTGGCTCAAA
AAATTGACCGCGATTAAAGAAATAATTGATTAATCGGTAGGTTAATCGATCAATCGCCCAGCCCTAGTTCGAAAGTCACGCTCTACAGAGGAGCCTATGTATATACACTCTGAAAGGGAA
GCTGAAGCAATCGATGAATTCGAGCAAACAGTAAAAGTTGTAATGTAAAGATGTATACCCCATAAAAGTTACGTGTACTAAGCCACCTTTCGATCTTATTATTAGGAGCGTCGTAATCAA
TTAAAATATCGATGTACACCCAACCGCTGCGGCGCGCCGAGAGTAGGAAAACGTGAGAGCGGAAAGAAAAGCTATCAAAAGTGACGTCACAAGCGGGGTCAGATGACTCCTGCTCTCCAC
TAAGCTGGTTCGGGGATGCCGACGATTTTGTCACAACGTACCGGACAGATAACAGGCGGCAGAGAGGACGCCACATGCCCGGCGGTAATCGCTGCACATATTATTCTAAATAAATGCGTT
ACTCGTTTATTTCTGCCCAGAAGAAACGTGATATCTGAATTTACGATACCAAAAGCGATATTTTCCCGCCCCTAACTCCGATTTCTTGAAAAGTGCTTCAGCTTTCCTTTAAGGCTTGTT
CACGCACTTTCGTTTGGGAGCGCCCGACCGCGATACGACTCTGCATTACGCTGCAACCCGTTGCCCGGAATTGGAATATGGTGGGGACAGTGTGCAAGTAGCATTTTAGGGCTTCTGGTC
CTGAAATAGACTAAACTTTCCCAACTTTTTGTGGCATAAAATTTACGACGCCCTTGGATACGGTCATTCAGTATTTCAAGCCCATAGTAAAAGAATGATGCGTAAACAAAAATTACAGGA
AGATCAACTCTTGGATACTTCTGGAATATGTTAGCATGTCCCTTGCAAGCGCCGCACACGTTCCTCTATTGGAAACTCTAAAGCTGAACCCTTCACTTGTTTATTTTGGCTTTTTCTTTC
GTTTATTGTATTTTTCGCTGCCTCTTTGTGGCCTCGTTACGTAGCTGGTGTTGCCATTTCCCAAAGGGGGTCGTGTGTTGCGGTTTCCAAGGGTCATCGGATTCCAAAATAACCCACCAA
TGGACCTTCCTGTAAATTTTTTTGGCCCTATTCTGTACTCGGCCTTTCAGGGTGCGTCGACGCCCTTGGATACGGTCATTCATATCACCCGTGGAAGGAACCACATCCATACCACTCATG
TAAAGAACCGCATCCTTCTCACTCGTGGAGTGAACCGCATCCCTCGTTTTAACTATACACACACGTATCCCAGCCCATTCACTGCTGCTACAGGAACCCTGAGCGAAGAAGAACCGTGGA
CGGCAGAGCGGCAGCTCAGCACGTCCGCACTCCACCGCACGGCGGCACAACACCTCTGAGATAACAAAGTCGTAGTGCTGATTGAGATGGCGTCATCGGAGAAGGACAACGCTGGGAACA
AATTGGACACGACGATTGCGTCAACGTTCGGCTCAAACTTGACTCGAAGCCGAGCGATAACGCAGCACTCGTTTCCAATCTGTGTCCAGTGTTTGCCTTCTCTGACTAAGCCATCTCATT
CAGGGCTACGAATTTGTTATCTGCGAGGTGTTGCTTGTCGCCTCCTCCTTTCTGGCTCCGCGCCATCTGTGCGCGTGACTTTGCCGAAAACGAAAGAGCTCGTTTCGACAAAAACCCGGC
AGTGTCTGTCAGTTTGTCAGCGCCGTGGAGAGAGGGAGAGGTGGACGGGCGCGTGCTCGCGTCAGCGCTTCGGACCAATGGGAGCGTCGCACGCAACAACGGACAAACGAAAGACGCCGT
AGGATTTTCGTCAAAATGAACGTTCTAATGCTAACGCTTTAAAAAAAAAAATTAAGCCACCTCGGTGGTTTTGGTACCGACCGCTGTCCTAGGGATCCGAGGAGGGGAATTTGAATCCAG
GCAGTGACGAAGACAACCTGAAGGAGCCTTGTTTGAGAAAAAAAACCTCGTGTAATTAAAATTTCAACTGGGCATAAAGAAAAAAAAGAAAAGAAAGGAAGACGAGTTGTCGAATTGTTT
CTGCTGGGGCGTGCCAGATGCCCTTCGTTCGTCTGGAACGATACCACCCTCAGATTAGAAGTTTGAAGCTTGATGCGCAAAAATTGTGAAATATATACACACACCGCAAGGATTCAAAAG
TTACCTGGTGGATGGCGTCAGTGTACCGGGGCGTTCGAGTCAAGATTGAAGGAAGGGTCCATCTTAAGCCATGGGGAGGGTTTGATATTTAACGGCGGACGCCTCCTTTGGAGATTGGTC
GCAAGTGCGCATGCGCTGCGTTGTCGTCTGCCCAGAAGGAAAGCAGGCTAAAAGGCGTTTGCAGACGATGAACCTTTTCGGCACCTTCTGGTAGCTCGCATTGCCAAACGCAGCCCATAA
ACTACCAAGCCCCGATCGAGCAGTTCGGAACTCTTTGTAATACGGCTCTCCAGTGTTCTTAAAACTCAGACACAAATGTGTGAACGAGCTGCCTTAAATAGAAACTAAGTCAAAATAGGC
AAGTCACACTGGCTTATTGAAACATCAGTTATTGAAAGAAAAAAAGAAACAAAAAAACATGTCAAGGCTGGGGAAGTTGAGTTCTATCTTCAGTACCGCGGTGGGTTTGAGCGAGAGTTC
TGGCGGGATGCATTTGAGAAAACGCTATTTTCCAGCAAGCTGAGTATACATGCTCGGAACTCTAGCCTCAACCCCTGGGAAATGCACTGTTGGGGCATGTTTTGCGCATGCGCGAGCAAC
TTGCGTAGGAGTGATTTTTTTTTGTGTGTGTGGAAACGTTTGGTAAGTCAATCCGCGAAGCACGAGGGAAGACGGGCGGATTACGATGAGAGAAAGACACGTTTTGATTTTACTAAAGAC
TGTAGTGAAAAACTGCCTACACCCGTCCACTTTTATGTAGGACACTGTTAGATCAAATCACATCTACCAATGTAAAAAGATATAGTATACATATATATATATGTTCATTTTAGTTTAAAA
ATATTTTACTTAATTTAAGTACGATATATTTTATTTCAATCAAATTAATTTGGTTTAAATTACTGTAACTACAAAAATATTCATTATTTGCAACTACAGGCATTTTAGACACGGCAGATA
CATTCCTAATCGTTCCTATTAGTAATAACATTAGAGAAAAATTACGGTAAATCTAAGTACAGTTTAATTAACAACATTATGTTGTTCTAATTCTCCCCGAACTAAAAAAGAACTTGATTG
TTTCAATTTAAAGTATTTATTTGATTCTTCTTTCGGCTTCGGGCTTGATCGCAATATAATAATAATTTCCTGATTTTTGACTTTCTTTTTTTTTTTTTTTGTGCGTGTTCACACTCAGAT
CCGACAGGACGTTACGTAGCTGAAGAAAAAGTAGGAGGCAGAAATCAAGCTCAACGCTCTGATTTGCTCAGAAGAGCAGCCCGTTTTATTCGCGTTCAGCCTTATTAAAAGGTTTCTTGG
CTTTGTATTTTTTTTATTTAAATAATATACAAATACTCATAGAAACTACAAAATTAGAAACTAACGGAAATAATAAGTATTTTGCAGGTTATTTTTCGTGAAATTTCTGATTTGAATCAT
GGTTGTAAAACCGGTCTGATTGAAAATACAATTCAAATCAAGATTTAAATGAAGGTTTCAATCAGCTTGATTTTTATTCTACACACCTATTGCCTCTCTACTTAGGGCAGTGAGAAGTTT
TAGTGAAGTTCGAAGGCGGAGACAACGCCTTAACCTTTCTTCGATGTGCAGTTCACGCACTTTGCATGCTCGCGGAATACATTAGTGCCTATCTCTTCCCAGACTTCATTTTTTCAGACG
TTTATATTACTAGTTCCTCTTACACCGAGCTTCCTTTGCATGTTACAGTGATTGCCTCTTAGAGTTTCCTTGCGGCGAACTTGACGCACAGATCTTCTTAAGAGTGCTTCACAGTTTAAG
TGAAAACGAGTTGTAGGATTTACCCGAACTTTCGATGTGCGTGAGATTGCAAAGTTTCACCAGCCCCATACGGAGGCCGTAATTAAAGCGTCATAAAGCATGCATACCCTAACGTATCAA
GGCCCTTCTTCTTAGAAATAAAGGGAGAATAAAATCTTGCCTGGGATACCATCGAATGAAGCATGTCAATGTTATAGCATAAGCATCAATACAACACAATTAAAACTCAGGCCTTACCAA
CTCCTCGACCTCATACATAAAACGTAATCGATATAAACAATAATTATATTTATACTAAACACGACAGTACGGTTGTAAAAACTCCGAATAAACCCCGACCTTGGTTTATACTAAACGGCA
GAAAATATAGTACGTTCACACCAAAATAATAAAACACTGAGATGGACAAAGCACGTATACCCTCAGTTCAGCGTGCGTATTCTAACTAAAAGATTGCAAATAGTTGTTTAATATGACTGT
TCTGGTTTGTTGTTTTCAAACTTTTTATAAACTTTATTTTGTGTTCGAATGTCCTATATATTATGTAATGCAACTCGGGGTCTTTAAGGTATATAAATGAAATGAACTCTGAATAGCTGT
CCTTCGTGGATTTCAGCGCTTTATTATTTCTGTGTGAACTGTAGTTTGTGCAACGCGCTCTCCTACGTATGGAAAAATTTACGGTTTGGAACATTCCTTCGTTTAAGTTTTTTTTTTATT
AAATTGTTGTTTTTTTTTTTTTTTTTTTTGTTTTCTTGCATGCGTTGTTATGTTGTGTGTGCAGAACGGCCCAGCCTGACGGAAGAGCCCTATGACGTGGAAGCTGCTTTTGGTGTCAAG
GTAAACTTCAGCTGCAAGGCCGAGGGCGAGCCACGACCAAGCATCACATGGCAACACGATGG
GTGCGTTTCCTAAAACTAATTTCCTCCTCTTTCATCAAACCTCGCTTTGTCGGCATTT
CTTTTAAGCCTCGTATGTTTCCAGGCGGGAGCGAGCTCCAGTAGCCGAATTTCAAAAGCGGCAATATACGGGCCAACGCACTGCTCACGAACAAGTCAGCGTTTGCTAACATTGGGTGCT
TGGGTGCATTGCCCGTAACCAGATTACCCGGGAGCAAAGCTTTCGCGCATGCGCAGTGACGACAGCAGCGCCACCGCAGTGCAGTGACGCCAAAGAGTTTAGTTGTGTGTACACTAAAGT
TACTGTACTCCAGCAGCAGTCACTGTGATTACTACAGTCACCGACAACCTAAGCGACCCAGGGCGTGTTGAGCCTCAAGATGGCTCAGCTGCGAGTAGGACTGCGGCATGAAAAGGGCTA
GGACAGGCCAAAACTAAAATATGAGATAACTATATTCTGGGACCGATTGCTTGTTCCTATATTGCCGCGCGCCAAGTAGGCAGGGCGGCCGTAGCCTAACGGAATAAAGAAAAAAAAAAA
AAGCGGCCGTAGCCTAACGGTTATCGCGCTTGCCTCGTACGCGAAGGGCCAGGGTTCGATTTCTGGCCGCAAATACGTATTTTTGTTGACACTGTAATGTGATGTTCTGATGAATTCGAG
AACCGTCTAGCTGATTCGAGTTTAGAATGTCCTACGCGTCGAACCTTCTACGTCGAATGCTCCAGAAGCCAACGCCTGTACAAAAGCGGCTCCGCGTGGCGAGCCGGAGTCATTTCCGCC
CCAGCGTTCGACTGTGCGGCTACGCTGACTTCGACGCCCGCGACGCTTTGCTTTCTTCTGTCCCCCTTTTTACTTTTGGGCACAAGTTCGCCCCATTAGACATTTCAGTTTTTTTCCCTA
GTTATTCTTTGTTTCGGCTTGTCATTCGTGACAATATTTCTGCTAGACTTGTTTTTGAAAATGGCACTGTAGTTTCGTGCAAGAAGCGATTCATATGCGGGACACTCGGGCCCGCCCCAT
TCAAAGAGGCCGCCGTGGTTTGCAACCTGGCGACGTCGCCCGCCCATCATGCGGCGTCCTCTTGCACGCACACACAGACTTGGCTCTCTTGACGTCTCGAGCTTCAGCTTCCTCGCATAA
CTTTCGCGATTCTAGCATGCGGTTCTTGACGATTGTATTGTCGGCATCGCTCACTTCGGTGAAGTCTTCGACGGTAAATTTTTTTACAAAAGTTAGTGGGGAAATTAATTTACCCATAGT
GACGTCACCAGTGACCCTCGTGACGTCACACGTGACGTCATTGTGGGAAAGGTCCCATAATACACCGCGAGGTTACGCCGACGGTAGCGCCGACGCCGTTCAAACCGGAAACGGGCGCCT
AAGAGCTGCGAACTAAAAAATGTAGATTAGGTAACCTTCTGTTCTTAGTACGTTTTATACAAGCACGTGCTGGTAAACTCTTTCGAAATTGAAAGTGGAGAGGGGAGGGGAGGGGTGGGG
GGGTCAAACCGGGTCATAAAAACGCGGTACACAGGAAACAAGGCACTCCCACAGCTCGACAGTCAAAACATCGTAAAACGCGTTTCCATCCTAATTCTTCTGGTACCTTGGTATCTTTCT
TTTTAGTTGTTAAGGAGTAAAAAGAAGTTTTCAACGTTGCTGCAACATAGAAGAGTGACGCACGGCAGACAGAGCGATTTTTTACGCAAAAATCTCAACTCAATCATTTTAGCTCTTTTG
GAAGCATATAATTGACTATAAAAATAGTAATTGAATTACAGCGAACGTTACTGCAAGAAAAAAGTAGTTAAACCGTTAAAAAGTTGCAATAAAATGTAATTGATTAGAAGCAAACACTTA
CTTATAACTCGTCACATACATGTCTGGTAGCCTATGAGCTTTTCATTTCAAGAATAATCTACACCCTTTAAAGACCGACGACCTGTTCGCGTTTTTCTACTCTTCTCCCATTATCTCCTC
TCCCTCCTTCTACCCGGTCCACCGTTGCCTGCTTCCTTCTCCCCCAGGGCGAGAAGGAATTTCGGCCTTGCAAAAGCTCGTGTCTGGTCGTCGACCTTTAAGAAGGCTGGACAAGGAATC
GCGAAGCAAGAACCTAGGACCTAATGAGCCACACACTGCGTTTCTTAAAGGCCGAAGTAGAACCGCGGTTTTCTGCAGGCAAGATAATCCTCTCAGTGCTCCCCTCTCGTGAGCCGCGAA
GGCTTAGGAGAGGGGAAAGGAAATAGGAAAGGAGCAGGTGGCGGAATTGGAAAGAGAGAAGTGTACGTCGGCCTTTAGGAGATAGGTGACTATAATCGTTTTGACAATAAGCGCCGCACG
ACAGGGACAGAAAGTATGAGACACAACAAAAAGTGGTTATAATCTCTTTCATCTGGAAAGGACTATAGTTTTCAACTTTCCAAATTAGGTAAGTTATGCTGCCAAATTAATTCATTTGAA
CTTTACACCAAAGTGTGCCATACTTGGTGCGCTGAGTTCGCGGTCAATGGCCGCCTGGTTCCCGTCGCGTCTCATTAATGTGACACGCTTGACGTATTTGGACGCTTTTTTCTCGATCTG
TCGTTCCTAGTTGAAACTACTCTCGCTATCTCGGTTCCTCTTTTTTCCAACGACTTTAGTACCCTCAGCTCTTCTTCTACTGTCACTTCCGCGTTTTGGGTTCGGAGGAAGTTGGGGTGC
GTGGGATGCGGCAACGTAATCTCTGAGGCGATCGAGAACGCTTCAGAGCGGACAACGAAAGTCGTGAGCCCGGTCTAACGATGTTTGCCCCTATTATAATTCAAATTACATTTTTGTTCC
CAGTCAGGGTGTGATGTTTGGTAAAACAGTGGCATATTCCTCATTTTTTCACTCGAGAAAAATGGAAATAATAGCGCAGAGTTTGGCGGTTCAGTACCTTTGTGTGTTTAAAGACTTCAT
ATAAATTGAAAACTGACAACGGCGTTGTTTATTTGTTGTTGCTGTTTTTAGAAAAAAAAACTGCGGCGAAAGGATGTGCACGGAGTGCTTTATTTTTATGAGAAATAAGTCGCTGCTGTT
TAATTATTTCTGCGTGAAAATTGTATAAAAAATTACATAAAGAGACAATTGAACATTTGTGTAAATTTGTCACCAATATATTTTTTATGAAAGTACATGTTTTAAAGATGTGCCACTCAC
CGACACGGGAGTGACACACCCACAATGCGATATATATCTCACGATCAAAAATCTTGAAGCCTGCTCAAATGGAATGTTAAAAAGAATGGTTTTATACTGGAAATAGTACGCTACCAAGAG
CGAGTTTTCTATCAATATTCGCTTTTAAATTGCCAAAAGTAACAAAATGGCTTGAAGTCAACAGCCTTCACAAATTTCTGTTGACTAATGAAATCTAGAGTTGGTGTTGCTCTCTAAAGT
AGAATGCCTGCTACACATTTAGATTGTGCCTTTTTTCTTTTTTTTTTGCAAATGATACATTATGTTTGACATCACAACTATGCGAATAATGGTCTACCCTACGCGACAAGCAAAATTTCG
GCATGTAATAAAAAAAAGGGGGGGGGGCCTTTTTTCCCGTGTCACGACCACGACGGACTCTGTCAAGGCTATTCGAAGCGGGGCGATGAGTTAAATTTTGAAGGACCGCGCTTTTCCCTG
CGTGTATTATTACATCCCACCCAGACCGAACACGAATGTTCATCGAGTGTGAAACACTTTCTTTTCCTCAAAGCCACTAAACTCACAAGGAACCATTCAGGGACAGAAACCTAAAACTCG
AATAGTGATTCCTTGAAAAAACAACGGCTGAGCCATACACCTTCAGTCCACGCCTCCGGGTCAGGTATTAGCTACTATTGGCGATTTGGAACATCCGCGAAGTCCTCTCAAAGTTACTTA
AAAAGAGGCCGTATTCACAAATCTGCTAGCACATGGAGAGGCACATTTTTTGGAAACGTAGTACAAGTCATGTCTCGTTAATATGGTTCCCGGGTGCCCAACTATATGGGCACGGTTTTT
GGGGACAAAAACAGTGAAAATACGGGCATTTTAGTCCGGTTATTATGGACAACTCACATTACGGACGTTTTGTGTGTGTGTGTGTTAGAATGGATGTGTACATATTAACGGAACATTACT
GTATTGAGCACAGAAGCGAAAGGTATGGCCGAGCCGAAGCACTGTTTGCTCCCTTATTACGGCGGTGGTTAAACATCAAACGTCACGCATCCTCAAGAAGACTTGTACGGTATTCGTCAA
GGAATCACTAGCTTTTTCGAGCAATTTTGTAATCGTTTCATTGCCATATGCAGAAATCACAACATATCTTTGATTACTCTTGACAGTAAAAAAAAAAAAAAAATTACTTGTAATCGTTGC
TATTTATACTCCTCTTCCCAACCTCGCTCCTTTTGTCCGCAACCTTCCTGCCAAGGAACCCTCGAACCGAGTTGTCTGACATGAGGACGCGGCCCACTGAAAATTTTTGATTTAGAAGAG
GAGTAGTTTGTACTACGGTTATCCTAATCTAATCATGAACAGCACGAGAGGAACGTTTTCAACCGGGCAGATAGATAAGCCGTTCTCCAAATCTATAGTGGGAAAACTAACGGTTACTGT
TTGTCAAGTAACGGTCAATTCCTTTTCTTGTTAGGTAGACAAGTAATCTGAATTAATAGTATGTTACCGAGAGTAATAGTAATTATAACTAATTACTTCTTTATTTCTGTTTTAAAAAAG
GTGCCTGAAGTCCTAGAGACTAAAATGATGTAGCACGTGGCGTCACAATGTCACCTGACCCGTGTGTTGGTCGAGCGTGTCACCTTTCTGATGAAACTCAGTCCTATAACAGATTCTGTC
TTAATGAAAGCGATGTTACCCTTAGTTGGTTAGGGATCTTCTCCGACAATCGCCCTGACACGAACGTTCCGGAAATTTTTGGGACATTTGCCAGTTCAGCTGAACAACTCGATAACTTCA
TACGTATCATGTTTCATGCCTAAACGTCTGATTACCGAAACAAAACACTGCGCAGCGACGAAGTGTCGACAGACCAGGACAATCGGGTGGAGATCCTGGACGACGGTACCTTGGTCATCC
ACTCCTCGAGGATTGAAGACATTGGCACGTACAAGTGCAGAGCCGAAAACGCTGCGGGTCACGTGGTGTCCCGAACAGCCTATCTGCGCTTCACGAGCCCTACACTCTCC
GCCGTCGACG
ACAGACAAGGTAAGGTACACATTAGTTTACGCAATGACCTCCGACAGGTGGAACCCTGGATGTTTGTGCGTTTACGACCGGCCGCAGTGGACGCCACGAGCCATCCCAGCCAATCCCAAC
TCTATAAACTAGCACGTGACTACGCTTTCCGTACGTCACTGCTACCAATCTACAAGGTCACGTGCCCCGCTGGCCTCCACCAGAAGGTGGCTACAAAATTGTGAGCTTAAAAAACTCAGC
CTGTGGCTGTTGTGCTCACGATTCTTGCCTTGTGGTTTGATCGTTGGCGTTGTTAACGACGAATGCCCGAATTCCACTTGCTGATGAGCGATAATGAGATGCGGGGGAGTCGCGCGACCC
AACACACCAATTGTTTCTTAAGTTGTCGGGGTCTAGATCAAGTGCTGCTCTGGTATGTGTGTGTGTGTGTGTGTTTCTGTGTGTGCGTGTGCGTGTGTGTGCGTATGTGTGTGTCTGTGT
TTTTTTGTGGCAAGGTGAAAAGCTTTTGCTGCTTTACTGATTAAATCTCAAGTTGGAGTGTCAGTTCTTGTAAAGAGCGAACCGTGCTACCACCTTATCCCACCTAAGAGACGCTTGTTC
CAACTCTTATTCGAGACAGTCTCGGTCACTGCCAAGACAGAACAGCGAGGGATCGCATGAGAGGTGGTCCCTTTCGTTACCGCTCGATCGATGCATTCGGCGATCATATCTTTCACAAGA
CACTTTTTTTAACACACTGACGACAGGAAGATACATTTTTCTTGTTTTCTTGTCTCGTGCTTGGAGAGCAGCCGTCACGTGTTTCCCAGATGCCTGAGCAGTTTGCTCGTGCACAGAATC
TTACGCTTGGTGCAATGCGGAAAAAGACTGATGAAACGAATGACTTGAGGCGCTATATCTTACTCACTTAACTTGTTACTTCATCCGATGAAGCAGCCGACTAATTTACAACTTCTGGAA
CATTAAGCTTATGAAGAGAACAACCCAGCATCTATTTAGTAGACTCAAAAGACTCCTCACGCAAACAAAGAGCGAAAGCGGGGGAGAAAAAAGACTCTACGCATGCCAGATCACAACAAA
TACTGACCAATGAGACGGGCTGCTAGTTTAGAAACTGATATCATTCGATCGACATTCTGTTCAATTGAAGCTACTAAGAACGACCGAGAAAGCTTTTTGATTAATTAAATTAAGCCTTCA
AATTCCTCTAGTGTTCACACACAAACTTGTTTCGACTTAAAAACTTGCTTCAAAGATTCGTACATTCCCATTATTCGAGTATTTCGGTGAATGCACCATAATGTAAACGAGATCTAACTG
GATATATTCGCGCCGATTTTTTCAGCGTCACCAATGTATCGGTTCGGTTTGTGTGACTCATTCTTCAACATAACTATGCACATCCTTGCTCTGATGAATGAGACCACATTTTCAACAACT
ATCAATAACCAGCTTGTTTTCGCAAGCTGTTAGGAGGCGATGTGCGCGTCAAACCAGTTCATAGCGTTATCGGCGTGTAGTATTCTAGAACGGAGACTTGACGTGCTCCGGCGCGAGCCA
TTCCCAGTTCAGGACCACCATCGGAGTCGTTCGTCAAAATCGGCCGACATAGTCCAAGAATGTACGGTGGTTCAGATTTATACAAACAACGAAATGTTCCGCTACGTGAATGCGGAACCC
TTTCAACAATGTTGGACTCACTACAAAGGGCACATTCCTACTTCTTTTTCGTATGTTTTGTTTCTACGCTACTCTTGACCCCCAACGAACGACTGATCCCGTTCCTCGATCAGGGAACCT
CGACACCCGGGCCCGGCTCCTGCTATACTCTTACTTCCTTGTGTCTTTTCCTCTCGTATTATGTTACCGGACCCAACGAACTCCTCGAGAGTCAATTACGATACATGTTACCGCGAGACA
CGCATTGGGCGGGTGGGGGGCTTCATTGAAATATCAACCACGCCCACAAGACTCTTACTGCCCCGTGTTCTTGCTTCTTCCATTCTGTTACCTGACCCTGCGAACCTCGAGAGAGTCAAT
TAAGATACATGTTACCCCAAGATACGCATCAACAAGGAAGGGGGTTCATTGAAAGCCGCCCACACTGACCGCGGTAGCAGCTACACCCCCTTTTCACCTTACGATGGACCACAGCGGACT
CTACGCTCCATTCTAACTAACCCAGGCCTGCGAACGTACCGCGTGACCACGTGATACGTTCACAGAGGCCATCACAAAGTCACGTCACATGACTAGGCTAGGTAGTGACGTGAAACTCAC
GCAGCATTGAATTGTCTTCGGTGGTTCTTTACAGCGTTGCCAGCGGTCCATCGTTAGGTGAAACGGTGTATAATTCCCGTTAACCCTAAGCTGACAGTACTGTAATGGCGGCCACGCGCT
CCCCGAGCCAATCAACCCCCTCCCTTTCATCAGCTGACCCTGCTCTCTGTGCGTGTACATGGGCCCCAGACGTGATCACGCGTCAAAAGAGCGCCATATGACTGGTCCAAGAAGTATACA
TAGCCTCCACCGCACTGTCAGCTTATTAGGGCGAAATACGGTATAGAAACCACATACTGCGCATTGTTCTCCGTTTCACCTTACGATGGACCGCAGTGGATGCTATGAGCTATCCTAGCC
GCACCGGCGCTGAGAACACGTCACGTGACCACAAACGTCGCTGCGCCCCCGTCGGAACCCACGTGACGCTCACGCGACTGTTGACTGGCTTCGGTGGATCCTGCAGCGTCCCCTGCAGTT
CATCGCAAGGTGGAAAAAAACGTAGCGAAGTGCGGTAATCGTCCATTGTGTTCTAGAACGCTCACGAAGGACGTTCCTTCCCGCGCGGGTCGTCCCTACCCTGCTATACCGCACCCCTTT
TGCAGCCCAGAAGCCCCGCATCGTCACGAAGCCGTCCGACGTGTCGGTCACGGCAGGCCGCAGCGTCACGATGCGATGCCAGGCCGCGGGCAGGCCGACTCCGCAGGTGACGTGGACGCG
CGACGGGCTTCCGCTGTTCCAGAACCCCCGGTACCACGTGTCCCGGACGGCCGGCACGCTCATCATCACGGCCACGGACCTGAGCGACTCCGGCAAATACATGTGCACGGCCAGCTCGCT
CCTGGGCGAGGAGAGCGCAGCCGCTGTGCTGCGAGTCGAAC
GTGCGTTGTGGTTCCTCTCTTTAGTTGCATTTTAAGTGCGCGCATCTGAAGGAATAAGATGAGCCGTTCACTTTTCTAG
AAAACATATGTGAGATAACCGTCATGCAGAACGCGGTCACAGCCACACAAGGCGAACAATACAATGACCCCAGTGATTGACAAACTCGCAAAATGATTCTCTTTGAAAAAAAGAAATTCG
ATGTGTGACAAAGAACAAGTGAAACGTCATGCATTCCTTTGAACATGGCGCTTTTGGGATGTGATCTCACTTTTAGCTTCGTTATTCGAAGTATCTATTGTTCGCCGCGTTTGACTGTAT
CGGTGTTCAAAAGGAATTAAACGCACAGACAATACTTAGGTTGTAGTTCCCTCGTTTTACCACCTTATTTTGTCATTGATGTAGTCCGACAATCCCGTCACGCGGTAGTCTGCAATTAAC
TGGTCACCTCTTTTCACGCTGTCTTCTCGCCCTTCTTGAAGGAGTGTGACGCATAGGTCCATGCGTTGTTTGCCTAGGGTGGGAATTTTGAGCAGGACGTACACAGAGGACAGTTTTAAG
CCACTCTAGAAATATCGAAATGAAATAATAACTTAAATAAACAACGGTTCAAGTGACGCCCCACAAATTCGCTTCTGTATGGAAAACGTTATAATACAAAACCTACTACCACAATTAAAA
ACCTTGAGACCAAGAAAACAAAGGGCACACACCACCCTCTGAAAACCAGCACTGCACACAGCAGTTATTTTTTTCTTCACATCATTCTTCTTTTGACATATTTCATCTGTTTCTCGTTGT
TTTTTTTTCTATTGATATTTGTTTAAGCACAAAAGAGCGGTGAATTCATGTTCGGGCAATTCTGAAATTCTGAGAAACCTGAGTGAATGTATCAATTGTTTTCCAGATTGAAAGTAGGCG
ACAGTGTTTAGGAAAAATAATATAAATTTAAAAGGGTAAATAGGGAGACAATTAGGATTACGAGCGACAGAATGAGCGACGGTATGTGTATTGGCATGCACTAATTGACCTTAAACCGCG
ATACTGCATTTTTTTTTTCTCCTCTGTCTGGTTTACGTAGATTGTGACGCGGCCGTTTGTGTATTTTCTGAATGGTGTTTGTCTCTCCGGCACTCGTCAACCGGAAAACTCCTCCAGACC
TTAGTCCGAGTGTTCGAGACTTTCTCGGTGTAGTGGATGTGCCTGCCGCTGAAATGTTTGTTGTACAGATGAAATACGGCAAATAAGAAGACTTCTGTAAAAGTAAATGACAGCGGTATG
CTGTGCTGGTTATGAGACAATGGGGTATATGTCCTCTTTTTATGTTTCCTTTTTTATCGAGGTTCCGAACTATGATTGTGCACCACCTCGCGTGGATTTGACTCTTATTTCCAAACCTAC
TAATCAATATACTGAATATCCATAACCAGAGGTAAAAAAATAATTACAATATTTTTTATGTGCATTATTTTTGCAAGTTGGACTGTGCTTTACTTTCTGTACAGCTAATGTTCAGATTCC
GCAGTTTACTTACTCACTTGTTCGCCTAACGCTGTTCATAGCACTCCATGTGTCGCCCTCAGTCGCGGATCGGATTGGCATATTGCCCAAGAACGTCGCGAGTTGCATCATCGCATTACG
CAAGATGTGGCTCATGAAATCCTCTCTTAGGCAAACACATATATCATCTTTACACGACTCGACAACAGACGCGACCGCAAAACCGAATCTACGCAAAAATCGCTGCTGCTTGCGCGGGCA
CCCTTCAGCGCAGTCACTTTTTTTTGGTCCGCGCTTTGTTTTCGTCTTTGTCTGCCACTGCTGAGTCAAAGGGAAACCCAGCCTTGTACCGGCAGACGAGAGTTCCCTCGTCCGATGGTT
TCCTTCTTTTCTCTTGAGCGTGCGCGTGAGTTCGCTCGAGCTTCCGAAACCCCGTCCGATAAAACGGGACTCTTTCGCGCTTCGCTGCTCTCTGCACCGTTAAGTCACGGCGGTCGTGGT
CACCCAGCATCGAAGCACGACGAAAGCCCCGACGAACCGCATTTGACCGCGTCCGGGTTTTTACCCGATTCCACGGGGCGCTGAACTCGGATATCTGGCTCAATCGGCAAAAGGTTTCAG
ACTTACTTTAATTTACATTGTTTAAGCGTGCGCTTTCTTTTCTTTTTTTTTCAAACAATCTTCACATTTGTTTTTAAATATCTTCCTAACGTGTTATTCTTAACACTAGTTCGCGTGCTA
TAGATGTATATAATTTGGAATTTGTTTAACGGTGGGGGCAATCTAAAGCGCCGGATTATACAAGTAGTATAGTCCACCTTAATATTGTAGGCCTATACAAGGATTGGTTTTCCAAGGTCG
TCCACGTATGACGAAATGTCAAGCATTTTGTGAATAAGAGGTTATTATATTGATGTTTTAGGTACGATTCATGTTTATTTCTGTACTAATAAAGCAGGTATTTTTTCTAACGCGCTGTGC
ATTATACTTTTACGTGCAAGATGTCCACCTGGTCTGGACTGTACACCGAGCATGGACTATGCACCATGTGCGGACTACATTCAAGGAAGTACGCTAATTGTACGAAGGATTTTATTCGCG
AAACTTCCGACAAGTTCCCCGTCGCAAGTTGCGAATGAGTTAGAAGGAAGCGCGTAGCAATTCCAGGTAAATTTACGCGTTTCTAGATATATGTTGAGTTCACACAGATTAATGAATCTC
CTACTTGGCTTCCGTGGAAGAACCGATTGTAAACAAAACCAATAGAAACCATGCATATAGTACAAATTAGACAAATGTTAAAATCCCTTGTATGCATAAGCGACTAAATCACATAGATTA
CATTTGTACCTAAATAAAGCTTCTAGAGCAAGGCTATTTTCTATGAAATAAGTCTACACCATAAAAAAAATTAAAAGTCTTCAACCCATATTTTTACTTAAATGCTTCATGATCCCGCTT
TACTACTGTAACTGCGTAATGTAATGGTGACGTCCCTTCATCACTCTACATGTATGGACATCCTAAAGTGTGGTCCTTCTTTGGGCCGCCTCTCGACTGTGCAACACTGATTCTCTCGGC
TTCATAAAACTGTTCCTTGTGTTCCTTGTTTAGTCGCACCATACTTTATTGAGTCCCCGAGAGAGCAAGACGTCCTAGAAGGAGACAACGTTGAGTTCATCTGTCACGCCGGAGGTTTTC
CAGCGCCACAACTCTCATGGTACAAAGACG
GTAAGCCATTATTCTTGACATAGGCCATTTTCGATATTTTTGTCACTTGTTACCTGGAAATGCCAAAAGAAGCTGTATGGACATTTACAA
AAGACAACTCTTTCATATGTGAACTTACTTTGAGTTAAACGTGTTGATACTGAAAAAAAGTAAAACCCCACAGTTTAAAACAGCATCAATAATCGACAGGTTCAATGACCATAAACGCTT
CGTAAAATGTTTGAAACCTTACTCCGACGCTGTAAAACATCTAAATAAATGGTCCCATTGTGCTTTGTCATGGAGTTTTCTTTTTCATTAGTTTTGATTCGGAAGAATGATATAAAACGT
CCAAAAGTAACTCACATTAGGAAGAAGTTGTCACGTCCCTTTCGATAAATGCTCTCAGTTATATTTTATGTGCGTTTATCCTTTTACGATTCGTCACGCTCTTTGCACTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGTAACATAAGATATGTCGGTATTTTTGCGGAAACCGGGGAACTACAAGCTGTCAGACTATTACGATTT
TTTTTAGGTCAGCGCCTGAAAGCTGATGGAGTGCATGTAAAGAACCTGCACGGCGGTAAAGTCATCAAGTTATACGATGTGCGACGGCAGGAACAAGGTGTCTACACGTGCCACGCCCAG
AACTCCCTTGGATATGCTGAATCTCATGCGGACCTTCTGGTCAGCTCTAAAG
GTGAGCACTCTTACATCCGTATGTGCAACCCAGATACTTTACCAGGGATAATTAATTCCACTCCACTC
ATTGGTTTTAGGTAACCTACCCATAGAGCCAAATCCTCCCCTAACGGTATGGGCAATGGACATTCGAGTGGACCAAGGAGGTTAGGAGCTTGGAGCGATAAACTGGCATCCCGTTCACCA
GATAAAAGTGACCCGCACTTGGCTGCCTCCATGTTGTACAATTTTGACCACCATACACGTGACCGTACCAAATCCTGAGGCTTTTATACAATATAGAGTCGAGATCTGTATTGCGATCGC
TGTAAAAAGCACGATAAACTATTTTTCAATACTGTTAGCCACAGAGATCAGTGTCTAGCTCCGATTAACACACGAAACACACCACCGCGGCTTGTGGCATCTAGCGGAGGCATTGTGAAG
CTGCACGAGTGTTTGTCGGAAAAGCACATTTTGAATTTAAAACAAATAAAACATATCTTATCTCGTCGGTACTGTTATTAAAGATCAATAAGCAATTATTTGTGGGCGGTACTTGGTTAA
ACTCTGGACGTAAAACTATAAGGCCACGTCTTTAGCGGTGAAAACAGTGCAACATGGCGGCGGCCAATTGGGGGTCACTTCCAGCTGCCAGTTCTTCGCTCTAAGGCCCTCTACCCTTTT
GGAGTTAACGCATGTGCGTAGAACTGCGCGTGACGTCGCACTGCCGCAAGGTGCTGAGAGAGCTACCACCAGTGCAGCGAGATCACTGGCTTGCCAAGACATTCTGGAACGGATGGCTGT
ACTGTCAACACCTCGTTCCCCCTTAATTCCGGACGCAACCGACGCTATGAGCTAAATGGACCAATTAGAATTCGTCAAAAGCGCACTATCGTGGTATTCTTTATATATCTGTGCGAATTC
TATAATCGCTAAACCAGTCAGGCACAAAAAGGCCCAGTGATAACTGGTGCTTTTGTCTCTTCTCAATTGGGCCCATTTGCTCGTAGCTGAAACGAAGTATAGTGCTCGAATACCCACGAC
GATAGATGGCACCCACCACCTTTCCCGATTCATAAGGGTTCGGAGCATCTAGCGGTTTCACGTTCAACTACGCAAAGCCGGTCAGCACAAGGCCACTGGAGTTACCAAAAGCAGTACAAG
CTCCTCGTACAAAGCCTTCCATTATTTCTGCTTTTTCAGAGCGAACACTGTAGAGGAAGCGACTGCTGGTGGACTCGTCATCTATCTGTTCGCTCCGCTAAACTAGAGAGTGTGTTAGGC
GTTGGTGTAGAGCTTGCCCCGTTTCTATTTTTATCCCCAACAGAGTATAGTGGAACCTTTTGGTTTACCTGCAAGCGTATATGGGGCGAAGAGAGACGTCACTGTGAGAAGTCATGCGGT
CAGAGCTGCTGATAGAGCGAACGCGTGTTTGCGATAGACCCTTTTTGAAAAGTCAGGAAACAACATTGGCGGTTTCCATTGCTTGGGCACGAACCCTGTGATTGGTCCCGAGTCCTCTCC
AAACGCTGAGAGAGCGCTCGCGTCCAATACACGTTCACAGTACATGAGCGAGCAATGACGGACAGGCGTTCGCGCGGAGTGTTGAAAAGGGTCTATTGAGGCTGGCGGCGCCATTTAAGA
GCAGTTATCCTTGCCTTCCTTCGCTGGTTGAAATAAATAATAAAACATCAAAGGTTAGAGCATACGCCTGAATTGCACAGCAGCATGCGTACAGGAAATCGCAAGGGTGTAATGCGTGAC
TTTGTTAGGCGAAACAAAGAACCGGTGGAATAATGATAATAATAATAATATTAATCAATTAATCAACTGATCGATCGATCAATCGATCAAACAAACAATCAATTTTATTCGGTGTCCATG
AACAACCATTCGTTCTTGGTGCTGGCACACCCGGCATTCAAACACTTGAACACAGCAGCACACTCACATTAAAAGATAAAACATGAAAATTATAACCATACCCGTTTTCACCTCAAGGAA
AAATCACGTTCTGCGCATTGTTCATACGCGACGCGAAGTAGTTCTTACAAGATTTCGTTGTCGGAGGAAGAGGCGATGCTTTTGGCTTTCGAAACCTCTACGGCTTGATAAGATAACACA
TATCTAATCTAAAATGCAACAATATATATATTAATTGTAAAAATAAATATGGAAATTAGTAATGCTCCGCGAAGAGCAGGACTCCTTTTACTATGGTTCTTGAGGTGAAAACGAGTATAG
ACAAAAACACGCAAATATGAGAATTAGTGACACACAAAATTATAAAGTAAATATTTACGTTGGAGATCCATACGTTGCTGCACAGTGATGATGATGTATATATTCGGGAAAGTACATCAC
GCACAGAGAAGTAAAAAGAAATTTTAAAATTACAAAGTTTCTTCCAAATATGTATGGCCATGTAGCCCTCATGCCATTTGTAATGATTAGAAGGTAGTTCAAAAGCGATCGTAAAATGTC
GGTTACATGAGCTTCAAGAGTAAAACAACGTGTCTTCAAAGTCACAAAAACGAGTAAAAATTCGTTTCCGATTCACTATAAACATTTGTCTGCAATTCAAAAAACACGCCAATTGCGACC
GGCCGCCTTGTTAAAGCTCAGGCCAGACATTAAAAAAAAAATATATAACTCTTGCCGATCCAAGCACGGAAGGAAAGCCGACGGAGCTACGCTTTCATGTAATAATACGTTTATTGCAGT
TTTTTTTTTTAAGCTTACAGTGTATTCGGTCCGACGAAAGCACTTGTCTGCTTATGTGTGAGGAGAGACTTCGCTTGCCGCGACCAACACAGAGAAACAACATGGAATCGGGTGCATGCA
ACTGCATGGGAGTCCGTCCGAGAGCCATTGTCATTGATGGCAATGGCTTTTTGTTTTAGCGAATACCATCACTCTAAAAACCGCACATCAGTTGAACTCCTAGCGGATTATGAACACCGA
ATCACGCAAACAGTAGAAGTATACGACCGAATGGGAGCAGCTCGGAATACGATTAGACCAGAGACACGCGATGCGCAAATGGGAGCGACGTTTTCACTTGCTCAGTGTCGCTCTACACTT
CGCATTTTTCAGACCTCTTTGCCGCGTCATTCGCAGGAATCCCTCTATTGCCCCCAGTCATTTGCCGTCTCCGTGTTCTGCAACAACAACAACAAAACTCGAATACTTTTCTTTGGCATT
TGTTATATACTTCGTCTCATCCTACGATGGACTAAAGGCCAAAGCCCCGGGCCGCCAGGTCCAATCACGTTCCGCGCTAAACTATGACACGCTTAGCGTTGGTTAGGTTGGACGAGTAAT
GCTCTGAATCTAAAACGCTGCGTCATAGGGAGTTTCGTAGATCGTTTTCGGCGTCCCGCAAGGCCCTCGCATCGCTACGATAGCGGGAACTCCACAGTCAAGGCTATGGGCGGCAGGCGC
AGTAGCAACTTCTTCGTTGCGGAAGGCTTAGCGGAGGAGGCAACGCGGTCTACGAAACTCCCTATTTTTATAGCATCGACACTGCAAAGTGCCTGTAAGCCGCGGCTTTCTTTGCAATGT
AAAATCGTTGAGTCACTCATTGCTCGATCCGAACCACTGTCGGCCCATTTCCATCTGTGATCCGAGGCGCGGGCACCGATACGTGCTTCGAAGCAAAATACCACAAAATGTCTAAGTGGC
TCGTGATTGGATCTGGCGGTTCGTAGCTTCTGCCTTTAGTCCATCGCAGGGTGAGACGAAGTATAGTGCTTTCTTTTTTTGAGGCCGGCCTTCCTATCTGGGGAACTCGCCATGGACGTA
TATGTGTCATCAGATATCCGCAAGTGTACACTCAATGGCTGGGCCTTACCGCACATCAGAGGCCTGAAGGCTTCTATACTTCGTTTCATGTTAAGTGGGAGTCCAGCAGGCGGCACGAGC
TGACGGGCTAATGAAGCAGCGCGAATACCGCATCGTCCCGGCGCTCGTCTCATATAGGCCAATATGCCTACATGGTCGGGACTCCTCAAGACCGTCGGTCTCTTACAGCCATGCCACACC
TGATGACGGCTCCTTCAAACACGGAAGCCGACCAGGGCTCCACTGTGGAGGTGTTCTGCGTCGCTGAGGGTCACCCGACGCCCACGGTGTCCTGGCGCAGGGAGGGCAAGGTCATCGGGG
ACACACCGCGCCGCAAGATCACCCGAGACGGGAGCCTCGTGGTCATCGGACTCCGTCCCGAGGACGAGGGGCAGTACGAGTGCGTCGTCGAAAACGAGATGGGTCAACTGGTCACTCCGT
TCTATATCCTCGTCAGAG
GTGAATGTGATTCCTATATACCTGACAAACAAATCGTTTTTTTTAATAGAATGACATTATATTGCAATATTTAAACAAAATTCCTTGCACGAGTGATTTGGG
TAAGTTTGCCTTGACGCGAGACAATATTTAACAAGGACTCGAAAGCGAAGTGGCAACCAAACGGAATACAAAAGATATGCGACAGACAAGACTGTGATCACGTAACGCATACATCTTGCT
GATATTTTTTTCTCTTATTTTTATACTTCGCCTGACTATACAGTGCTTACCAAAGTTCTACGGATCACCCGAACATAATATTTTTTCATACAATGTCGATCCTGGCGGCAGCCGGTCAAC
GGATACGTCACGTGGTAATCAACAAGCCATACCGAAGCGCTACGTGAAGTGCTCAATTTCCTCTAGGATAGTGACTGTCATAAAAACGCACACAGTTCGCGTACACCGAAATAGATTCTT
AAGCCACGCATAGTCTCCTCTGTACCCTCTAAAAATAAAAGCTGTAGCACTTACACCCCTTGCCACATATACGACACCCGAAAACTTCAGTTTGCCGTACAGCGCACTGACATCAAGCTG
ACGGCCCCAACTTTTACGAGAGGCTTGATGACGGTGAGATAAAAGATATGAAACAGCTAAAATAAGCATCAAAGAGTACAGAAAGAAAACACTGAGGTTTGACAGTAGGGCCAATAAATC
CCCTATATTATTTTTACTGTCAGTTACGCTTACGTAAGCTTTTTTAATAAGCTGTACAACTCAGCTATCAAGGCGCTCATGAAAGTTGGTAGCGCCAATACAACGTCAGTGCGCTGTACG
CCCAACTGAAATTTACGGGTGTCGTATATGTGACAAGGGGTGCAAGGGCTAGACACCCTTTTTTGTGTGTGTGTACTCAGAAAGCCTGGCAGTTCGACGGCGGAGCCCTAGAGTGTCCGG
TCGCAGATTTGCAGCGCGAAGATCTGGTAGCACAGAGCATCAAAGAGCCATTTCTCGGGGACCCTCGACGTCAGCGCACAGCTTTTGAAGCGGCGAGGACCCGAAACACACTTCCGGGTT
CTCGCGCATCGCCGCAGCGTCTCGCGGCAGCGGTGAGACGCTGCGCTTCGGAGTCTCACCGCAGCGGGACGCCAATTACGTAATACTGTTGAAATTTGGGCTAGTTGGTGAAACGTGTTT
ACGGGTAAAACAGCGCGAACAAGGACACAGGACAGAGAATTGTACAAGGACGGTGCGTAAAACAGCGCTCCGTCTGTGTAGATCTTCTCTGTCCTGTGTTCTCGTTCGCGCTGTTTTACC
CGTAAACATGCTTCGATACATGCTCCGCTATCTAGGGGCAGCAAGGCACTGATAAAATTGCTGAGTGGAGAGATGGGTTACGAGGGTAGGCACTTGGTATGCACATCGGAGTGTAGCCCG
CACTCTCGCAGCCCCCTCTCTACCCCGTAGTTTCATCAATTCCTAGTTGCCTCTAGGTAGCAGAACATGTACCGAAGGCCACGCGCTCCGTTGTTCGCATTTCATGCGAAGTCGATAGTA
CCTCGATAACACATAACGCACTTCACGTTCACTTCATATGCGACATTAACGTGCGATATGTTCTTACTATGACCACATTTGTCCCGTCGCATTCACATTCTTTTAAAATACCGTCTTTTT
TTTTCATTAACAGACACGATTGCCGAGGGACAACCGCATCCTGGCGATCGGTACTTCTTGTCCGCGCTTCAAGAGGCTGAAGAATCCGTGGACAAGGCCATCAACAGCACGCTCCAGAAC
TTGCTGAACAGCAGCAGCAGCGGTCATAACCACCACCAGCTCCTGCGGATCTTCCGCTACCCGGACTCGGAGGCCCAGCGCACTGCAAGAGCGGCCGAGATCTTCGAGAGAGCCCTCGGT
CTCATCCAGGAACAAGTGTCTTCCGGAGCCAAATTTAACCTTTCTC
GTATGTTTATAACGCACAATGTGGTTTATCAGTCAAATTCTACTAGAAAATAGTCACAAAGTACTCTCACCTCG
ATTTCCCCGCTAAATTTCTCAGGGAAACTGATGTGACATCGCCACGTCATATGTCTTGATTCCCATGATGTCAATTTTTCCGAGATGCTTCCGTGAGTAGGTAGTTTAAGCTGAACTTAT
ATTGTGCTCTTCGATCTCGGTCAATATGATGGAGCTTGTGTGGTTGTTGTTGCTTTCTTGTTTCTTTTAAAGCGATTAGCTTTTTTTAATTTCTTCAGGCTACTTTACGTATATCTCTGG
CCGTTCATTTTCCCCGCTAAATTTAGCCGAAAAAATGGCCTCATCACTTGACGTCACGCGACCTGTACACAAAGTCATCTTTCCCGCTACATATGGTGGGAAAATTGACTTCACACGAAT
GCAACGCCAACCAACTTTCCCGATAGATTTAGCGTGAAAACTGATGTCACCTAATACCAACACCTATTCAGATTCCTCGCCAGATTTAGAGGGAAATTGTCACATGACCGGTGCCGGTTC
TTTCAATAAAGCTAATCAATTAATTAGAAAGCGAAATCGTTGGCTCTGTTAGAATATTGTTACAGTTTTACTCGGATAATATTAGTGGCCTATAGTGAATTTTTATACATTTAATTTATT
TTAATTTTGCTACGCTTTATATTGCGGGCTAAGCTAAGAACCGAACTCATGGGGAAAACAAAAAAATTATATTTTTTTGTGTGTGTCTTCCTGGTGCAGCATTCGGCTCGCATAGACGAA
CGCTGCGTCACAGCTCGACTGCAGCTCGTGCTTAATCAGTGAAGCACCAATAGAACACAATTCCCAATCTGACGCTATACACTCTAAAAAAAAAAAAAAGGTGTCGTCTTACACTCTTTT
GTCCAATATAATACACCCCAATATTTCAGTTCGACGTACAGCGTACTGGCGTCGAACACACGGCCCAACTTTTACAAGGGGGTTGATTATTAAGCAGCTAAAGCACGTATCAAAGACTAC
AACTACAAAATAAAAAAAACACTGAGGTTCTTCAGTAGGGTTCACACAACCCGTGTTATTATTTTTTTAGTTAGTAACAGGTATTTTGTCGGCTATCTAGCCGCTCGTGAAAGTTGATAT
ATACAGTCAGTTTGGCGTCAGTGCGCTTTACGTGGAACTGAAGTTTCGGGGTGTATTATATGGGACAAAAGAATGTAAAACCACACTCTTTGTTTTTAGAGAGTAGCAGCACGTGCCCCA
GCTGTGCCCGACACTCGATCGATGAATATGACGCAAAGAATCCACACTACCGGCCTTGTGTTAAGACCGAGCACCGTGAAACACAACCTAGAAAAAGCACTGCTTGTAGTGAGATATCCT
TTGCAATAGAATGGGGCCAGCAGCAATTCTAAATTATCTTACAATGCGCAGATATAAGGCCATTTCAACGGATCCGAAGAGCGAATCTCGCTTTTGATTCCAGTTTCTTTCAGGCAGACA
TAATTAGAATTTCTTTAGGAGTAGATATTTTCTCTTCTTTTCAAGGAGTGCTATTGTAAGTAATGAGGACTTCAGCCTTCTTTAAGAAGCTAGGTCTTTAAATGACATCTGCCGCTTTGG
TACTCCTAGGAGGTTTTTTCTTGAGGTCTTTCTAGCACCTTCTGTTAACTTTATGTTTTTCGTCCAACTATGGCAATTCAATGGCTTGCCTTTTGTAAGACTGTCAAACTATCTTACTCT
TTCTTTATCACTCTTACTGCATAGTTCAATCTATCAAATGGGCTCTGGCAGAGTTCCGTTCACTGGTGTCTCTCCATCCACTTTTCGATTCAATGAAGAGTTCGCTTTCCGGAACCTCCT
GTCTCCGTCGTATCTGGACTTGCTGGCGGAGAAGTCGGGATGCCTCCAGCACCGCCGGATCCCGGACTGCACGGACGACTGTTTCCACAGCCGCTATCGCACCTACGACGGCACTTGCAA
CAACAAGGAACATCCGATGTGGGGCGCATCGCTGACCCCTTTCCAGAGGCTGCTCCCTGCCCAGTACGAGAACGGTTTCAATACTCCAATCG
GTGAGTGCAACCCAGAGTGCACCGAGCA
TGTAGGTTGTGTGGTTTTCTGCACTTGTTTTTGACAGAATTTTGCGTTATTTTAAGCCTATTGTCGGTCTCCTCCTCTGCCAAGCCCACCCTCGTAGATAACAGATTTTCAGACTACGTG
CGCTAAGCAAATGTATACGTCTAGTCGAAAGTGCATGGTCTTTTGTATGAGTGCTTTCAGCGCAAATTCAACGGTCCACCTGAAAAAGAAAATTAACTTTTCGGTTCCCAAACACATTGC
TTGAATAACAATGTCTAATGGAAAGATAACGCAGTCTTGTTTACAACAATTAGGTCGCGGATAGCCAGGAATGGGCAGTATTTCAAATACAAGTATTTGAAATACGTATTTCAAATACTT
TGTGTATTTTGCATTTGTATTTAATTACAAATTGGGTAATGTATTTGACGTGTGTATATAAATACTAAAACGTGGGTATTTCAAATACAATCGTAATTAAATACAATTTTGTAGGCGAAA
ATACATCCCTCAAATTTATTGTCACTGTCCATAGCAGGAAGAACACTACGTTCCGCACCGAATGCAGTGTCTCTCAATCAAGCACAAGCGTTTAGTGACTTTGCGGTTACGTTGCTAGTC
CAGGGCAAGAATAGACGAATAGGTTCACCGGCAGACTGGCTAAATAAGTGCCTGTGACAACTTGTGATGCTTTCCAGCCTGATTTCCATCCATATTTTTGCCTGGAACATCCTAAATGCG
AGGGTCGTCCAGATTTTCGTGAATGGTGCGAGTTGCAACAATAAAAAATTCTCTAGCTAGTGCTGCGCGTCTTGGTCGTCTCGGTTCTTTGTTAGTCTATACCAAAATGTAATCGACAAA
TAAAAGCTGCTTGAAGCTCTGTATTTTTTTCACCTATTACGTCCAAGCTGATAACATTTTTTTTGTGATTATATTTCTATTATGTTGCTAGAGCCTCGCACACTAACTCCCGAGTGTGCG
ATGCAAAATTAAAATGAGATACACAGAAATCCGTTGCAGGTGCCATGAAGTCGCTGACGCAAATTTTGAGGAATCTATTTGAAAAGTATTTGGAGGAGACCAAATACATTTGGTTGTATT
TGTATCTTGTACTTAAATGCTTTTTTGGAAATGTAATTAGATTTGTAATTAAATACATTTTTGACAAAGTATTTTGTATGTTTATTTCAATACATATTTGCATGTATTTTGCCCATCCCT
GCGGATAGCATAGCTTGACTGGGGAATCAAGGTAAAGCAGATGCCGTGCCCTATCTACGACGTATTCTAGAACTGATATACGTAAGTCTCAGTGTTACGCAATTGCGTTGGCACTTGCTT
CCCACCATAGTTCTGTAAAAAAACATAATCACAATGTCCCTTCATACAATACGCCATTTTTTTTTTTACTTATGCCTTTTAACAGCACATGTAATCATGCCAAGTGTGGAAGAACACAGG
GTCTTTCAGTCTGCTCGTACGCCGCCATGCACGTCAAAAGGCCTGAACCGTCAAGCTTTTTACCCCGCGGAGGCTGTCGCTACTAGCATAAAACTCTAAGCTCTGCAGGGTACGAAACAG
GAACTAACAGTAGCGCTTTCTTAACCGCCTCCTCAGGTTGGACAGCAAATCTGCCCGTGAACGGTCATGTGCTTCCGCTGGCCCGCACGGTATCCACGGGGTTGATATCTACTCAAGTCG
TCGAGGAAGACAGCGAGCACTCGCATATGCTGATGCAGTGGGGTCAATTCCTGGACCACGATATGGACTTCTCTGTTCCAGCGATCAGCCACGAACGCTTCATCGACACGGTGGACTGCT
CCGAATCGTGCGAAAATGCCATGCCGTGCTTTCCTATTGAG
GTAAGGCTTATAATTTGCTTGATTCTGAGAGTATTGTGAAGTGTTCTACATACCGAAGTGGCGGCTTAGAGGCAGCTAA
AGTACAATATCTCCTAAAGTGTTTTGGCAGTCGACTGCCAATGAGCGACAACTTACGTGCTTCTTAAGGCGGGAAGACATGTAAAGAAAACACACGAAACTCTATCTAGGAATACGGCAA
ACGATAACGAGCTGGCATCTTCCACTCAGAAATCTTAAATATGATTTTAACTAGAATACACCTTCTATTTATTTGCAGTAAATATTCTGTGCACTCGAAGATAGGATGAAACAATTTTCG
CATATTCCGAATTCTGTGCGATTATCTGTTGTTGTTTTTTTTTTTTTCACACGTGCTTGAGTTATTTTTGTTTATTTTTAAGCCTTTTCGTTCTCCGCAGTCTAACACGATTTGAATTTT
CCTTCTGGGCTAAGGAATGTAATATGAGTTCTGCTTCCGGCCGCGACGTTGATTTCTATTTGCATATAAAAGGGGCCGACGCTTGTTATATGAAGATTTAAATCGTGAAAGTGCAGACTC
ATAGGTAAATCAAGCAAGAAAGCTAAGGGTTGTCAATACATCAAAGTGAAATAAAACAACCAGATAAAAATGAGATGAAGCTTGCAAGAACTTGAGACAGTGATATTTTCCATGTTCTTC
TTCCCTGTTCTGCGAGAACTTTAACCGGGCTCTTGTTACTCCATGTTCGATGTAGACATCTCACTATCCAACGCGCCAACAGGATTGCGTACACAAAGAGACGACCAGCATAAATAGGAA
ACACCAGCTCAAAGGAATCAATTCCCAGACGCAGGCAGTTTCCCTGACAAAGAACGTTCGAAAATATCCAGTTTCAGCTCCTTTATTCAAGTGGATATCGAAATCTTTTCTCTTGGTAAC
AAGGCGAGCCACTGATCGGAATATTCCACAAGCAGCTAATCAAAGATCTTCGAAACACGTGGATCGCCTGTCCAGTTCGCCACTTTGTGTCCATATTTCTTGTCGTTTTCATCGGTAATA
CAAACTTTGGTTGAAAGGCTTCTAGCACAGGTTGAGTTGTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTTTATTTTAGTCTAAAGTCTAAACCCAAGCCTGTCATGACATAGTGCAAGTTCAAATAGTGACTGATTTGCAGATTATTTGTAAAATCATCTACTGTAACT
TGTCTACCCGAAAGAATCTATCCACGGGCACGTGCACGCTCAATTTCGTCACCATCGTGGACGTGGACGTGCGCCTACGGCAAAATTCCTTTTGACGAGACACTTTCTTCATGATGTGCA
CAGTCTTCGAGAAATACCGACACCAGACACACCATTAGATGCTGAAAACCATGACTCCCCCCATTGTGCAGATCACATACAGGAGGGGCTGCCACTGTTTCTCTCAACTCAGTCAAAATT
CAACTTATTTGATACATTTGAAGCTGTGCAGCAGTGAGCGGAGAAACAGTGACCTTCTACGAAAAACGTCGAGAAGACAGTACGGCAAACGGTAATTTTGAACTAACCGGAGAACGGATA
ACTTTATTCATTCACGGACTTGTGCACAGAATGAAGACTTTTCTCCAGGTTTATATTTATTTTACAAGCTCGGCCCCATCTTCAAATTGTGGCCACGAAGACGTCGTCTAGCGGCCTAGC
GTTTGTAAAACTAGTGGGCTGGGCTCTGCGAAGGCAACGGTCCGCGTATGGGCGGACCTTGTCTCGACTGGACTGGGTACTTTAGAGGCTGGTTGTGGATGGGTCTGCGTAGACAAGAGT
GTGAGTTTCCACAATCCTGAGAATAATTGCCACCACCCGGGGGAAAACGGGGTTCGGGAAAATCCCAAGATGACGCATTCTTCACATTACAAAATGAAAGATACTTTTTAAAACAAACTT
GGAACCAAAAAATAAGACATAGAGACACAAAGGGGACTTTAGGAAAGCTTAGTCTATGGCCTTATATCTTCATTGGGTCAGCAGAATTTAGCTTTCTTGGTCGAGGGAGGGCCCGCGCTC
GTTTGTACACGTGTTCAAGTATTTTCAAGCCAGCTTCCTGAAACGGCGATTTTGAAAATTCATGATTGGGAAAACTTGGCTAGACTTGACTGGGAACTTGGCGGTTCGGAGCGAGCTGGC
TTATGGCAAGTGCCTTCCTTTCTCAAAGGAGCGAGGACAAATACGATGGGATGTTTTGATTGATTTTCTACAACGAGAAAGCATATGAGCAGTCGAATGTAGCAAAAGCGCGTTTGCTCT
TGATATCTGGTACCTGTACCTTGAGCGGCAGCAGGTAGGCTCTTTCAAGCCTTTCACCTGCCATGAAAGGATAACGTACCTTGCTGAAATAATTTAGTAGGTGCACCGGCACCGTGTTGG
AATCAGTCCGCTTGTCTTAGACCAAGTAGTCTGAGTCTGCCATGGACGATGAGTCTCGCACAAAGCCCTGGCGATTGACGATTGCTATCGACAACGTCGTAAATCAAGATCCTTGAAGAA
GGTGTGGACAAAACCTCGTGCTGCAGCACTTCAGAATATCTATCGCACAAGTCTCTGCGATTGAGTTTACACTAAATATTTTTATGCGCACAACGACAGCGCTATAATAGTCCGACGACT
GTAGATTTTCGGACATACATGGTGTAATGGTAATAATAAACGTTTGGAACTAGCTCACGCACGTCATTCTCCTCTAAGCCCTTTTGGCGCACCCTTGATGATTGCAATTCCTGTGTCAAC
GTGAAATCAAAAATGCACCGGGTCGATAGTGCGCCATCGGCGCACTGGCTTCAGATGACCCGAAAAAGCCTCCATAAGATCATCTTTGGAAAACCTCGAAACTGAGGAAAACAAAAAAAA
AAAATGGGGACACCACACACAGAGCATCTATAGGTTAGTGACACACGTTACGTTAGCGTATAGCGATGAGCTTGTTAGTCATGGGTTAATATTTTGCTGTTACAATTCCGGATGAGCGTA
TTAGTTTATTCTTAGACTACAGTACATGAAAACACATTTACAGATACCCCCATGTTTTATAATAGTGAAAGAATTGGTCTCTCTGTTGTGTAATTTTTATGCGTTTTTTTTTTGTCTAAG
TTAATTATAATCAATAACCCACTTCCACACATGCATTGAACGTCAGGACAACTATCATACCTGTTTTCCTTTCTCGAAGAAAAAGAAAGTTTCCGTAGAAGTTTTTTGGTGTACTACAAT
TCCTTTTCGCTGCTGTAGAAAGTATCTGGTGGCACTATATACCAAAACAGCATTCTAGGATGTATGCACATTATTAACGCAGTTTTCTGAGGTCAAAATACATTTTATTTAGGACTTAAG
TGTGGCAAATAAGGCACTGGGGAGGTGGGTGACACTCTGTACTATAATTGTGTTATTGGAGGCACCGTTGATTTCTTTGGGCGCATATTGCAAAGCCCACATAAAACAGCATGTAAACAT
GATTTTTTGCACGTGGGGTAGTTTCTATTGTAATTGCGGCTGCAGCATTTGCTTCGGTTCAGTAACCAAGCTATGCATTCTTTCTTTACTTTAATATCTGACACTCGTAAATACAGAAAC
AAAGCCCACTGTATTTCATTGGCCCCACAAAGTTAAAAGCATGTAATCAACGAAGCGTTGACTATACTCCTTTCACCCCTAAGCTGATAGTAGAGTAGAAACTACGTGATTGTTCGACCA
ATCATACGCCCGTCTGTTACGTGATTGCGCTTCCACCTGTGCACACGAGCGACGTCAGGTGAACAAAGGGAGTCCGGTCAATGGAACGGCGATCGCATAACTCCAGGCTCCCTGTCAACC
TAGAAGAGATCGGAGTATAGCTACGACGTAGAATTTAGGGTTTTATATGAGAGACGCTGATAAACATCCATCGATGTCCAAAATACAAAATGGATATTAAACAAAAACAACCGAAAAAAT
AGTGGGTGTTGAAAAATCAATGAAAACCGAAAAACACCAATTCCTGGAAGTTGTTTCTTTAGCTGGATTGTTTTTTTTTTTTTTGTTTTTTTTTTTTTTTTGTCGAAGCTTTTTGTCTTT
AGACTTAATCTCTTAAGTTTTTCCATGACAGGTGCTCAACTGATTAAAACTGTTCCGAGCGCCCGTCCGAAATCTTTAATGCGAAATACACCGATATAAAAACATAAAACGCGCCGAATA
AGCGGCCACAAGTCGACTGTGAAGGTCGAGTTGCGCTCCATTTAGGGTGGAGACCTATGTTTATTCTCACGTAAAAAAACACCAATAAATAAAAAATGAATGAACTCTGAAAAGCATCCA
GCGATATTTCTTTTCTAAATAAACACCGGAAAGTATACGGCCAAAGTCCAGTTCCTCCGCTTCTACGATCGCACGGGCCCGAACTCATTCGGTGGACACCATGTGCATGCAGGTCCCGGC
GGACGACCGGCGAGTCCGCGGCCACCGCTGCATCGAGTTCGTGCGCTCGAGCACCGCCTGCGGCTCCGGTCGCACGTCTATGTTCTACGGCGGCCTGATGCCACGGGAGCAGACGAACCA
GCTGACGTCGTTCATCGACGCTTCCAACGTGTACGGCAGCAGGCCCAAACAGGCGGTCCATCTGCGGAACCTGACCAGCGACCTGGGACTGCTTAGGGTCGGTCCTCGTATGCCCTCCGG
GAAGTTCCTGCTGCCCTTCAACGACGGACAACCGAATGACTGCAAGCGGAATTCCGAGGTGAAGGGCTATTCGCCACTTCCACATTTCGACAACCAGGCAGTGAAAGTTTTCACTTTATA
TGGATACAAACATCCGAGCTGTGCGTTTCCGTCCTTTGC
GTCTGTTCCGCTAGGTGATGCCGCGCATAATCTCTTGGCGCCACTACAGGATTTTTGACAATTTAATGCTGGTGGGCTTGT
GTGCCAAAAATGCACGCAGTTACCAAACATAAATTTATCTAGAAATGTGTCTTAGGTTTCAGCGCCCGTGAAACGAATTTTTCTCTCTGATAAATTAATTTAGATTGGCATTTTACCCAT
AGCATATCGTTTGGTGGACCAAAAGAAAGAAGGTAGGATGTTAAAAGCCTGATTTTCGGCACGAAATTTTGAAAACACAGCAGAATATTTCGCACTCCCTTCCCTTCGTAAAATCTCTGC
CTTTTCACTCACTATGATTCATCAGCGGTACCCAAAGCGCGTCACCGGGCCCAAACGCCGGTCGCACGACACCGGACCTCACTTATTCCCTTCACCCCTAAGCTCACAGTGCGGTGGAAA
CTATATGTGCTTGCCAGACCAATCAGCCGCCTTTCTTTCATCACCTCACCTCGTTATATGCGCGTGGGTATGCCTGAGGGAGCATGATCACGTTGCAAAAACGTGGCTGGCCCAACGAGC
ACGTCGCTTCCACGGCACTGTCAGCTTAGGGGTGAACAGGTTGGGGAAGGCAATTTTTGTTCCAGTTTTGAGCGACGGGCTAATCTTCCAGGAGGAGAATGGCCAGGTCCCGGGTACTCA
AACCAGGGTCCCAGCATGAGGGGAGTCCCTTCTTTCTGTCGTCTTGAACTGTTTGATACAGTGCGCGATTTGTGAGTTTAGGAGGAAAGCTAAGAATGAAAAAGTTGAAAAATCGTATCA
TGACCTTTCAATATCCGAACCTGTTTCTTTTACAGTTTATATTAACACAAACTATAGATTCAGAACGAGTCAAGAGTTTTCTAATACGCCTAGCTTTTTGTGGTGAGTAAAATTTTAATA
GATTTTCTTGAATCCCCAGCCTTTGTGAACCCATGCGCCGCCTTGAAGTCACGCCGCTGCATGCCGCTGCTTTGAGCACGGCGCATGTGCAAACATCTGACCCTAATTCGACTTGTGCAC
ACACGCAAGCGTGGTACTTGGAGCAGGAAACCTTGTTTGTAAACAGCGTGTCTTGATATGGAAGCATTATATCATAAAACGATAACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNATGATCAACATCTTGTATCTACTGTTTACACCGAGCCTACTTATAGTCTTTTGAGGCCTGCAGTTACTTCTTATTGCAATCACCGGGTCAAAGTTTGGTCGA
CGGGCCGCTTTTGTTTGAACGAGCAGACGACAAAAGCAAGCAAGTTTGAAAGACCAGACGAAAGTTCGAACGATCAGGCGGCCGTGTGAATTTGAAGACGCACTGAACCCGTGGGTGGTC
CGGACAACTTGGCGGCTTTCTCTCGTTCATGTTGGAACAAAGCAAATACATCTCGCGACCACAAAGTGTTGCCCTCACACGCAATCGTATTTCGACAGCGTCTGGTTTGCCCCTTTCACA
GCTACTATCCAAGTCCTCGGACGAACGGAGGGGGCAAAAACACATGAAAACTGATCTTCAAACCTTTCCAGACTCTCTTGGTACAGCCCCCATCGCAGCATTTTGACGAGAAGGCAGGTT
TTTTGTCTCGTTTCTTCCAAAGGAACACAGGAATGCATGTCTGGCACGGCGACTTCTACCCACCGCCCCAGACCGGAAGTGCGTCCGGCGCGCCACCACCGCGGCGTCACGTAGGAGAGT
TGAGTTCGTGTATATCCATTGGATTAAGGAATAATATGCACGGATTGAATTGAAGAATAAATTATCATAGTTATATAGCACTTTCAAAAGTGCATAAATATGCACGGATCCATCCCTTAA
ATCCCATTTGAATTTAGAGGGGAATGTTAAAGGCCAAGACTAAAGCCTCGCTGTCTAGCTTCTCGAAAAAAACGCACTACGCTACTGTAATAAACGCATTGTGTATTTACGGCCCTGGCA
TCTGCTTTTCCAAAGACAAATCGGAAATTTAATCATTGATTCCTTCGGATGGAGTTTCGAAAATTGCGAGTGTTACAAGGACATTTTTATTGACGAATGTAGTCTGGCGCTGCTACGCCT
AGCTTGTGTAATTGCTATCAGATGTTCACTCATGGTTCCAATTTTTCTCATTGCAACAGAGCCCATCTTTTAAGATCACAATGATGTCGTTTTTTTTTCGGCCTGTTAATTTACCGTGCA
TCTGTCATCTGTCGTAAACTGCTGTGATTAGCTTTCTCAGTGGTCTCCAAGACCTCCTGGATAACAAAGCCTGACTGCTGGATTTTTTGCGCCACCTACCGGAGGCCAGTGCGGGGGTGG
GGGGGGGGGGGGGGGGGGGCAGATTAGACAGCTGCGTCAGCGTAAAGTGCCGACTCGTGCTGAATGAGGGAGCACACAAGGGCCAGCCGAACGTTGCTGACGCAGCACTTCGATGCAGCA
ACCTTTGGAATGCACTTGCCTCCTGTTTTAGCATGGAAAATCCAACAATAGGGAACTGTAGCAGACCGTTTTTCTCCTCCGCTACGGTATCCCTGAAGAAAACGGCGCAGCTGCGCATGC
GCGCCGCCAGCTTTCTCTGCATAGTTCAAGGTCTTCTGGCGGATTACGGAGCGCTATCCGGGTGCTTAGCGGGCTGCGGAAACGCTCTACTANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCATCCCTTCCGAGCCAGTCAACGTGATTTCAAAATCCTTCTCCTAGTTACTGCGGCTAACTTTAGCCGCGGTTAGCGCTTCGAGCAAACGGGCCCAGG
TGTCGTAAAGGTCCCCTCTTCTTGTCTCTCAGGAAACTCGCAAGATAGTCGGAGCCCAGATGCAGCACATCACGTACTCCCACTGGCTCCCCAAGATCCTGGGACCCGTGGGGATGGCTG
CCATGGGACCGTACCGGGGCTACAACCCCGAGACCAATCCGTCCATCGTGAACGTGTTCGCGACGGCCGCTCTGAGGTTCGGGCACTTCCTTATCAACCCCGTTCTCCTGAGGCTCGACG
AGAGGTTCCAGCCCGTGCCCGAGGGCCCCGTGCCGCTGAGAAGGGCGTTCTTCGCTCCGCATCTCCTGCTGAGAGAAGGGGGAATCGATCCCCTCATGAGGGGCCTCTTTGTGGCCTCTG
CCAAGCTCCGGAAGGCGGACCAGCTGCTCAACTCTGAGCTCACAGATCATCTGTTTGAG
GCAAGTTTATTTTCTTGCTTTTGTGTTAAGCCTGTATCCGAACAAACGGCTTATATACATA
CCACATTACTGTCCCTAAATGAGAGCGTTTGCCCGCCAAAATTGTCGACAGTTGGCGTGCGTAGGAACGGGTTTTAGTTTTGCAGGTAGTGCGGAACGTCAAAGCTTGAATTGTTGTTAA
GACGCCATCAGGAAGTTTTGATGTTTGACCTTGTGAATCGGCACTGAGATCAAATGCTCTGCGTCTGTGTGAGCGCCTTTCGTTCAAGTAAAACAAAAAAAAAGTTTTACTTGAACATTG
CGTTCATTCGCAACTCTAGTGGCGTGTAGTTAAACCCCTTCCCTTTGTTTCACCTAATGCCCTCCAGACGGCTCTGAGTTTAGATGCACACGCGGATAAGCAGAAGATGCCAGCTTCTCT
CCTTTACGCCTTTTCTGGTGAATGGCGTCACGTCCTCCGGAGTTAAATGTATACGTAATTCGGTTTGCAAAAAATGAACATGCATTTATAACTTCAATAAAAAATCAAATTGATTTCCGA
CTGTTTCTGTGGCTTATTATAATACCCTGAAAAGGTGTAATATTACGAAGTCCTTGCCATTTTGGGCTGAAGCATAGAAAGCGCACCGCGAAATACTGAAAGCGGGACACACCAGCGACT
CCGAGTTGAAGGTAAATGAGTCACTCACCACCACCGAGGCACCGATTGAGTCGATCCTCACCTTGCAGCCTGCTCTCGTCGTGGCCCAAGATCTGGCGTCGTTCAACATCCAGCGCGGTC
GCGATCACGGTCTCCCTGGTTACAATCGTTGGCGCCAGTTCTGCAACCTGACAAAGGCGAGCAACTTCCACGACCTCAGGCACGAGATCACAAGCGACGACCTCAGAGAGAAGCTGGAAC
GACTCTACAAGACTCCCG
GTATGCTGCGGACAAAATATAATAGTACAAGAGTGCGGACGTCTCGTGCGCACGCCGTGGTGAATGTAGACTGGACGACTCTGTTAGAGGGAACACGACATC
GATTATCTATTCAGTTATATTGCTTGATAGCTTTGGCAGGTACCACCCTAAGGATCAATTTCGACCACCATGGACTTCCTACGCGTATTGATTTTTAACAAAAAAAAAAAGAAGAACCGG
CGATTGTTTGTTTGTGCTAAAAGTATCATGCAGTGTTCCTTAATTCAAAGGGTTGGTCTCAGCAGTCTAAATCATCTCGTCCTACTTCCTGGCTCATTTTCTAAGCCACGCCATTTACAT
GCCGGGACCCTATTAAATTATTCAATGACGCCCCAGATAAAATACGTTGTTTAGGTTCTGCGCCATTTCCGAGTTAAGATGGAGCCCCTGAAACCAGAAGGTGGCACGTTAGAGGGGGAG
CTATTAACTCTACGCAAGGGGATACGTGTAAACTGTTCTCACTCGATGCAGACAACATTGATACCTGGGTAGGCGCCATCAGCGAAGAGCCAGTGCCGGGTTCCAAGGTGGGACCTACGC
TGCTCTGCCTGCTGAGCGGACAGTTCGCCAGGGTGAGAGACGGTGACAG
GTAAGTGTCTCAGTAATAAGTGAAGTCAGGTGTAGGAGGCAGAGAGACGTATTCGAGTTACAGAAAATTAG
GTTTGTGAGTGATAAACCTATAGTAACACCCATTCGAATGACATCCATAGTAACCCTGAAACGAAGGAACAGACTTTGTTGTTCTACCCATTCGAATGTTCTCAAAAGGCAAACGAGATC
AGATGGGATGGTTCTTTCAGTCATCTAGGAGTTCTTTAAACGTTCTTCCTAACAAATGTTACTGCATTCTTAATTTTATTGATCAATTGTGCAAATAGCAGGCACATAAAATTAGTATAA
TCTAGATGCTTGCCTTGCCGCAATTATGCTGTGACCTTGTTACACGTGCCTGAGTAGGTGCGTTAAAACTTAACATATCGAACTGGCTCAATATTTGTCTGGAGATGTGGTGATCCTTCT
TGCCCAACCCAGGTTATGGTATGAGAACAAAGGATCGTTCACAAAGGACCAACTCAACGAGCTTCGGCGTGCTTCCCTCGCCCGAGTTTTGTGCGACAACGGCGACAACATAACCAGGGT
GACGGAGGACGTGTTTATGGTGCCGCGGCGGCAGAACCCAGCCTTCGTAAACTGCGACACCGTTCCTTCGATCGACTTGACGCCCTGGAAGGACGACCAGAAAGGTATACGGCAAACTAT
TCCGCGATGACTGACCAGTTTTCGAAATGTTCAAAATCCCCAGGTACTTAGCGATTTGTCTTCTGAACTATGTGGGGCCTGGAGGGCGTCTCTAAGTGGAGTGTATATACCGTGTCAGCA
AATGTGGTCCCTTTGTTTTCCGCCCCCTGACGTTGGGGAAATTTTATGCTGTTTAGTGCTGCGATCGTTGCGGTTGCAGAACTGCGGAGGCGAATGTGGCAGACGCCTGTCATGTTGCAG
CACGCTCTGAGCCTGATAGTCCACGGAAGCGTTTTGCAGCTACGAGTTGGGACGCCGCGACGACTACAACACATGCATTCTATCGTCTTTCGTAGCCTCAGTTTAAATGCCAACCGCGAG
GAGTGAGCATTTAACACCCTAACACGTTCCTTTGACGTAATTTGTTGCCACTTTGGGAACACTTTTGAAACAGCTGATGATGCGTTCCAGGGACGATACAACGTTTCCCAATTCCTTTTT
TTTTTTTTTTTTTTTTTTTTTTAGCAAATTAGCGCGGGGGTTTATTTGAACGGCCAAACCCACGCTCGGTGTAGAACCACTTGAAAGGGTTCTCGGAACACCGCAAACAAAACGCGAAAT
TCTGACAACAGGGATCGGCATTTCTGCGATTATGCATCTACGCGAGGAAACTGTGACAGACGGCGAATTGAAGATCCATGGTAAAGTAGTTTAGTTCTGACAGCGGTTCGGAATCTTAAC
TACAATTCGAAAAAGCTGGAAAGCTGGAGTGTCTATTTTCCCCCAGGAAGCTCGCTGAATGAAGGGATTTATATTATATTTAGATATTCAAAGCTTGTTTGCGCTGTAAGACTAAGCATC
GTAAAACGCCCTCCTCAATTTCACAGCAAAAACTGTTTTTTTTTTCTTTCATTTTTTTGTGGGGTTTAAAGGGATATTACAACGAAATTTCGGCCCTTATTTCTTGCTTTATACCTGTTC
AAGAGGGCAGTCTCCCATCGGACACTCTCCATGAAAAGACACGATAAGAAATTTTAGAAGAAATTAAACGATTATCAAAGGACACCTGATGAATGTCGCAGAAGCCTTTTTTGTAATGCC
CGTCAAGGAACCATGACACATAGTGACGATGCCTGTCTCGACTAGAACTATACATGCCTTGAGCCTCACATCATCCCGTGAGCTTTCCTTCCACCACGAGAAAAGAGGAAAAGGAGGAAC
TCTTTTCTCACCGGGACTTTTTTTTTTTTTGTTTGTCCCTAACGCCGCTATCGTTCCAATAACCCGTCACACAAAATTCGCACAAAAGCAACTTTGGGCTTAGTTGCGGTGGCCCGATCG
CTGGCGTGCTTCGGCGGCTTCGTTGGCTGAAATGGCTAGGACATCCCGTCGACGTCAACCTCGCCGCAGCTTTGCTCGTCCTGAGACAATCTACGTCACGTTTGCGCCGGATGTCACGTG
TTCTTCGCTGGCTGCTTGACGTGCGCTCGCCAGAGTGGCCCGTTTATACCGAAAAATACAGCCTTCAGGCTCAAAATACAAACGTGCTATTGTCAATTACGAATATTGCAGATCATATTC
AGCCTATTTGTGAACGCGACGAGTATAATTCAAATTGCGTTAAAGTATCCCTTTAAACATATTTTTGGTTTCCGCTTTAACCGATCTCTCTCCGTACCTCGAGGGAAAGTACATGCTCCA
AAGTTCATTGAGCCATGACAGCGTCGCTCAAAACTGGTCAACGCAGAGTTTATTTTCCGATGCTTCAACCTATTATGTAGTCTTTTTTGAACAAGTAATGCGTAAAACACCGGTCATAAG
AAGCAGTATTAACGTCGTAAACTTACATACAATAGTATCGCAAGCGCTATAAATTCTTCTTGTCTGCCGGAATTAGAGTAATTTTCGCAAAATTCCGACACCATAACGTCTGGTTTCCCG
GTCCTTATACGTAAGCACTTACAGTACCCGTAATACATTCATAAAAAAGAGAAAAAAAAACATAGAACACAATAGCAACGTGAACAGCAAGACATCCAGCCTCAATTTATCAACAAAATT
AGACATCCTTCCTTATCGCAAAAAGCTTTCGGAAACTTTAAAAAGTGCAATTGAAGATGCGCTTGAGGAACGGGAAACGCTTGTAACGGACTCACTTCTTTCACTGCTCTCATTAGAGAA
GCACATTAGAGCCAAGGTGAGAAAAAACCTACCCTCCAGCCAGACCTGAAAATAAAATAAAAGAATAAAATAAGCAAGATATGGTAAAAATGTGAAAGAAAGAGATGAGAGTAGGAAAGG
GAGTGGGATGGTAGCAAAGCAGGAAAACACATCTGGCTATTATGTTTCAGGCCCATCTTGAGCGTCGTCGCTTCTTTTTTTACACCGGCTATACTGTTCACGCTCAGACTCTTCGCTCGA
CAGCTGAGGCAGAAGGGGAATGGAAACGATTTCTCAGTGTATTAGCGGTTTTTTCTTTCCTCGTACTTCTCTTTTCTTTATAAAGTGAGGCGTATTTATAAATATATTTCATTTTTTGCA
TCTGCTTCCGCATTCCCCTAGAAGACGGAGGCGGCTGCCCGGCTGGGAAAACTGCGAGTTTCCGCAACGGTCGTGTTCCTCCACGTCTGAATTCGCCGTTGCCGGTGACCACGTGAAAGA
AGCCAGTTGCCACCCAGTGAGACGACCAAGGATCCAAGACGCCGAAAGTTATTTCTCCGAACTATCAAGCATTTCACTGTCTCGAAAGCGACCGCGTCTGTCCATTGAATCGGTATGCAA
CACGCATGCGCGGTAACACGTTTCTTGAAGGGGTTCTCCACGTGTTGCATTTGACATTAGCGCCGCCATTCTGTTCTCACGCCGAAAGTATAAGGTGATGCGTGTCTTGCCCGAGTGTTG
TTGCTGCTTTTGTTGAGGTGGATTGTATAACGTTTTTCTTAATGTTGTTGTTGTTTTTGTTTTTGTTTTTGGAGATCGTTTTCGTTGTTGTTTTCATTAATATTGAAAATATATGTTTCA
ATTTTAACCAGTTTCCGTTAGAACTGCCATTAATATCGCGTGATTTGCGCGTGGTAATATGCATTAGTTGGTTGTTTATCATACTTACATTTTTTACGTATACGTTCTAGCATTCAGTTA
ATTTGTAGAAACTTTACGAAGCATCTGTATTAAATTTTGATGCGGGCAAAAACCCCATACGCGTAAACCCCTTGTATTTTGTTTTCTTTCGTTAGTTGAATTTAATTTTTACGGGCATTT
TGTAACTCCGATTCTGCGTTTTTGTTTGCTTGTGTCACGGTGCTAAATACTGCCAAAGCTCATATTTTTCTCTGTTATTCTTTATCATTTTTCGCTGTCTTATATATTTGTTGTTGTCTT
TCAAACTCTGCTCATATTTTTCTTGTTGGCATACCAGTTATAGTTATTGCCTAAGATTAGGGCTAACTCTCAAGTATATAGTCTTCGCATATTCGTTTTTATTGGCGTCACGTTTTCAAG
CGACGTTGAGGTGCACACCAAATCTCTGTCTCTTTTCTAAATGTTTTGTTCACGCACTCGACGAAACGTGAAGAAAGGAGCAAAAACGCATCAGTTTGGAAGAACTGATGCGTTATTGTT
GAGATTTAACTTTAACATATAAGAATGCCGAAAAAACGAATCATGGAGTAAAAAGCGTAAAAAATATCCACGTCCTGCGCCTCTTCAGCTGCCATTGGATAGTGTCGTGTTGTTTTAAAA
AAATCTGACTTGTTTGTCGATGAAAAATAAATTAAGTGCGCACACAATGCCTCACAATATTGCACGTGCTTCTGAGGGTGTATCGCTATCGCAGTTATAAAACATGCTTCAGCTCTGAAA
GATATTCCGTTCTTCGAAGTCTACCGAAACCTTTCTTTATACTTTGAGGTGTTTCTGAGTGTATGCCTCACGACTACGCGCACGGAAGGCATTATTTCAGCAAGAGCTGGGGAATTGTTA
AGAATGCCAAAAAAACAAATCATGGAGCATAAAGTTTGAAGGAATCCACGTTCTGCACCTTCGAATGCATACTGTCGTGTTGTTTCAAGAGTTGTATCCACTGCCAAGTTTCTTGATCGA
AAATAATAAAAAAAGTGCGCGCACACTGCCTCACAATATTGCACGTGCTTCTGAGTGTATTACTGTTGCAGTCATACGCTTCCGCTCTGGAAACTTTTTAGTAGTCAGACTGTATAAAAA
AGCCCTTAAGGTGTTTCTGGATGTACACTTTACCGAGATTCACACGGAAGGCATTATTTCAGCTATAGCTAAAAGATAAATCTATAGGGTGACTGAAATAACCAGCCTCGATCTAAAACG
GGCCGTAAAAATCAGCGCCTGCACGCAGCAATCTGAATTTTTAGTCACAAGTATATTTTACAAGCTAGCTTTATCTCGTAAAATTGCAGAGTAACTCCCTTTCTGTAAAAAAATAGGGCC
AAAAAAATTGCCAAGATGAACGGCGGAGGGCGATGCAGACTATACCGAGCCGAGTGGTGGGGCGCGTTTGGCGCACGTTTAGAGAGATGACGCTACCTCCTTACCGACAGTGGTCACGAT
GATCGTGGTCTATTAACATTAACACAATCTTTTATGTTACGAACCTTTGGTTTAAAAATAAATTCCGACTATGGGAGCCAAACTTCCAGTAAAAAAGAAAGCGCGGTTTCATAACGACGG
CGCTCCTGATGCTGACGGATTTCACCTTAGTGTCCTCTGCTTTCTTTCGCTGGTCGGGGACACCTTCGGACGCTGCTCCCGACGCCATCTATCAATGCGTGCGCCAAACGCGACCCGCCA
CTCGACTTGTGGTCTGCGTCGCCATCAGCCGTTGATTCTGACAAGGTTTTTGGCCTTATTTTTTTACAGAAGGAAAGCTACGCTTTGGAATTTTACTAGGGTAAAGCAGAGCTGGGAAAT
TCACATTTGACGAAGAGTTTAGGTTGCTACGTACGGACGCCGATTTTTAAGGCTCAATTTAGACTAAGCCTGGTTATTTTAGTAACTCTATATTATCCTACCGATCTCTGATGAATGTAT
TAATCGTCAACTAACTCCTTAAACAGGATGGTATACTGGGATGGAAAAATGTTACAACAGTAAGGAACAAAAACAAAAATGAGACAGACAACATCTCAAACTCTCCAACAGAATGTATCC
CTCCCATGCTTTATGCACCCTTTCCAGAGTTGTCATTGCCACAGACGAAAGTGTACATCCGTTGTAAAACTCAAAAAGGAAGAGGGAGAGGTCAACTGTCCCACTTTTTTTTTTATTGTT
TCTGAGTTTGTTGTTTACTTTTTTTTCACGTCTTACTTTTTACCTTCATGTTCAGTATGCACGAACTGGATTGTAGTTTAAGAATGATTTCGTTAAAAAAAAAGTCAAGAACACAAAAAG
TCAAATCACGACCCCTTTCACTTTTTCTTTCCCCCATTTCACGATATCACGATATGCCAATTAAATACATGAAGTCGAGCTCGGCACTTGATCGATAAACCTGCCGTTTAATCAATCAGT
GCCTTAATAGCGATTAATTGTTTTACCGGTTCACCAGTGAGCGTTTTACAGACCAAAAAAAAGTAAATGTTAAACGATTTCATTACGCAGATGTACATGAGGACACCTGTAGGAAGGCAA
ACTTCAGGTGACATTTTGACCTAAAGTAAACTGTAGTTGCGATATTTGTAACTCTAAACGAGTGGAGATGGTTAAACATTTCCCAGACAATTCAACACCGTGCGAGTGTCCGTTTAGCGC
AGCAGGGCCTATTGTGAACAATCAAAGGAGTTCGCTATTGGCGGAGAACATCAACGAACCTCTTTGCCTCTGCGGATGAAGTAATATTTGGGAGTGTGGGTGTCTTTTTACGATTCTTAA
TCACACGGGTTGATTTAAAATCGGATATCGTACTGCGCTATTTATTACATGTTCAGCCAAGGCAAAATATATAATTTCACCCTTTTTGTTCTTAAAACTAATATGCATGTGAATTATTGA
AACCGATCAGTCGATTAATTAATCAATTAATGAATGCCGATTATTCGGGATTACATTTTTATCGACGCCCATCCCTAATATGAACACTAGTACACAAAAATTCACCATAAATATTTATTG
AAAAGTTCGTCTAGTCAGAATAAATCAGCTCACTAAAAGCAACAAAAAGAAGGCAAAGAAAACGTGGCAGCACGATTATTTTTTTTTTTTTTATGAAAAAGGTTAGCTTGTTTGTTAGAG
CAAAGAGGCTATCGAGTTGGTCTCGAAATGTACCCTTTCAGAAGCTAGAGCGTCTGCTTCCTAGCAAAGCACTTAGAAAAGCCAATCTCTGCACTTTGCAGTTCGGCGAATGACGAAGAA
ACTTTCTGCGACGTCACACTGACATATTGCAGTTTATTTATTTCTTTATTTATTACGTGAAACGTTTTTGGTTAAGTGTTTGAGATTTCGTGAAGCCTGGATGAAAGTGTGGCCGCGAGG
CCCGACACCGATTGGTTGACGAGTGGGAAAGGACGACAGAGGTGCTCGACGATGATTGGTTAACGGGGAGGTCATGTGACCAGCGCGGCAGGCGAGGCGAAGCTCGACCCCCTGTGCACT
CTCAGGGAGAGGAAATCGAGCTTATAAACGGCTCTGGAAATCCGTCAGGTGTATCAGCCCGATTAACGGTAGTATCACTTCATTCTAGGAAAACAACTAAAAAGTTCACAATTTTTCCAC
CACAGTCTCAGGTGTTATATGACATGATTAGCTATCACCAGCTCGCCTGCACACTCACTGTCTTTTCAGTTATTTCTTAAAGGGCCTTCTTGTTTCTATTTTTGATGATGATTCGATTAA
TATTTTCAGGCCCTCAATAGCTGCAGGACCTTTTTGTTACAATCAATGAGAATGAACGACCCGCTCTCTTAGCAAGTCATTAATATAGTGTTCCTTTCGTAGGAGGACTTATTTGAAGAT
AGCAAAGACAAACTTGACGACTTGCGTTTTGCAAAACTTTACATCTCCAGCAAAAAAAAAAAATCTCAGATCACTAATTTATTTGTTTGGTTCGTCTCCATGCTTTGGGTAATTGAGAAA
GCTACATTTATACTCCACGTGGCACACAGTGTCTGAAAGTTTAAGGGAAGCAATTAGCATAATATACAGCCGTCCAATTCCGTCGTTTCAAACAGTACATAAACACTCTGGTAAATCATA
ATACATTATTTTTCTTACATGTACGTCATATATATCTTAAATTAGCGTCGGATGCAGTCGTGTCCGGAGGCTGCATACTTATTGCTTCGGAGCACCAGACAGTCGGGATAAGAATCTGCA
TATTTACTGATGCTCATACGGGCTCACTGGCTTCGCGGAACAAGTTATCTTCATCTCGTCGATGTCGTTACAGCGCTGAACAGACGTCGAAAGGCGGGGGAAATGCATAAACCAGAGTTG
CTTTGTTACATAATACAGCACGGAAGCCGCGAGGTTCATCTGTGTCCGAGCGTACCCATTGGTAGGGAGAGAAGTGATGGGTATTAATTTATTCACATCGGCTTGACAACCAAAGTTCTT
AGTTCGCATGACGAAAGATACTTCTAATTGGTGTCGCAAACACTCTAGCCCTTAAATGATAGCAGAAATATTTTGTTCGCGTATGAACTTTACTCGATAAATATTATCTCAAGAAGCACT
ACACATTAAACGAGGAAGAAATGAATAATATATAGCAACGCAGCAAGACAAGACATTGATTGATGCGGTCATTCGCTACTTCAGGTATGGTTAACACAACCTTTCATTTAGTGTCAAAGG
AAACATCGCACAAACGCCAAAATTTATGCTGACTCAGTACATATTTTCGAAACCTTAAAGCTCTCCCTTTCTTTTTTTTTTTCTATCACTCTTTCTGTGTACAACAAACTGCGCTTTACA
GGTGAAGCACAAAGCCTTTATATAGCTCTAACACTAAAGAAAAGCTAAACCACTTCAAGAGGGAAAAAAAAAAAAAAAAAAAAACAAACAAACGAGGTTATAAGACGCCTAATATAGTGT
TTGGACTCCTGGATTCGGTTACAACTGTGAAGCTGAACATGTTTAGCCTTAAAGGAGCTGTGCAACAGTTTCAGTGCTTTGCTTAAATAATTTGGGAGTTGGTGTCTCCACCTTTCTGAA
GTAAAAAACAAAAAAAAAAAACGTTTTTGCCTGCATGTCCTATTTTTTGTTTTATAAAAATGGACAAAAATTGAGGTTTTCTGCACCTCTCAACTCCTTCACCATCTTCCCAGTCACGTG
CGCCGTGACGTCGTCGGGGGTCGCACGGGGTTCCGGTGAAGCTCTCTCTANNNNNNNNNNNNNNNNNNNNACTGTTCTCACTCGATGCAGACAACATTGATACCTGGGTAGGCGCCATCA
GCGAAGAGCCAGTGCCGGGTTCCAAGGTGGGACCTACGCTGCTCTGCCTGCTGAGCGGACAGTTCGCCAGGGTGAGAGACGGTGACAGGTAAGTGTCCCAGTAATAAGTGAAGTCAGGTG
TAGGAGGCAGAGAGACGTATTCGAGTTACAGAAAATTAGGTTTGTGAGTGATAAACCTATAATAACACCCATTCGAATGACATCCATAGTAACCCTGAAACGAAGGAACAGACTTCGTTG
TTCTACCCATTCGGATGTTCTCAAAAGGCAAACGAGATCACGACTGAAGCCACCTGATATTTGACCTGCAAATGTTATTCGGAGAAATATCGCAGATTTAAACGAACCACCTCGCGGAAG
CATAATAGCTAGCCCCCTAGTTCGTGGCAGCTTAAACACAAACGCGTTACTTGGTGTAGTTACGCTTCTTGCTTCGTGGCTCATTCTTCAGTTTTGTTATTGTCTAATAACACAACCTAA
AAAAAGTCAAATTTGGAGGTTTTACGTGCCAAACCAACGACGGGCATCTGGCACGCCTCAGCGGAGGACTGAGGATTAATTTCGACCACCTGGGGATCTTTTGACGTGCAATCGAAAGCT
CGGTTACACGGCGCCTTCTCCGCAATAAACCTCCTTCAGATTGCGGGCACCTCGGCCGGGTTTCGAACCCGCCACATGGGGATCCGTAGGCCAGCGCTTTCGCCTCGGAGCCACCGAGGC
GGCTAATAACACAATCTCATTGGCTGCGGAGAGATAATAAAATGATCGGCCCTCACCACCACCTTTATTTCTTAATCTTCCAGTGGCTAGAGAAGCGTCAGTGTCCTCATTGCGCAATTT
CCCAGCAGAAGATGGGATGGTTCTTTCAGTCATCTAGGAGCTCAGGCTTTAAACGTTCTTCCTAGCAAATGTTACTGCATTCTTAATTTTATTGATCAACTGTGCAAATAGCAGGCACAT
AAAATTAGTATAATCTAGATGCTTTCCTTGCCGCAATTATGCTGTGACCTTGTTACACGTGCCTGAGTAGGTGTGTTAAAACTTAACATATCGAACTGGCTCAATATTTGTCTGGAGATG
TGGTGATCCTTCTTGCCCAACCCAGGTTATGGTATGAGAACAAAGGATCGTTCACAAAGGACCAACTCAACGAGCTTCGGCGTGCTTCCCTCGCCCGAGTTTTGTGCGACAACGGCGACA
ACATAACCAGGGTGACGGAGGACGTGTTTATGGTGCCGCGGCGGCAGAACCCAGCCTTCGTAAACTGCGACACCGTTCCTTCGATCGACTTGACGCCCTGGAAGGACGACCAGAAAGGTA
TACGGCAAACGATTCCGCGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCCAAGAGAAGCAGACCATTACGCAGGCTACAGGACACTGCAGCCTTCCGGCGTCTCTCGCTGGGAAACCGCTGACGTCGCTCGTCGAAAGTGACTTCGCCTGCGAACGGCCCAGC
CTGACGGAAGAGCCCTATGACGTGGAAGCTGCTTTTGGTGTCAAGGTAAACTTCAGCTGCAAGGCCGAGGGCGAGCCACGACCAAGCATCACATGGCAACACGATGG
CGACGAAGTGTCG
ACAGACCAGGACAATCGGGTGGAGATCCTGGACGACGGTACCTTGGTCATCCACTCCTCGAGGATTGAAGACATTGGCACGTACAAGTGCAGAGCCGAAAACGCTGCGGGTCACGTGGTG
TCCCGAACAGCCTATCTGCGCTTCACGAGCCCTACACTCTCC
CCCCGCATCGTCACGAAGCCGTCCGACGTGTCGGTCACGGCAGGCCGCAGCGTCACGATGCGATGCCAGGCCGCGGGC
AGGCCGACTCCGCAGGTGACGTGGACGCGCGACGGGCTTCCGCTGTTCCAGAACCCCCGGTACCACGTGTCCCGGACGGCCGGCACGCTCATCATCACGGCCACGGACCTGAGCGACTCC
GGCAAATACATGTGCACGGCCAGCTCGCTCCTGGGCGAGGAGAGCGCAGCCGCTGTGCTGCGAGTCGAAC
TCGCACCATACTTTATTGAGTCCCCGAGAGAGCAAGACGTCCTAGAAGGA
GACAACGTTGAGTTCATCTGTCACGCCGGAGGTTTTCCAGCGCCACAACTCTCATGGTACAAAGACG
GTCAGCGCCTGAAAGCTGATGGAGTGCATGTAAAGAACCTGCACGGCGGTAAA
GTCATCAAGTTATACGATGTGCGACGGCAGGAACAAGGTGTCTACACGTGCCACGCCCAGAACTCCCTTGGATATGCTGAATCTCATGCGGACCTTCTGGTCAGCTCTAAAG
CCATGCCA
CACCTGATGACGGCTCCTTCAAACACGGAAGCCGACCAGGGCTCCACTGTGGAGGTGTTCTGCGTCGCTGAGGGTCACCCGACGCCCACGGTGTCCTGGCGCAGGGAGGGCAAGGTCATC
GGGGACACACCGCGCCGCAAGATCACCCGAGACGGGAGCCTCGTGGTCATCGGACTCCGTCCCGAGGACGAGGGGCAGTACGAGTGCGTCGTCGAAAACGAGATGGGTCAACTGGTCACT
CCGTTCTATATCCTCGTCAGAG
ACACGATTGCCGAGGGACAACCGCATCCTGGCGATCGGTACTTCTTGTCCGCGCTTCAAGAGGCTGAAGAATCCGTGGACAAGGCCATCAACAGCACG
CTCCAGAACTTGCTGAACAGCAGCAGCAGCGGTCATAACCACCACCAGCTCCTGCGGATCTTCCGCTACCCGGACTCGGAGGCCCAGCGCACTGCAAGAGCGGCCGAGATCTTCGAGAGA
GCCCTCGGTCTCATCCAGGAACAAGTGTCTTCCGGAGCCAAATTTAACCTTTCTC
AGTTCGCTTTCCGGAACCTCCTGTCTCCGTCGTATCTGGACTTGCTGGCGGAGAAGTCGGGATGC
CTCCAGCACCGCCGGATCCCGGACTGCACGGACGACTGTTTCCACAGCCGCTATCGCACCTACGACGGCACTTGCAACAACAAGGAACATCCGATGTGGGGCGCATCGCTGACCCCTTTC
CAGAGGCTGCTCCCTGCCCAGTACGAGAACGGTTTCAATACTCCAATCG
GTTGGACAGCAAATCTGCCCGTGAACGGTCATGTGCTTCCGCTGGCCCGCACGGTATCCACGGGGTTGATA
TCTACTCAAGTCGTCGAGGAAGACAGCGAGCACTCGCATATGCTGATGCAGTGGGGTCAATTCCTGGACCACGATATGGACTTCTCTGTTCCAGCGATCAGCCACGAACGCTTCATCGAC
ACGGTGGACTGCTCCGAATCGTGCGAAAATGCCATGCCGTGCTTTCCTATTGAG
GTCCCGGCGGACGACCGGCGAGTCCGCGGCCACCGCTGCATCGAGTTCGTGCGCTCGAGCACCGCC
TGCGGCTCCGGTCGCACGTCTATGTTCTACGGCGGCCTGATGCCACGGGAGCAGACGAACCAGCTGACGTCGTTCATCGACGCTTCCAACGTGTACGGCAGCAGGCCCAAACAGGCGGTC
CATCTGCGGAACCTGACCAGCGACCTGGGACTGCTTAGGGTCGGTCCTCGTATGCCCTCCGGGAAGTTCCTGCTGCCCTTCAACGACGGACAACCGAATGACTGCAAGCGGAATTCCGAG
GTGAAGGGCTATTCGCCACTTCCACATTTCGACAACCAGGCAGTGAAAGTTTTCACTTTATATGGATACAAACATCCGAGCTGTGCGTTTCCGTCCTTTGC
GTCCCCTCTTCTTGTCTCT
CAGGAAACTCGCAAGATAGTCGGAGCCCAGATGCAGCACATCACGTACTCCCACTGGCTCCCCAAGATCCTGGGACCCGTGGGGATGGCTGCCATGGGACCGTACCGGGGCTACAACCCC
GAGACCAATCCGTCCATCGTGAACGTGTTCGCGACGGCCGCTCTGAGGTTCGGGCACTTCCTTATCAACCCCGTTCTCCTGAGGCTCGACGAGAGGTTCCAGCCCGTGCCCGAGGGCCCC
GTGCCGCTGAGAAGGGCGTTCTTCGCTCCGCATCTCCTGCTGAGAGAAGGGGGAATCGATCCCCTCATGAGGGGCCTCTTTGTGGCCTCTGCCAAGCTCCGGAAGGCGGACCAGCTGCTC
AACTCTGAGCTCACAGATCATCTGTTTGAG
CCTGCTCTCGTCGTGGCCCAAGATCTGGCGTCGTTCAACATCCAGCGCGGTCGCGATCACGGTCTCCCTGGTTACAATCGTTGGCGCCAG
TTCTGCAACCTGACAAAGGCGAGCAACTTCCACGACCTCAGGCACGAGATCACAAGCGACGACCTCAGAGAGAAGCTGGAACGACTCTACAAGACTCCCG
ACAACATTGATACCTGGGTA
GGCGCCATCAGCGAAGAGCCAGTGCCGGGTTCCAAGGTGGGACCTACGCTGCTCTGCCTGCTGAGCGGACAGTTCGCCAGGGTGAGAGACGGTGACAG
GTTATGGTATGAGAACAAAGGA
TCGTTCACAAAGGACCAACTCAACGAGCTTCGGCGTGCTTCCCTCGCCCGAGTTTTGTGCGACAACGGCGACAACATAACCAGGGTGACGGAGGACGTGTTTATGGTGCCGCGGCGGCAG
AACCCAGCCTTCGTAAACTGCGACACCGTTCCTTCGATCGACTTGACGCCCTGGAAGGACGACCAGAAAGGTATACGGCAAACGATTCCGCGATGA

Retrieve as FASTA