Entry information : GgaPxd02
Entry ID 7673
Creation 2010-10-28 (Marcel Zamocky)
Last sequence changes 2016-02-16 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-16 (Achraf Jemmat)
Peroxidase information: GgaPxd02
Name GgaPxd02
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Chordata Aves Phasianidae Gallus
Organism Gallus gallus    [TaxId: 9031 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GgaPxd02
start..stop
S start..stop
TguPxd02 2618 0 1..1344 1..1344
TguPxd02 233 3e-62 1236..1406 1344..1475
MdoPxd01 2080 0 24..1405 182..1577
XtPxd 2059 0 8..1405 13..1413
MmPxd01 2058 0 24..1405 33..1427
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2590..2753 164 N° 2 10995..11066 72 N° 3 17819..17890 72 N° 4 18010..18081 72
N° 5 20858..20929 72 N° 6 22307..22378 72 N° 7 23927..24096 170 N° 8 25433..25550 118
N° 9 27100..27269 170 N° 10 27723..27995 273 N° 11 28169..28285 117 N° 12 29846..30004 159
N° 13 31708..31820 113 N° 14 32871..33027 157 N° 15 34311..34419 109 N° 16 35166..35323 158
N° 17 37007..38510 1504 N° 18 38995..39129 135 N° 19 39607..39815 209 N° 20 40368..40482 115
N° 21 40860..40953 94 N° 22 41277..41372 96  
join(2590..2753,10995..11066,17819..17890,18010..18081,20858..20929,22307..22378 ,23927..24096,25433..25550,27100..27269,27723..27995,28169..28285,29846..30004,3 1708..31820,32871..33027,34311..34419,35166..35323,37007..38510,38995..39129,396 07..39815,40368..40482,40860..40953,41277..41372)


exon

Literature and cross-references GgaPxd02
Literature International Chicken Genome Sequencing Consortium (2004) Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432: 695-716.
DNA ref. GenBank:   NC_006107.4 (9279703..9235568)
mRNA ref. GenBank:   XM_417421.2
EST ref. GenBank:   BU486113.1 [5' end]
Cluster/Prediction ref. Genebank:   419247
Protein sequence: GgaPxd02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1406 (1383)
PWM (Da):   %s   157745.7 (155287.3)  
PI (pH):   %s   7.38 (7.26) Peptide Signal:   %s   cut: 24 range:24-1406
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLLKPSALLGFLCFLLLPASSRSCPPRCLCFRTTVRCMHLMLETIPDIPPQTSILDLRFNHIREIQPGAFRRLKNLNTLLLNNNQIKHIVRRSFEDLENLKYLYLYKNEIQSIQQHAFHGLRSLEQLYLHFNSLETLEPETFSDLPKLERLFLHNNKISRIHPGTFSQLESLKRLRLDSNALLCDCDLLWLAELLQKYAELGSIQTAATCEAPRELHGRSIVTLTAQEFNERPRITSEPHDVDVLLGNTVYFTCRAEGNPKPAIIWLHNNNEIDMKDDNRLNLLQDGTLMIQNTKESDKGVYQCMAKNIAGEVKTQEVVLRYFGTSKPTFVIQPQNTEVLVGESVTLECGVSGHPHPRISWTLGTGSPLPQDPRFAITSSGGLFIQNVTFSDQGQYNCNASNTEGSIQATARIIVQDSPRFLLVPTDQTVTEGQSVDFPCTAEGHPPPVIAWTRAGGPLPSNRRHSILSTGTLRVMRVALHDQGQYECHAISAIGVRTLPVQLAVTPRVIPVFLHPPQDVVAETGQDVAITCAAQGDPRPTITWVEGIQITESGKFHVSQDGTLSIQDLGVADQGRYECIARNPFGFTSSAMQLTITATDVGRSGDTFVATSLREAISSVDHAINSTRTELFSRRPKTPNDLLALFRYPRDPYTIETARAGEIFERTLQLIQEHVQQGLIVDMNVGYRYNDLVSPHYLNMIANLSGCSAHRRTPNCSDICFHKKYRTHDGSCNNLQHPMWGASLTAFQRLLKPAYQNGFNLPRGFSLAEDARDLPLPLPRLVSTAMVGTETITPDEQFTHMLMQWGQFLDHDMDQTVAAISMSRFSDGAPCSQVCSNDPPCFSVLIPANDPRVRNGRCMFFVRSSPVCGSGMTSLLMNSVYAREQINHLTSYIDASNVYGSTEQESRELRDLSSQNGLLKRGRVVPSSGKHLLPFAVGPPTECMRDENESPVPCFLAGDHRANEQLGLTAMHTLWFREHNRVAAELSVLNPHWDGDLLYHEARKIVGAQMQHITYAHWLPKVLGEAGMKMLGEYKGYDPNVNAGILNAFATAAFRFGHTLINPILYRLNETFQPIRQGHVPLHKAFFSPFRITQEGGIDPLLRGLFGVPGKMRVPSELLNMELTEKLFSMAHSVSLDLAAINIQRGRDHGIPPYNDFRVFCNLSSAQEFEDLRNEIKNLEIREKLRSLYGTTKNIDLFPALMVEDLVPGTRVGPTLMCLLTTQFRKLRDGDRFWYENPGVFTPAQLTQLRQTSLARVICDNSDHIQQLQRDVFRVASYPQGMVGCEEIPAVDLRFWQDCCDCQTRGQFRALSQRFRSKRSPGFSYPEENPAKHKPASPRNEAPAPRSSSRENLESLVAELEKAVTSLRKVHVLESQLRWHHGNTSTYGQGKKTGDKWRKR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromosome 20, 18 introns) and 1 EST, strain="inbreed line UCD001".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGCTCAAACCTTCAGCTCTTCTGGGCTTTTTGTGCTTTCTCCTCCTGCCTGCTTCCTCCCGTTCCTGCCCTCCTCGCTGCCTGTGCTTCAGGACTACAGTAAGATGCATGCATCTG
ATGTTGGAAACCATCCCTGACATCCCACCTCAGACGAGCATACT
GTGAGTAACCGTTGCATTTCACTGCCTTTCTTATCTGCTTGGTGTTCAGGAAATAAAGAGGAAAAGCCTTCAAGGC
TGAAGGCGTGCCTTTTGTCCTTTATTTATTCCTCCTTGCTGCAGAACTGTCTGCACTTGAATCTGTTTCATGCTTTTAGAGCATAAGCTGCTGCTTTTGTCATTAATTAATTGTTAATGG
GGCAGTCAGTTGGGAAAACGCATACTAGTAATGCCACACTATCGCTGGGAGATCGTTTTGGGAAATTGGGGATCACAAATGTTAAAACTGAGCCTATAGAAAGGTACACAGTTTACATTT
CAGAAGGATATGGGTGTAGGAGAGAGGAAATACTGCAGTTTAGGCTTTTGTCTCTACAGAAGAACCCCCCAAAACTTAATTTTTCATAAATAAACCACCCTTTTTTTTTCCTCTAGACTC
TTAAGTTTTGGCTTTCCAGTTCCTATGTCAGCTGTGCAAACCAGATCTAAAGTTTATCAATAAAGCAACAACTGGGGCATCTCGCATTCCTTGAGAAATAAAATGTACCTGTTGAGTTGG
CTGTGCCTTCTGGAGAGGGAGCTGCTGGCTGTGGCCATTCAGATGGAGAAGGTGGAGGAAGAAGGCGTGAAACACTTGGAGACTCCTAAACAGCTCTCACTGCCAGGTCCAGGAGAGCAC
TTTCCTGTCGATGTGTGGTAGTAAATCCTATGCTTAAAGGTGCCTTTGAGGTGCAGTGCCATGTGACAAAATGTGAAAGGCTTTTGTTTTTTTTTTTGGTAAACAGCAGGGAAGACTTGT
CAAACGTTGATCTTTATACTCATTCTCCTTACCTCACTGCTGTTTATGAAACTTATCCAACCTTGGTGGGTTGAGAAGCCTGTCTCTGTGCTCCTAACCAAATCTGGTCTCAGGCAGAAC
ATCCATAGCAGCGTGTCTCCTATAAGCATTGCACTAATACTCTTAATGCAGCTTACCTGCTGGCAGCTTGATGGGGCAGGATGCTGCCATGGTAATTGTTGCATCCAGGTCTACTTGGGT
GGATGGGGAATACAGAGGTTCTAGCAGTAGTGGCACACAGGAAAATGCCTGCACTTGCTGCAGCTGCCAGAACTGCCACCTTGGCTCATCGTGACATGGGGCAGAACAGAATTCCCTGGA
AGCATTCAAGGCCAGGCTGGATGTGGCTCAGGGCAGCCTGGTCTGGTGGTTGGCGACCCTGCATATAGCAGAGAGGCTGGAATGAGATGATCATTGTGGTCCTTTTCAACCCAGGCCATT
CTATGATATATATAGAATCTGGACTTGCTTTCTCTCTAGGCTGGTGGTGCTGTGGTTACTGCACAGTGTGATAATATCTGCTCCATGGTTTATTGCATGCTTTTTGGGTAGTGGCTGGCT
GCTCCGCAGTAACTTACAGTCTGACTGTCCTAATTGCTGCCAAACTTTTTCCCCTTACAGATTTTTCTGCATCTTTAAGTATTTAACACACGCATACTCTGTTTTTAGCAAAACAGTTTG
CTGCTGCTTGTTTAAACATATGTCTTACTGGGGGAAAATTTGGGTGGTGGTTTTTTTTGGGGGGGTGTGGGGGGTAAAGGCAACTTATTTCCAAGCTCAATGAAGCTTTATTTTCATTCT
TTATTCCAAACAAGACAGCATTTGCTGTTGCAATGAACAGCCTGAGTGTGCTTCCTATGAGGATTCCTCGACTGCAGAGGCAGAGAAATGTCCTGTGCTCACCATCCTGTGCTCACCAAC
TTCTTTTCAGTACAGGAATGGTGTATTTCTGAATGATCTCAGACAACAGCACGCTTCGTTCTCTTATGCTGCAGGGAGTGAGATGTGACTGCTTATCCATGCAGCTTTAGTAAAAGCACT
GGTAGTATCTGTTTGCAATTTAGCTGACACTGAGTTTTTTGTGCAACTCAACCTGGACAGGTGCATTTTTCCAGTGCAAGGTATGCAGTCACCATACTTCTCTCTCCCCTGCTAGGTCTT
GTCTACTGACTAGTTTGAATGTGCACTGCTTATCAACGCTCCATGATTTGCATACTTAACCATTTGGAAAGCTGGTTCATTTAGTTTAATGTGCTAACTATAGCTTTGAATGGGAAACTG
TGGTTTTAAGCATTAGCAAAGTGGTATAGGTGTGTGATACGAAAGAAGTAGTATTTCAGTATGAGATGGCTGTCTTTATGGGTTGGTATTTCTGACTGAGGTTTATCTGGTGTATTCTCT
TCTGATTGTCTGCGTAGTTATAAGTAAAATCCATATTGGCAATTAGTGATCCCCATAGAGAGTGATACGGGCTGCTAGCAGATCATGTGCCTTTATATGATGTGCAGCAAGTAAAGGCAC
TGACTTTCTGGCTGTCTTAAGGATTTAATGTATGTAAATGCATTTGCCAGCAAGCATCCCATTGTATCTGTTATAAATAGCATTTGAACAATTAAACTTTTTTAATTGTGAAGGATTAAA
GAATGCTTCTTAGCCAAGCCCCCGACTGCTCCAGCTTTCTGGTATGTTAATTTTTCTGTTGGGAGGAGAACTGTTCGTTCTCAGTTCGAACACTGGGAGTGTATAGCAGGAATGGTCTGA
TCGTGGAGCTGTTCCGAGTCAGACATGTGGGATCGTGATCTTTTCCACATTTGCCCATTGGTGTGAATAGGACCGAGGCTGTGACTGCGGATTCAAACCCCGATCAGAGGCTCCAGCTCT
GTTCCCTCACAGAGCAGCTGCAGCTTCCAGATGAGCGTTGCTTTGAACTTGGACTTGGAGACTTCCTGACTTCCGTGACTCCGTGCCACCCTCTCTGCAGTGCTCCTCGTGGAGCAGGGA
AGTCTCCTCGCCAGCACACGCTGTGCCTCGACGAGCCCTGCTGGCGGATGTACCCCAGGGGTTCTCGCCAGCTGGCGGCCCTTGGAGCAGCCCGTGGCCCTCTCGGAGCGATGCTGGGGT
TGGCACGGGCCCAGCTCTGGGATTGATGAGCTGTTACTGGCTGGCTCCTCTTCGGTCGCCATTTCGCTCCTCCCTTCGGAGTCCCAGCTGGGTGCAGCAGAGAACCTGGCCTGATGTCTG
GTTTTAGCAACAGGCTATTTGTCTTTGGTAACGATGCCTGTTGGTTCTACCTCTGAGCAGAGAACAGGACAGCAAGAATGGCTACACGTGTACAGATAAGCTGTAAAAATTCACGATGTT
TTAACTGCAAGCCTATTTTGGCTGCTGTTTGTTCAACTGGAACGCGATTCTCCAGATGTGATCTGCTGGTTACTGCTGGGATTCACGCCGTTTGTTTAGCCAGCAGCCCAAAGAGGGGAA
CAGCTGGGAAACACACACTCCGAAAACTTCAATAGGTCTTTAACCTTCAAAGCCGTTTGTTCTACAGAGTGACATTTAAAACAAACTTTGAAATGTGTGGGCATGAGTAGAAGAAGTCTG
TGGAAAGAAGTTCCCCTCTGGCTGGCAGCTAATGGGTTGCAATCCAATTATCCGTGGGTTATTCTCCTTTTTGCATTATGCATAGCACATAATGAATGAGCACTTCCAGAGAAACATAGC
TGAGGGCACCAGCAAAGACTGCGTGGTATCTGGCATCTGAATGCATTGCTGGCATGAACCGGAGGTGACCCAGTTGCTCACAGACCTGGTTGCTAATTGGGCACTGTGAGCACGGCCAGC
TTGACGAGTTTTGTTTCCTGTCGTCGCTGGATGTGCTGCGTGGTTGGTGGCTGCTTGTTCCTTCTCCTCCTCCTGCACAGCAGTAGGGAGGGCTGCACCCTGCCCCGGCACAGCACTCGG
TGTGTCCTAAGGAGCAGAACTGAGAGAGAGAACAACGCATGTTTGTGTGGGGAAGGGTCACTGAGAAAACGAGTTCTTGGAAATGCTGCTCCCTTTGTGATGTCTGTCGTGAGCCTTCAG
CCCTTGGGATGACGAAGGGGATTACTCATTTCCTCTGTGTGTGATGGTCTTATGTGCAGTCATTAAACGCACACCCACACGTTCTGCTTGTTCCAGGTGTGATCTCTTGCTGACTGCTTC
TGCTGTAGTATTTAATCCTCATTAAACCTTTCTGAGGTGACCTAAGCCTTCTGTACGTCCTATTTATAGCAGTCACTTCATCGGAAGGAAAGCGGGGAGGGAAGGTCTTCAAAGATATTT
TCCTTCCTAGAAGCACTGCAGCACCTTTTGCTGAAGCCATCCTGACTCAGGGTTGTAATTACCTCAGGTGTTTGGAACTCACTGAGCGGTTGTGTCCATCATCTGGCTCTCACCTGAGTG
TTCGTGCTTTCCCTGACTCCCTTGGCTTCAGCACATCCTTCTTCCCATCCCCGGGACTTCTTGCTGTGCACTCGAATGCAGCTTCCTCAGGGTGGGCTGCAGTACCAGATGGGAGCAGTC
AGTATTTTTCAGTGAAGGAGTGTCTTTGTATTCTGCGTAGACTTTGATGTTTGTGCTCTTCAGGAGCTAAAAAGCTGGTACTGATGCTACGAGAGACTTTGGATTGAAGAAGCTTTCCAT
TTCCATTTAAGCTGATATGGTACTACTGCTTTCTGAAGAAGGTATGTATATTTCCGCACTGAAGTTTTCTTTTACTGCTTCTGGATCAGGGTCAGAATGCAGTTCAGGAAGAGGGCAAGC
TGTCTTTATTTGATCTGGGCAATATTTTGAATAGATGGTGCAAAGGAAACGTGCAGCACGTTAAGAGAGTCCTGCTCTGTGCTGACTTGAATATCCAAGAATAGATCCAGCTTGTTTGAT
TGGGATCAGACCTTAATCTCCATGCCAGCTGTTAATACATAATACCTCAAATTATCTGAGATTGGTGAGGTCAGCGGTTTGCTGTGCAATCTTCTAACCTGGATGTGTGCACTTGAGTTG
GAGGTGTTTGCTGCACCTCCTGGGGCGACTGGTGAGAGCTGGAGGGGTGCTGAGTGGTAGGAGGGGATGCACCAGCAGACACCCTGTCACTGCCTTCAGAAGCCACCCAGAACCACTGCC
TGGAACCAATTCTGTGTGTGCTAGCTTGCATGTGCTCAGAACAGCGTGGTAGGCTGAGTGCTGAATTACTGACTGGTTGTTGACCCAGCTGACAAAGAGGGAGTCCTTAAATATCTGACC
CATTTGTGGGTGCTGAAATTTCCAAGTCTGATTTCAGTAACGCCTGTGGTAAGTTCTTAATTAAAATCTGGTGTGCCCGCTGCTCTGACTTCGGTACGTAAGCACTGCACGGTCTGTTCT
GCAGCATGGAGCTCTCTGCATCTATGTGCTCTTTTGTGTTTCATCCATGATCTTAGTATCTTCTCTGTCACTGTTCTCATGCTGCACGTGTTTTCACTCCTTGCACAGTCAAAATCTGAG
TGTCTTAAACTGGTATGAACCAAAATAGCAGAAACTTGGAGTCCCCCCATGGTCTCTTTCTCTCCTTTGCTGCTCAGCTCTCCTTGTAGGGATTTAAAGATGAAGGCTGTCATTTATTAA
AGCCATTTGGGAACTTGTGTATAAGAGGGACATTCCTGAGTTGGGGAGCTGATGACAGTGAGACTGGAAGGCTTCATTCCCATCACAGCAAGGCTGTTCTCCCTTCCTGCCAGGGCTGTT
TGGCAGGATGGGGGAACCTGAGGAGCTGACTGCGATGCTCTGTGGTTAATGCATAAACAAGCAGCCTTCTGACAAGTGTTCTGGCTCTTCTCATAAGTGGGGGGATACTTGACTTAAAAT
CACGTTTAGGGTGTCTTTCATGCTGTCTGTTCTCCAGGAAGAGCTGGATGGAACGTCAGTGCCTTAACCCTGTTTGTAAGGCAACCTTTGCTCTGCGTCATTGGTGATGGTTGAGTGGCT
GCCACTTACCACAACCACTTTGGGTTAAGCAATGATTGCTGTGCACGGTGTTATGAACACAAAAGATACTTCAATGAAGCAAAGACAAATTTCCCTGGAACTACAGTAAAATACCTCTTG
TAGTTAATTATCTGGTTAGCTAAGATGGTAATATAAGATTCACTAACAGCCTAAATAGATTATGCAGAAATGGGAGGCTGTTGTAAAAGCTGTTGATTGCTTTATAGGCTGTTAATTAGT
TAACACAATGATAACAGCTCAGAGGATCAGAAGGATTCGAGTGCCATTCTGTGAATACCTGAATCTCCCAATCTATTTGCAAATTTTCTCATTCTTGATATGCTTCAGGGATGGGGCTGA
GCCTCCCGGAGCCAGAAAAAGTAAATTACTTCAATAATAGCAAGCCTGAGGTTATCCACCTTGCCCAGCCTGGTGTCCTGGCAGTGCTGTGGTGCTTTGACATGAGGACTTGGGGAGATG
TTCTGTAGAGCCAGTCTGAATTGATCAGTGCTGACCCCAGGCCATGGATGCATGAAGGATGTGGGGTCCTCAAGCAGCAGATCCAGACTCACAGCCTTGAAAGCATGAAGGATTGTTAAA
TCAGAAGGGAATTCCATCTCCCCCCTTTAGATTTTGCACATTCCAAGGTGAGGGGATGCAAGTGGGAGTGAGGGAGCCCAGCTGCTGACATACCCAGCAGCTGGGACAGGCTGGCACAGG
ACAGCTGTGTGGTGGGTCCCTGTGAAAAGCACACTTGTTTGTTAAAAGAAATGTGAAGTTCCCAAAGCGAGCACCCTGGGAATAGGGAGAAACAAGAGTTTCTGTGTGCCAAGGGCTGAA
CTCTGCAGGGAGTGCTCTCAATCACTGTGCAAGCCAGGAATTTCCTGGTGCAGCCCTGCGTGGTATTCTTTCACCAGCTGAGCTTCAGGCAAAGGCAATGGCTGGAGGAAAACACTGCAG
ATGAGCCAAGGTTAATTTTGGGGAAAGGGCAGGATGTTCTCTAAACCACTTCTCTCATTGCTTCGTTTGGAGCTGTGGAGTTACAGAAAGGGGAAAAGACAACAGATGAGACGTCTTCCA
CTGTCACGTATCCTATCCCATTCTGTGATAAAAGGGGGTAACAAGACAGAGATGTGATATTTCAATTTAACTTGAGTTGGGTAAAAAAAAGCCTGTACATTTTCTGCCTAAAACGTAAGA
AAGCTTAGTAGGATTTTTTTTTAACATAAAATAACCAATTTTGCAAAGTGTGAAATTAAGAAACATTACATCTTAAGTTAAAAATCAGCCTTCCTTGCTGTGCATCTTCCTCTTTGGATG
CTCACTCGGTTGGTTTCCAGCTGCCTGCAGTGCATGTGTCTCTTTCTAATCTTAATTTTATAAAGGCCCCAGCTCTGGTTGAAGCCCGTTGTAAAAATAATTGTTGAGCTTTTAGAAACG
CGTGGAATTCTTGCTTTAAAATGTGACTTTGGATGCTCTGTAGCTCACCAACAGCATGATGGCATTCGGAGCATTCATTCACTTAAAATAAGTGCCCTTAAAAGGCTGTCTGAAGCAGAG
AAATAGCTGCGTGTTCTCTAAATGTGAGAGCTCAGGCGGAAAAAAAAATTGCTGTGCTTTGGGTGGAAGCTAACAGCAAAAAGTATTTGTCAGTCTTCTGCCATTTGTTGTAATGTGCTG
GACCATGCAAGGCGCCCAAGCAATGCGCATTCCCTATAGAAGCGTTTCTACTTGCTTAACTGGGTTAACCCACTTAGCTCCTGTTTTATTATCTCATTAGCAATCCAAAAAACCCCACGT
TTTAGGGTTCCAAATCAATGCAGTTACATGGACTGCCCTTGAAATTTGCCAGAATCCCCTGGACTCCACTAGTTCTAATTGAAGTTGGCACGGATTTGAAATGCAGGCAGCGATAAGCTG
TTCGGAGTCTTGGAGCACTGAGAAGAAAAATGTGAAATGCTTATTATATGAGGTTATTTGATCACGTTTAACCATTGTAGGGCAAAGATAATTTTGTTGGGGACCTAAAAAGTGGCTCCA
CATGGTGATGCGCATTCCTCTGTGATTCGGCACATATCGTTGTATGTGAACTTGGGGTGCTGAGCAGCAGACCTTGGCTGCAGTTCATGGAAACAATCACTGGAATCCCTTCAGCCTTTG
GTTTTCAATGGGGTGAAAATAAATGTTGTAGGTGTAGGGCTGTGCAGGCTGGTGGCTGACTTTGCAGGTAATGGTAGCCCCCCAGCCATCGTCCACCTTCCTGTTCTGCCTCCCTGATGT
CGTCTCCATTGCTCCCATTGCTGTGGGCATGGCGCAGACTCTCCCAGGAACCTTCTTCCCTTTGGTGTTGATTTCTACTGCCTCATCTGTGTTACGAATGCACTGATTGTGTTTTCTGCT
TTCAGAGATTTACGTTTCAACCACATCAGGGAGATACAACCCGGGGCCTTCAGGAGGCTGAAGAACCTCAACACGCTGTAAGTCCCACCTGGTGATCCTGCCACGAGGTTTTTTCTTTAT
GACTTATGTTAGTACTAAGTGCCATCCTGGCTTAAAGATGGCCAAGGTTTTACTTAGTTATTTCAGCCAAATTGCACGTATCCGGCTAACGTGTCATGGTTGTCTCTGTTCTACTCTGGA
TCGTGTGCATTACCCTTTTGAATCAAATGTGCAATTTAATAACTTGCAACGTGGCAATTAACCTGTCTTTTAAAAGGAATAACTCCTGATGTGTACTCTTACTGCCTGAGGATGTATAGC
TTTAGAGTAGCCTGTAAAAAGAGCTATGGCCTGGGGTCAAGATGACAGAGGGATGCATTAAGAGCTTCTTCGTTTTTGCAGTGCTTCAAATGCATAAACCACATCAGCTGCTCTGCATGA
TGGTTACTGAAGTGAGACTGCATCCTTCCAAATGCCAGATTGTCACTATGCTTTGCCTTAAAAGAAACCTACCTTATTGCAGATAGGGGTGAGAGCATAAGGCAGTTTCTTTGGTTTTGC
ATTCCAGCCAGAGCAGGCATGCTCACACCACTGCGATGTACTGCTTTACTAACAAGTTTCTCACTCTGATCAGAGGAAGTAACGAGAGCCTTCACTGCTTCTTGCTGCCATAAGGCTGAG
GGTTTGAAGATAGATATGAGTACATCTGCATTGTGTAGCCAAGGAGCTGAATCCAAACCAGCTCCCAAATCAGAAACAGAACTGTGCTGGATGTAATTGGTCTGTCAAGGCTCAGATCTG
ATTATTCAAGCTGTAGCATGGCACTAACAGCTATGAGATCTCCAGGTTTGAGCCTCAGTCTCTCTGTGAGGCGACCAGCTGGTTTGGGAATCTGCACTGCATGGCAGACACGTTCGTATT
TCCTGGGTTCAAATGTCTGTGGTCATAAACAGCAAGAAAAAGCCCGTCTTTGTTTTTTTCTGTCTGACTTTGGGAGATCTGAAGTCCCCGCTCAGTAGCGATGGCAGTGCTGAAAGAAGG
AATACCTGGGCAGTGAGACTCTGGCCGGCGTACATGAACAGAGCCCTCGTTAGTATCTCAGACAGCACCATGTGATACTTAATGACCAAAAATAATAGGAAAGATCCAGAAAATTAATAT
GGATGTATTTCTGTAATTGAAGACTACCATTTCTTACCCTATCTGAGCCCAAAATATCAAGTGAAAAACATAGAGCCAGAGTCTGGAAGGCTTTACCTTATCACAAAGTTCTTCTGAGGC
ATGGTGACTTCTTATCCTTGTCCTCCACCACTGAAGCTCTCCCACGACAAGAAAACCAGCGCTTCCAAGTGATGCCTTTTTGCTTTCTGCCTTCACATGCTCCCGGATAGGGACCTTGAG
GACAAGACTTCCATGAGCAGATGCTAAAGGAAATAGGCTTGAATGTACCCTCCCCTCAGCCCCCCATGACCCTAATCTCATGATGATGGATGCCTGGGCAGTAGGAGGGATGTGCTTTGT
GCAGGTGGTGGATAGGCTCTCATACCTTCTGAATAGTGTCTTACAGCTGTTACCAGAGCTAGAATACTGGGCTAGCTGAAAAATGCTGCTCTAACAAAGTATGGCATTTTAACATTTCAA
TTCTGAATACCAGCTGTTTTTATAAATGAAACCTTACCATTTAGGTAGTTCCAGTGCTCCGTTCTGTTTCCTGCTTTGGTGTAGCAAACTGGGAAGATCAGTTATTCTCACACTCAGAAG
TGATTGAGCTCCCCTTCATGAGAGTTAACAGAAAGAGGCGGTCAGACCCTGTGCTCCTAATGCAAGGTTCTCTTGAGGAACTCTGGTTTGTCTAATTCCCACATCAAAACTGACAAGAGG
TGACGAATTTGCTGATGTTTCCTAGATGGTAACCTTTTGCCTCAGGGTTTATATAGGTTTTCAAGTGATAAAGGGAATGAGTCCTCAAAGGTCCCTAAGAGATGTGCTGGGTAAGTTTGG
CCAGAATACTTGAAGCGCATGGCTTAGAGGGCAGAGTAGCTCAGGTTCCATCTGTGGGAGCTCTCAGACCACAGCTATCTGCCATGGGGTTTTCAGAACTAAATGTTCCTTAACCGAAAA
TATGCTTTTGAAAGAGCCTTTTCCTGCAGCGCTCTGTCCTGGCAGAGGAAGGGCAGTACAGTTGGGTGCACTTTCTGTTTTGTGTCTCCTCCCTGGCAGGATGGCTGGGGAATATTCAAG
TTTGACAACTTGTAAACCACCCTGATTAGGAAACCTTTGTGCCCTGCATTGGAGCGATGCAACGAGGTGAGCTGAGAGGAGAGGAGCCTGTCCTGAGTGCCCATGGGGCTTTTTAAACAT
CCTGGGTAAAGTTCAGACCTCCCCCTGGCTCTCTTCCTTCCTCTCCCTGATGCAGGTGGTTTGATAAACTGCAGAACAGTACTTTAAAGTTAAAAGCAGGAGCTCTGTTTGTATGTGGAG
GAGCTGCAGTCATTACATGCTTCTGGCAGGGGCCTCGCGATGCAGCAGCACAGGTAACAAGCAGTTATCTGAATTCCTGCCCTGCTGAGAGCTCACTTGTCAGCTGTCTGCAGCATTGCG
TGCACTGGGGGAATTATTTGGGGCCTGAATTCTTGGAGCTGTAAGGTTTCCTCATCCCTTCCTTCTGCTGCTTAGAATCACAGAATGGTTTCAGTTGGAAGGGACCTTTAAAGGCTGTCT
GGTCCAACCCCCCTGCAGTGAACAGGGACACCCACAGCTCCAGCAGTGCTCAGACTGTTTAGGAAGCATCATGTGAGAGTAAAAGGTGCTTTGGTGAGCTCTGCAACTCTCCTTCAGATG
CTGCTTGTGAAGCACGTCAGGGTGAGTGAGGGAGTAACTGATGGTGCTGTTTGGGATCTTCTGGTGCCTCATAGAATCGTTAAGGTTGAAAAAGACCTCCAAGATCCCCAAGTCCAACCC
ACTGTGCCCACTGCCCACGTCCCTCAGTGCCACATCTCCAGGGTTCTGGAGCACCTCCAGGGACGGTGACCCCACCACCCTCTGGGCAGCTGTGCCACTGCAGCACTGCTCTTACAAAGA
AATTGTTCCCAATATCCAACCTGAGACTCCCCTGAGGACACAAGTCCCTGTGTGCTGCCAGGATGTCAGAGCTGCTGAATCTTGGAAGAAAAGTTTCATTCTCAAATATGGGAAATGTCT
ATTCCAGATCATTCCGTCAACAAGGGAGAATGTGTGGCTCAGTGTTAAGCTAACTTTTTCTCCCCCTTTAAAAATACAGTACGTGGTGATTTCTATTAATGGTGGGAGGAAAAAAGTGGC
TGTTGCGTCGCAATGACTGCAGCATGTGGTTTGTCAAATGAAAAGAGGAAGGAGTAGATGTTCTGAGCCTGAATTCTGTACTGTCACATCATTTAACACATGCTTCAAAATAGAAAAATG
ACTCATTGAATGCAACATAAGCCTGTGCTTGGCAACCTGGATACAGGGTGGGGAAGGGAGAGGGAGGGACAGACAGAACATAGAACCTAAAGGAAACTCAATGTGAAATGTTCCCATAGT
GAATACAGGCCAGATCGCATGGTGCTTGTGTATCTCAAGCCTCCCAGAAGAATTTTCAGGAATAAAACCTGCATGACTGAGTACATCTATTCATTCTGAGCCAAATTCACCAGCTGTCAT
GGAGGGGAGTGCCACATCATTTTGCTGTCTTGGTAAGCTCCAGGAAATGTATTTCTGATACCTTTAATTTAGCTTATTTTGCTGCAGGGTATGCTTGAGACATGCATCAATAATGATCTT
TCCAGCTTCTGTCTGCCAGAGCATTTATTCCCAGCAGATCTGGTTAGTAGCAGGACTTAGCTTTCAATTCTCTGTAACATTACCAGGAATTTGGGCGTTTTTGCTATGATTGCAGCTGGG
ATCAATATCCAGGTCATGCAAATCATGGCCAGGATTTTGCACGCTTCTTTGCCTGGGTGAAGTGCACAGGAGTCCAGGAACAGACAGCTGTCCACAAGCCATCTGAAGTCTTCCTAGGTT
CCAGATGTGCTGTCTTGTCCATGGATTTCCCTGGAAGTAGCTCTTTGGAATATGTGCAGTGTGATAGGCTTCATAAATTATCTCAATTTTGAGTGTATTCCAGCACATATCCTTCTATTA
CAATAGGGAATCCTGAGACAGGAAGCAGAGAGTGCTTCTTCCATACACTCGTTAACCTTTAATCAGGCAGTGAATAATTCTTTTAAGTATCAGACGATGAGATAAGAGGTCAGCATAGTG
TGTGCCATTTGGACATCCAGAGTTGCTCTCATTTGGCTCAGATCACCGTCCTATTGCCGAGACAACAAAATGGATTTGATCAATGTTTTTCAACAGCACCAAATTCAATCAATCAGTACG
TTGCAATTTGTAATCTCCAGAGATTTCAGTCCAGGTTCTAAGCCTTCTGTGTTAAAAGCTTGGCCAAGGAGCTCAAGCCATGGTGGAGCATGGGATAACAGAGGCTGTCGGTGCGTCTGT
CCCCAGGGTCTGGTGCTGACAGTCCTCCTGTTCCCTGTGCAATGAGTGTTGGTTGCGTGGCAGGGGACAGGTGGGAATGATGCTGGAGCTGGCACCTGCTTATCAGCCCATCCAGCATCC
TCAGAAGCGTGGCCAAAGATCAGATAGCAGAGAACAAGCTGCCTTCTTTCTTGTCCGGCTGCAGATGAAAGCCTGCTGAGAGGGCAGGGAAAGGAGTGTGCGCGGTTGGTGGCTGTGTTG
TCTTTGTCCTGTGGGTAAACAGACAAAATCCCTCTCCTGTGCTGCTCTCGAGCAGTCACTTCCAATCCTTGGGTGTTCAATTAACAAATAAACCTTTGGGTTGGTTTTCAGGGACTGTAT
TTCCACGCAGCATATTTGGCTGTCAAAGCACGATAGCGTGTTCCAAGAGTTTGACATCATTTTTGCATCCTTATGAGCAAAATCGGGTTATGTAGCCTCAACCATGTGTAGTGAGCCATT
GCTTCCAGCTGTGCAGAAGCTTTCCAGCATGTCTCTGTCTGCCTTAACCTCTTCGGGTTGCTTATCCACAATGCTGACTACGTGCACTTTGGCAGTGGTACCCGAGTTTGGGGTAGCTGA
ATAACTGGTCGAGACAGGCAGTGAGTGAGGGTTTTTTCTAAACACTTATTGCTCTGGCTTCCAAAAGATTAGGGGGGTTTTGCACTCAAGTTCCATATGTGCTTTTTGGACTTTTAATGC
AACTCCCCACCTGAAGACAAGCTGGTGGAGGGCTGATGTGGCTCGAGTGGCTGATGGCAACTTGTGAAGCTGCCGTATTACATCTGTGCTTCTAAGATCTTGCATCCCCGGGGCATCTGA
TTGCATCTTCATCTTCTTTTCCAACATGCTTTTTTCCACTTCTTGCTCCTTTGTCTCTTCTCCCTTTACCTGTACACACCCTTCCTCCCAGGAAGGAGCCTTTGCTCGTAGTACCCGAGG
CTGTCTGATGTGCTTTCTGCCCTAATTTCTCCATCAAAGAGGGGCAGAAAATTGGGCTTTCCTTCTGGGAAATGTCTGAGCTGTCTTCTCATGTGCTGTCAGGTGGTGAATTACTTCTGA
GGGCCGTATTTATTCCCAAAAAGGAAAGAGAATCAACTTGGAAAATAAGCTCCGTGGGCAGTCTGAACCGTCCTTGTATTAAATTTAACCTGATACTGTAAGGTCTGACAGCTTACAGAG
GGAACAGCAGCTTTTCCTTCAACACAGAAAAACAAATCTTTGCAATATGAAGTTGCAACTCTCCTTTTTTGTCCACGTCTCCAGTTAGGAACTTCAGAACTAAGGTGAAGTCCTTACTCT
GAGCCATCAGGCTGTGACACCCACCGGTGGCCACAGTAAGCTTTGCTGGATCTGACGCTATGGGGAAAGACCCAAAGGAGTGGTGCAGTTAGGCAGCCACGACGTATAGTTAAATCCTGT
CCATTAAAGAGCTATTTTTAAGTGATTTATTGAGTTTTCGTGGTGTTTGGTTTGGCAGTGGTTGCAGAAGGAGCTTTTGGAGCGTTCAGCTGTGTGGTCACCGCCGTTGTGGTGGTTACA
AGGGTGAATTGCCTTTCTGGTCACTGGCACAGGCATTCATTTGCACCCACAGTCATGGCAACTGCCCATAAAAGCCAGAGATGCCTGCCAACGTGATGCTGCCCGTAGATTTTGTATTAA
AATCTGGCACAAGGCTCTCAAGATTGAAAGAGGCTGTTTCTGCCTAGCAGCAGATACAGGATCTGTAATATTTATTTATTTTTCATCTGCACTAATGTGTATACAGAGGGATTAAACCAA
TGCCTTTCCATTTAACCACTCCTATAACCCCATGCAGTGGCATTTTGGACTGCTTTCATACGGCTAAAACCCGGCTCTGCTCACACAACCATGCACTCCCCAAACCTGTGCAGTTGTACA
GAAACAGCAGTAGTGGTTGAATTTGGATCTCCCCTGTGCTCCCAGCTGTCTGTCTCTCTTCCCCTCATCCTTTTCCTTGTCAAAATGGGGACTTTTGGGTGAAGACCACTGTGGTAAAAG
GTAGGGAAACATCTTTGAGCGTTGTACATATTAGAAGCACATGGCAACAGTGGGCAAGAGATGTTCTTGAGTTATCTGCTGTGAGCATCCCAGCTTTGGCCTGATAACCCCTTTAAATCC
TAAATTCTATGCATTAAGGGTTTTTCTGTGGTCACCCAGCAGTACAAATGCCCCGACTCTCCCACGCTGTGATTTCACCAGCTATGTTTTTGTTTCTTGCTCTGAACAGGCTGCTGAACA
ATAATCAGATAAAGCACATCGTGAGAAGATCCTTTGAAGATCTGGAGAACCTGAAGTACCT
GTGAGTTGGTAGCTCAGTAATCTCTTAACCTCCTTGAAATTTAACAGCTCATTTCTAAC
ATCTTCCAATACGGCTGCTGGGCGGTTATTCTGACGTGTTTTTCTCTCTCCTTTTGAAAGCTACCTTTATAAAAACGAGATCCAGAGCATCCAGCAACATGCCTTCCATGGGCTGCGCTC
CCTGGAGCAGCT
GTAAGTATACACAGTGTGTGTCAGAGCTGAGCTGCTGGCTCATCTAACCCTAATTCTGCACTTCCAGTTGTGGAGTGCACTCAGCAAGGAGTGGGATGTCCGGCTTTG
TTGTCCAGCTGTGCAGCATTGCTTTGGCTTCATCTGCGTACAGCTGGTCCCAGCATTGATCTGGGTCAGGCAATATGAGGACTGTTCCTATGACACCCTATATGTTCTCTCCCAGCTTCA
AACTGCTGGAGCATAGGAAGAGCTCAGCTGTGCTTCGGAATACCTTTGCATCCACAGGCCTTCCAATGGGAGGGAAATACGGACATGTTTGGTGGCTTGAAATAGAGTGTAGCTGCCCTG
CTGTGTTTGCTGTGACTCCTGGAGCACAGTGTAGGGTCTGGCTGCTCTCCTCCATTGAGAGCAGTGGTTGTGTTTCTCTTTTGTTGGAAGCAAATGGATGAAGCCCAAGCTGAGAGCTAG
GGTTGGGGTATTTAAGAAAGCCACCAGGAAGGCGATGCCTGCATGCATTAAAGCATCTGAAAATTCCAAAGGGGAGAATATGATGGAGGCAAAGAAACCAAGTGATGGCCTTCCCTCCAA
GCTGCATGGCACTCTGTGATGAAAGGAGCCTCGTGTGCTCTGCTGGTAGCTGGAGCCTGTCACGGTGATGTTCCTGCATTCCTTAATTGCTCCCCTTCTGCTTTATTGCAAATCTGCACC
ACTCTTTCTAAGTAGTTTTGTTTTTTGACTCTGCTCCATGCTCAAGGTGAGATGGGAAGACTGAGGTCTGACACTCTTCATGCGTCTTACTAAACGGGGATTTGATTCGTCATGTAGGTG
TCACAATATGTTATGTGCATGTGGGGAAATGTGTGTGCTGGAAAGAACAAAAGCATGGGTGTTTTAAGTGCAGGCATTATTTGCATCATTGAAGAACAGGCAGCAAAGGTGAAACCGCTA
ATTCATGGATTGTCCCAGCTGACAGCTTGTAGGGCTCGGATGTGACTAGCAATTTTCCTGCAAAAGGAGTAGAATTCAGCTTGTTCTCCAGGCTGACAGCAAAAGTGGAGGGAGCATAGC
GGGAAGTTCCAGCAAGCTTAACCCTAGCTGTGCTCCCATCCTGGTGTACGGGATGGATTTCCTTCATCCAGCTCTGCAGTGATACCTGGGAGAAAACATAGGAAGCAGATTCTGGCTGTG
CTGTGCTTGCAGAGATGGTGCTGGCCACAGTGATACTTTAACAATGAGTGTTCCAGACTTGATGTCATGAATAAAAGGAAAAAAAAAAAACCAACAAAACCACAAAACCAACAAACAACC
CTCTGAAAGGCCCATCTGTTTTCAGTCTCTCAGGCAGGCATGGTTCCAGAAGAATTAGCTTTGCTCAAATCCTACCCCATTTTCCTGTACCCCACAGGCCAGCTTTCCAAGGAGGGGTTG
TCCAGTCGATGGACAGTGTCAGGTGTTTTCCTCAAGGTCCAAAGCAATGACAGCAGATATCTCAAACTTACTACAGCACATGCATTTCCCTCTCCCCACACTTACTCTCCACCCCAGGAT
CCGAGTCGGTGTGCCTCGGTTCATGCTCTGATAGCACACCGTGCATTGTGACTCCTTCCATTGCAGATCAAACAGCCATGTGGAGGCTTAAGCAATTATTTCTTAATGCGGTCAGCTACA
ATAGCAGAACGAGTATTTGTAGATCCATGATTAATCAGTTTCCACTGTGAAATTTATGCCTGTGTAAAATCAGGGGGAAGAGTTTTGGCAACGTTCGGAGTGCATTGAAATGCCTGTGAG
GGTCAGGAACGTTTCAGTTATGTTAGTAATGTCACAGCCGACGGGAAGGGGGAATCTTGGCTCTCTTGGTCTGTTGCTGCAGACCTCAGGTTTCCTTCCCTGATGGCAGGAGGTGATCTG
GGACAGTGCAAGAGGTCTCCTACACCTGTGGAGCAGCAGGTTGCTTGGGATTTTAGTGGAACTAGCAATACTAACCTTCGTTAACAAGAGCAGGGCTGTTTACATTGGTGTTCCATTTAG
GCCATGGTGTTCCAGCTGACTGCATCTCTGTCTTTGGAGATCGTGTTTTCTGTCTGCAGAAGCTGCATAGCCTGATGGCAGCAGGTCCTGTTGATGTTTCTGCTCTCGCGGGGTGGATTC
GCTTGCTGGGAACTCCTGTTAGCATTGCAGAGAAATGCGGGCTGGAAGAGACCTCTGGGTGTCCCCAGTCTGACCTCCAGCTCCAAGAAGGACCAATTTCAGTTCTATCACGTTGTTCAG
GGCCTTTTAATACAAATGAATTCTTAGCAAACTCATGACCCCTCTCAGAAAGGCTGACAAGTGCTTTATAGCATGGTGCTCTGTTCCTCCCCAGCAGTCCAATGGGAGGCTGAGGGCAAG
GTGAGCAAAGTTGCAGTTGTGGTGGCTGGATGGGGGGCTGCAGCTGCAGGCTGCCCGTGGTAGCAGCTTCATCCTCACACCTAACAGTGCAACAGATTCATAGCAATGGTGGTGGCGGCT
TTAGGTTTAACAGGAGAGCAAACAGGACCTCAGTGTTTGCTGGAGTTTGTAAAGAGTGGGAGTAAATCATTTGGTCTACGGGAAAGACAGCTCTGGATATTTGTGTTGGGAACATTAAAT
ACAATGAAGAAAAGGTTGGCTTCTGAACAGCATCTGCCCTGAGTTGTGTGGTGACTGATTTGGGGATATTGGTGCAGTGATTGGGAAAGATCTTCTGTCTTTTTAAACTGAGATCTGTAA
CCTCGTCCTTTGTGGTTTCCTGTGGCAGCTACCTGCACTTCAACAGCCTGGAAACCCTGGAGCCAGAGACGTTCAGTGACCTGCCCAAACTTGAAAGGCTGTAAGTAAAGATGGGACCTC
ACACGAGAGCAAGGGGAGAGAATGGGAAATAAACCTTTGTTTTCTGTGATGTGAAGCGAGGTGATCTCTGAAATGGAGAGAAATAGAAAAAAGCATGCTTAAAGATGCAGATTTTATGCA
CTTATAAGGTTACGTGATTAATGGGGTTGTGAAGGGTTTTCTCATTGTGTGTTATGTTTCCATCTGAGTAGGGGTAAATCTGTAGAAAGTCAATCTGATTCCAACTGTAAGGTCAGCATT
ACTCACTGCTGGGCAGTGTGGTCAAAGTCCCAAGGGAGTCTAACAAGAAAAACACGCATACTACTTGAAAGCAGCGGGGAATCCAAGTCTTGTGTCTCTTACTCCCTAGTGCTGCTTGTA
GTGACAGTATAGCCATCAGGAAAAGGGCACACACAGTGATTCCTGCTCCATATTGAACCCAACAGACACTTCTTTACTGCATGCGAACGTGCATCCGTGCATGGTGGGAAAACAAAACTG
GGGGATCCAAACACCCTCAGGAAAAGTCAGACCCGGATCAGTCTGCCATGGCTGATCTCAGCGTCTGTGTGTGATCCAACAGAAATTCTGCAGCTACATTTCAGAGCAAGGTTTGTCAGC
ATCCAAGCCGGGCAACTGGGCTGAATGTGCCTGTACACATGCGTGTGCACATAGCTGTGTGCAAGCACGCTGCTTTTAGATTTCTTTTCTGTTCCACCTTCTGCTACAGTGAATTCTTAC
CTTTTGTAGATTGTCTTTTGTGAGTATTAGATGCCATGAATAACTGAATTTTCTCCTTTAAGGAGGGTTAATTGTTCCATCCCGGTTACCACTGCTATGTTTCAGTGCAATCAGTGTTTT
TTTTCTAACCGGAGAGCTTGAATTGGATCTGCTCATGGAGTCGGCTTAGTAACATGGAGTCTGGGGCTCGTCTGCTTCTGCTGGAGCCTCACTTCGGTGGCTGCCCCATACAGCTTCCAT
GTCTTGTGCAGGGAGGAGAAGGAGGTCTCCTCTAAACCAGAGCTGACCCAGGTGCAGAAATCACAGGGTGGGTCCAATCCACAGGGATTTGGTGCCCTTTCTCCTCCCTTTGCAGAGCAC
GAAGCAGATTAACTTGAAGGTTCCAGTTTAAATCCATTACATCACGTCTTGAGTCACCGTTTCCAGTACACACCCGCTCTCTGCTTTGGTGTGCTGCATTGCACTCACAAGCAAACACAA
TCTCTGTAGCTCGTGGAAGCAGCAAACGCAGTAAATGTAAAAAGTGAGCTCCATCTTGGTGAGCAGCCTTTGTGCTGAAGCTGAGTTTTGACCCGGGATGTTACCATCTGCAGTGCAAAT
ACTGAATAATGTTTTGGCATGGGTTCTTCCATTGCAGATTCTTGCACAACAACAAAATTTCCAGGATTCATCCAGGGACATTCTCTCAACTGGAATCCCTCAAACGACTGTAAGTGAAAA
ACATTGCCTGCAAAGAGCATTTGTTTATCTTTGATCAGATGGCCAGGACCTGAGGAAAAATGTGCCTGGTTGGCAAAGCTCTCAGTTGTTGCACTTCTAAGGCCACTCTTAAGTTTATAA
AGCAGTTTTGGTTGGACGCAAGAGCTGATTTAACCAGTTAGTAGTTACTTCACACTGGTGTCTAATTAAAGTCTAGCTCTAATCTTCTTAGAGCTCACTAATGACCCAGGAATGAGCGTT
CCTGGAAAGCCATCCCAACCCTCTCCTGCCCTACGTTCTCTAATCCCATAAAACGTCCTGCAGAAATGTGGGATGTCCAGGCCACGCGTGGGATCTCCATCATGTCTTCAGTGTCCCAAC
GTGGAAGGAAAAAAAACGTGCTCAGAGGGGTCCCACAGTGCTCGGTTCTCATCCATGAAGGAAAGCCCTGCTGTGTTGTTCCCGTGTGACCTGACAGTCTCTTAATCTTGCATTTTGATT
GCTTATACCCCTTAGTACTTAGATTTGTTTGTCTTTTGTGACCTATGGGCGTAAGTTCTAAGGTGCTTTTCTTTGGGAGGGGGGAATAAAGCAATGAGAAACACACAAAGGATTTTGGTG
TTTTACCACGATTTTACGCTGCAAGAAAATAAGGTGCTTCTCACTATCTCACCACAGCCCTCTGTGATTTCTGCAAGCAGGTAAAATGCTTCATATTTTTTTGAACAGAGAACAGCTCAT
GAAATGTTGTCTGCATATGCCAGGGAAAAAGATGTAGTGTCTATAAAAAGCCCCATCGTGGCCTCGTGTGAAATCTCACTTTCTCAGATGTTTGTCCATTAAAACGTCAGGCCTTTCCCC
CACGTATCCATATGGCTAAGACCCATCTACTATAAAACTGTCTGTGGGGAAGGAGACATAAGCTAATCCCCCAGCAGCCTCCTTATCCTTGCACGTAGCCCTGCATGTCGTAATGAGGTC
AGTGGGAGGAAAGGCGCGGGTGCAGCTGGAGGTCACCAGTGCTCCCATTCGACATGTGCTGCAGCAGTAAAAGTTCTTACAGCGGTGCAGAAATGCTGCAGCCTCCAGGAGAAGATTGAT
CCCATGCACACTGAAATCATGGAGGTGTTTTTGCTGATTTCGGCATACTCCGGCAATGGCTTATGCAGGGGGATGTCACGGTGCTGTCATTCCCATGTGTTCACTTGGATGCATTGCATC
TTGCAGGCTATCTGGTTGGTGAAAAAAGGGTGACCTTATTATGCATTGTTGTGCTTTGTGCTTCTGCAAACGAACTGCGGGATTGGATTTTAGCACTGGGGCCATTAAGTGTTCAATGCT
ATGCACAATCAGGTTTAATAGAATGACTTTTGTTTGAAACTGGGGTAGCTGATAGGCAAAAGATCGTCAGCAAAATCACTCTGACTTGGTTGAGCACCCTATCCAAATTGTTGTGGGAAT
CAACTATCTCGGATTCTGCTTTGGGTTATGATCAAATGCCAGGCAAAGCGGGCGATTGGGAGGCTGGGGGCTGACGTGCCTTCCCCTGCTGTTGCAGGCGGCTGGATTCCAATGCACTGC
TCTGCGACTGCGACCTGCTGTGGCTGGCTGAGCTGCTGCAGAAATACGCTGAGTTGGGCAGCATCCAGACTGCAGCCACCTGCGAGGCCCCGCGGGAGCTGCACGGCCGATCCATTGTCA
CCCTGACCGCCCAGGAGTTCAACTGTG
GTGAGTGGGGTACAAAAATCTCAGGGCTGGGCTCTGGGCTTGGAACTGCTTCGTCCATCTGGGAGTGATGGTGGTCAGTGAGCTGACTGTGAG
CCAGCAGTGTGCCCAGATGGCCAACAGGGCCAACGGCATCCTGGCTTGTATCAGAAACAAGCACAGCCCTGCATAGAGTTGAATTGGCACAAATGGGCTTGTGACCTCTAGTACATGAGA
GGAACAGAAAAGATCTGGAGACAGCAGCTGGAACAACCTGCTGCCATGGGCTGTGCTACACCATGAGCCATTCCTGCCACTATTGGAAATTTGACCTGCTTTAGGCATGGGCACACAGTG
GGACATCTGTCAAATTACCCAGAGCACCTGTGGTGGGAACATTTTGCTGGCATTAGGGTATTATGCTGGTCTTGTGCCAGCTGGGGAAGACAAATGATGCATAATGCAGCATAAAACCCT
AACAATGCAGAGGGCTGATATCTGAGTCAGGATGGAGCCTGCTGGCATGAAGCTGACCCACCACTTCTTAGCAGATGTCAGCTGGCAGTGCAGGTTTGCACTGGGTCAGCATTTTGTGTC
ATGGAGCTTCATCAGCATCCTGGAGGTTGGGCACCAGCTTGTAGGCTGAGGAACAAGGGCACAGGCCTTTCACTGAGCAAGGTGGCAGGTTCTCTCTTAATCTTATGAATAATCCAGCTG
TTTTCACTGGATTACTGGTCAGCATAGAGATTATTACACGAGTAATAAGTATTCTGCTGAAATGAGATCAAGTGCTTTAGACCGCGTGCCTAAATTCCTTCCTATTTTAGCACATCCCTT
GAATGTGTTTGGCTTGCTCAATGCATGAGTACATCTTAAAATGAAGCACGTAGTGAAAACCTCAGCTGAATAGGGTTTGGCCCTATTCAGGGACATAATGAATGAAATTCTGTCAAAAGG
GAAGCGTTGTGATTTGCAGAGAGCTGGCACTGTTTGGATGGAGCTAGCAGTCACTGAGAGCAATGGGCTGCCAAGGGCATGAAAACGAGAACATCCTCAACCATGTGAGGATGTCACCAA
CTCTGTTTCGGGGAGCCAGGGGCCAACTCTTGATGAAGCAGCACACGGGGAGTTTTTGTGCCCTGTGTGGCTGAGCTGAGCAGGAGGCAGCCACTGGCCATCAGAATGGCCACACCAATC
CTCAAGGGCACTTGGGCTTGAGGTGCTGCTCCACTGCTGGCACTGTTCGTTTTGTTGATGCTGGTAAGGGGTGTTGGGCTGGCTGCTGGCGTGCTCTCCTGGGGGATGGTTGCACTGGAG
GTGGTTTTGTGCTACCAGGTTGCATTAAAATGGTCTTTTGCAGAGAGGCCTCGCATCACCTCAGAGCCCCACGACGTCGATGTCCTCTTGGGAAACACAGTTTATTTCACATGCAGGGCA
GAAGGCAACCCAAAGCCTGCGATTATTTGGCTCCACAACAA
GTAAGTGCCATACAGTGAGCTCTGGGGTAGCAAAGGTTCATACCAAGCACTGAACTTTTCACTGACTGCTGCAACTACA
GAGACATGCAATGTTAAAAATATAGAAACAGTTATCCCGTGGATTGCATTTGCCTTCTTCTTAATGGTATCCTCTGATGACCATGTAATCCAAGTTATCTGTATTTAAAATGTTTCGCGT
GTGTTGCAGTGGATTCCAAGAGTTTATAACTGTCCTGTAAACATGCTCTGCTGGCTGAGAGCAATTGTCTTCTGATAGAAAATAAAAGTACTTCATGTTGCTCTCAGCCACCATATTTGC
CATTTATGAACTGCTGAAATGCTTCTTTTATCTGGGTTTTTTCCTCACTGAAGGCCCAGTGTGCTGGGAGTGTGCTTTTCTATCAAGGGGAAAATCACTGAGCTCCACTGAAAGACAGAC
CTCGCAAAGCAGTGTATAGATGAATGTCCTATACAGCAATGCTGGAAAAAAATATATGGCTATGCTAGGTGCCAAAGCATTTCTGAGCAGTGCTACACAATAGAATATTCTGTGCTCAAG
CAGTTACCCACTGAGGAAGTAAAGTTCCCCAGCTGCTTTACGAGCTCCTTGTCTGGGGGAGTCTGAATAGGGGCTGGTTATTAATAAAAATGATCAATGTGTGCTCCTTCAGTTAACTCC
CCACTAGGCAAAATTTCAGCGCAGAGCAAAAGTTTATGTCTGAGTTATGTCCCCTCGGACGGAAGATTTTGTTGGGGAAATGCTGGCAGGTTCCCAAAGATAGCATTGTAAGAGGGGTAA
TGATAATAAATGCTCAGCAAATGAGGTATGACTACAGTGAGGAGACATCAGGGGAATTAAATAAATGCCCAGCAAGCATGTTAGTTTGCATAGTGGATTCAGCCTTTGTCCTGGTGGGAG
TGAGGTCCCCTCTCCCTTCTCAATCATTTGCAGCCATCCAGGGCTCCTTCATGCTGTGACAAATGGGGTGTTGCAGTGGGACCTGCTGCTACAGGCTGGGTTCTGGGGCCTGGAGCCATT
GAAGAAAGAGGGAAGATGCTTCACAGCTCTTACATCCCAGACTGGAATCCAGGCTATGGTGGGGTCCCATGGTGCCTTTCTCAGAGGTTTTTGTCTCCTCTAAGGCTCTTGGGCCCATTC
AAATAGGAATGGCTGCACACAATAACAATATGCATTTGTTATTATATTTACATTTAGCAAATAATAGGAGCAAGCTTTCTGAGCTCAGATGCATGGCAATAGCAATGATGCTATTGCATG
GGAACAGTATGCTCTCCTGATGGGCTGTAAACGTCACATATAGTCAGCAGTGAGAGAGAAAATAGCTCATCCCATCCAGGGAGTAAATCAGAGCTGGAGCTGGAGTTCAGTGCTCTAAAT
CATAACCCTTGCTATAAACGTCATGAAGTCTCAAAGCAGTGTCAAGGAACACCAATTTAATCTAATGCACATGAAGCCCCCTGGCAGCTTGTGGGAAGAACGTTTTGGCTTTCCCCCTTC
CAACTTTGCCTGTTTGTGGCTGTCTTTCAGTAATGAGATTGACATGAAAGATGACAACCGCTTGAACCTGCTGCAAGATGGCACCCTGATGATCCAGAATACCAAGGAGTCGGACAAAGG
TGTCTACCAGTGCATGGCCAAGAACATCGCTGGGGAGGTCAAGACCCAAGAAGTCGTTCTACGCTACTTTGGCACCCCAT
GTAATTGAGCCTTGGGTACCCCTTGTTGACTTGGGAGTGT
GGTTGGGGCTGGAAGTGGAGCTGATCACTGAATCTTTACTTTATATGTGTCAGGTGTTTCTTGGTGTGCTGGGGAATAGAGCGGCTAATAGTTAATGCCATCTGCGGGGTGGTTCGTTCA
TGGGAGTTGGAAATTGGGAGGTTGGGGATTGGAGATGATTTGGGAGTAGGGAGGAAATTCGGAGGCTGTGAAGAATTCTACAGAGTGATGGGGACACAGGGGTGGGGAAATGTCAGCAGC
AGGGCATGGGGAGGTTGTGTGAAGGAAGAGGGGCTGGGGGCATTGCTGAGGGTTTGGAGGTCAGGGAAGAGCTAGATGGACGCTAGCTGGGCTGCATGAAGAGTGAGCAATTTCAGTCCG
TAAGCAAACAAGCAGCAGGGCTCCTGGTTTCTGAAGCACTCGTTTCCTTCCAGCCAAGCCCACTTTTGTGATCCAGCCGCAGAACACTGAAGTGCTGGTTGGGGAAAGCGTCACCTTGGA
GTGTGGGGTCTCTGGGCACCCCCACCCTCGCATCAGCTGGACACTTGGCACAGGCTCTCCTTTACCGCAGGATCCCCGCTTTGCTATCACCAGCTCTGGAGGACTCTTCATCCAGAACGT
CACCTTCTCAGACCAGGGACAGTACAACTGCAATGCCAGCAACACTGAGGGATCCATCCAGGCGACAGCGAGGATCATAGTGCAAG
GTGGGGAGCCCCAGGCTGGTGCCATTTCTGGGGT
GAAGTGCTCGGTGTGTGTTTAACCGCTGTGCATCAAGACTAGTTAATTTTCATGCTCCCATGATCTGAGAATGAATCTGAGCTTGTGCTGTGATTATTTTTTGTTTTGCCTGCTGCTCAG
TCACTGCTTTCCCTTCCAGATTCTCCCAGGTTTCTCCTCGTCCCCACTGATCAGACAGTAACTGAGGGACAAAGCGTGGATTTCCCCTGCACTGCTGAGGGTCACCCCCCACCTGTGATT
GCCTGGACAAGAGCAG
GTATGGCCTCACTTGACTTGGGTTTTCTCTCTTTGCCACCATCCACAGGGTACGGGTGAGAAGAGCTGTGTCGTAGATCACCAAAGATAATGTTAAGCACTGAG
AAAGGCTGCCCAGAAAAGCCATGGATGCCTCATCCCTGGTGGCGTTCAAGGCTAGGTTGGATAGGGCCCTGGGCAGCCTGACGTGATGGGGGGTAAGCTGCCCACAGCAGGGGGTTGGAA
CTAGATGATCTTTAAGGTCCTTTCCAACCAAAGCCATTCTGTGTGAGAACATATTCTCTTAGGTTATCATGTTGCAAAGGAGGAGTGTGCCATTTTTCATCAGCATGAAACCTACAGAAA
GCCTTGAACATCCTCCTGCTGAGGCTTTACCTCCTTTGGAAGGGCAGGGTCTGGACACCACCATGTACCAGCTCTCTGTCATTGCCATCGCTTTGCTTCTCTTGATGAGCACATAGCAGG
AGAATGCTGGTCGCTGCTGACACAGCTCTGAGGTTCCTTTTAGCTTAGGAAAAAGCACTTTGGGCCAACAGGTGGTGGTGAGCTTTTAAAGTCTCAGATGATTGTTAACGCTGGCTCCAC
CAGACTGATCCCATCTAACACTTTCTGGGACAGAAGCCAATAATGCTTGGCCCCGAGGCCCTCCAACTTTTCCTTATGCTTCACAAGCCATAATTAATGGTTTAGTGCTGTGGAGGATTC
ATGGCTATTGTATTCCAGCTTTCGCAGCAATAGCCCTGACGTGGGGTTAAAAAGGACCGGCTGAAATTCTCTACCACACTCTCTATCTCCTTTAACCCAAATCTCTGGTAGAGATGGGGA
AAGGCCTCAGTGACAAGAGGTAAGATTAAGAAGGCCGTTTTGTAACCAGATTTGCAAGGTCATTTGGCAATGCATCAATTAACCAAGCTTTTTAGCTCTTTCATGTATTACAGCCAGGAC
AAGAGGACAAGGTGGAGTGGAGCACAGCTCATCCTCAGAGTCACTTCTGGCAGCGTAGGGAGGGTTTGGATTCCTCATGGTATTTGACATAAATAAAGCCCTAATCTGGAAGAAGGTGAA
TATTTAAAGGAAAAAAAGTCACCTGAGTTCTGACATTTTAGAGGAAGTCAGAAAAATGTCTATTTTGAATTTAAGAAGAGGAAATATTGAAACAGTGCAGTTTCTAACCTGAAGAAAGCC
AAAATGTTGAATTAAGAAAGAGATAGTTTGAACTGTTTCCACGTATTTGATTAACCACATGGTTTGGTTAATTGAACACAGAGTTGCTATCCATCAGGTGTCAGTGAGCCTGCAGTTTTC
ACTAAGTAAAGGCTTAGGAGGGAATTAAAAACATACCATCTCCTTCCCATTGCTTAGGCAAGACGACTCCATCATCTTCCTGGGTGTGGGAAGAACAGCATCTGTCCTGTTCCCCTCTTA
GCAAGATGAAGGCTGTATTTCAGGGTGACTGATGGCACGCTGGGGGAGGAAGCGAGATGATGAGCTTGTAGATACACCAGTGATGGGAGGAGAAGCCTGAGAGGTGATTAACTAATTGAG
CTGTTTGTTGGAGCAGGGGGACCGCTGCCGAGCAACCGGAGGCACAGCATCCTCTCCACGGGGACCCTGCGAGTGATGAGGGTGGCCCTGCATGACCAAGGGCAGTATGAGTGCCACGCC
ATCAGTGCCATTGGGGTGAGGACCCTGCCCGTGCAGCTGGCCGTGACCCCGCGGG
GTAAGCTGGGGTGGTGGGAAACTGGGGCTGACAAATGGCTCTCGTTAAGTTAATGTCATGGTGAA
TAAGGCAGCCGGGGAGCTGTGGGATGGGATTTTGCCTTTGCCAGGGTGCAGAAGTCTGGCCACCAGAGCTCTATCAGTTGGTGGGAAACTTGAAGGAAGCTTGCAGAGTGCCAAGAGTTG
TGAGTTGGAAGGAGCTGCTTTGGTTTTCCTTCCTTGGAGATTTATTGAGCTGTCAAGAAAGAGTATAACTGTGGGAATGAATTCATCTGGGGTAGGCAGTGACTGGGGGAAGGGCTTGTA
TGCACCCCACAGACACCGGACAGGGCTCTGTGACCAAGGAGTGGCCTTGTCCTCTAACACTCATCAGATGAGCTCTGGTATCTGGCCAGTTTGGGTGAGACATGGGGCCCTTCAGTGTGT
TCAGAGCTTCTACTAAGGAAGTGATTTTAGTAAAGGAAAGGAAACCAGAGGTTTTTGTTGGAAAATTTACAAGTTGTATTAACTGAGTTCTAGTAATATTTATTTATTTAATTAATTTGG
GCCTTCCCATACAACGAGCCGTGAGATTCTTTTTTTTTTTTAATTGTTTTTTTCGTTTTTCATATTTAAAAATTCTAAAGAAAAACGCCCGGTTCCCCCTCACCGAAGCATAACTCTGGC
TCCTTAAACGTTAGCTTAAAGGGTCATAGGTTCAGCCTAAATTTAGGTGTTGTTGAATATCAAGCCTGTGTAGAAACACAAGTCATGCAGGAATGTGTTTTCATTTTCTTTTTTATTCCC
ATATAAATAATCTTCCTACATGAGCAAACGTTCCTGCTCTTTCACGGGCTTGACAGAATTTTACTAATGGTTGGCTGGGTGGAAGGCAACTAGAAACATGAAATTAGTAATGCTTAAAGA
AAAGAGCTCGCAGAGTACTTTAAAAGCAGAAGGATCAATAGAATGGCTTGATGTGACCTAACACTTGCCAGACGGCTTCATCTGGTAACTCCTGAGTAAGTTCATAATCATCACTTCAGC
TTCTGCATCCCTCCTATGCAGAAAGGTTGAATTGGGCTTGTTTAGCTTGGAAAAGAGAAGGCTGCGGGGAGACCTCATTGTGGCCTTCCAAAACTTGAAGGGAGCGTATAAACAGGAGGG
GGAATGGCTGTTTGCAAGGGTGGATAGCGATAGGACAAGGGGGAATGGTTTTAAACTGAGACAGGGGAGATTTAGGTTGGATATTAGGAAGAAGTTTTTCACTCAGAGGGTGGTGACGCA
CTGAACAGGTTGCCCAAGGAGGCTGTGGATGCCCCTTCCCTGGAGGCATTCAAGGCCAGGCTGGATGTGGCTCTGGGCAGCCTGGTCTGGTTGGCGACCCTGCACACAGCAGGGGGGTTG
GAACGGGATGATCTTTGAGGTCCTTTTCAACCCAGGCCATTCTATGATTCTATGATCTTTAATAGAAATTCATTTAATGGAAGATTTTAAATGGCAGAGAAGCCAGCGCATTCCCATATA
ATTGCCCCAAATAGAGATGCACAAGACTAGAAAGTAACGAATGTAAATGATGGGGGACGTGGTGGAGAGGCAGAGAACACACTTCGGTTCAGAGAGCCCTTACAACAGCACGAAGAGCCA
TCTTCCCAATGGTGAGATGCTTTGTACGTGGGTTTGTTTTCCTTCATGCATTTACTGTGTCTCCCCTGTGCTATGCAGTGATTCCTGTGTTCCTTCATCCCCCCCAAGATGTGGTGGCAG
AGACAGGCCAGGACGTGGCGATCACCTGTGCTGCCCAGGGGGACCCACGGCCCACCATCACCTGGGTGAAG
GTAAGGAGCACTGTGCTGCAAAGCCAACATTTCAACTGATTTGAGTTCT
TAAAGGCTTTAAAGGAACGTTGCTGTTTCTCAAGCTCAAAGCCTTGCAATGCACATTCCTGTTTTTTATTGCTCTTCTTTCCAAACAAGTAACATAAAGCCAGTGACCTTTCAGGATGTT
AGGGATGCTTGACTGACTGTTCCTGGAGAAAACTGCAAAGTGATTGTTCTTTTCCTAAGTAGTTTTGCTTATTTCCAGGATTCCCACTGCTGGAGCTGGATATGGTGTTGGCTGGCTCTA
GATTCGATGGGACAAAGCCATGATCCTTTACAGTCTGTCTGCAGCTTCTCTTTTGAAGAATTTTGAAGGCTTCTTTTGGTGGAGCTCTTCAGGCTTTTTCCTGCTGTTCCATAGCACTGC
AGCTGGGACCTTCCCTGGGACCTTCCCTGGCTATGAGCACAGTCAGGCATGCAACACATTATAGGGGAAAGGAAATAGCTTGAGCCTCATTTCTCCTGTGGAGATCTGCTGGCAGGTGAC
ATGCAGCTTTCCAACAGTGGAGCAGAAGGAGAGAGGAAGCATTAGATTGGATCAGGACAGCAAAAAGGTGTTAAGGAGATGGAGACCAAAGTAAAACTGAAGCCCCCAGCCAGGCTGAGA
GGTGTGGTCAAGCATGGTGCTGCTCAGAGCCAGCAAAAACTGCAATCTGCAGCCCAGAGCCAACAAAAAACCCTCAGTTCCAGGTTAGCCCCAGGGTTATTTCGACTTATTCCTGCAGCA
CAGAACTTCTATGCCGGCCCATCTGTGTGGAGTGCAGAGCAGCGGGCGCAGCTCCCATGCCCTGCAGTGAGTGCTGGAGGCAGAGCAGGATCAGGAGCTGAGCACGATGTCCTCGCAGTG
GCTCCAGGCAGCAGCAGCTGTCCTTGGATGGCTTTCTGCTTTCTCTCGAAGAGCAGTGCTAACATCTGGTGGCCACATCGGCTCATCGCATCCAGTTTGCTGAAGGCTGGGATGCAGGGG
AGCTTTCCCCACGCTGACACAGTTTCTGTCTTTTTGAACAGGAGGGGATTCAGATCACGGAGAGCGGCAAGTTCCACGTGAGCCAGGACGGGACCCTCTCCATCCAGGATCTTGGCGTGG
CTGACCAGGGCAGATATGAGTGCATAGCACGGAACCCCTTTGGCTTCACCTCCAGCGCCATGCAGCTCACCATCACCG
GTAGCGTACCTCCTGCTGCTGCTCCTTTTTGCCCTCGTGCAA
GCAAGAATTATGTAGTGTTGATGGCTGCACTTTGAATTAGAGTTTTATTTCTTATTTCTTTAGCTTTGCAGACAGGTTGCTCACGAGCATGAAGGGGAGAACCTTCTTAGCATGTGCCAG
CACGCTCCCATGTCTGACCCAAATCTCACACACTGGGGAGGGAGAACAGCACTGTTACTGCAAATCTGGGGTTTAAACATTCCCTCTGTCCCCAGGGAAAGCCTCTGCTTTCCAAGCAAC
CGCTCTGTGCATTAGGGAAAGTGGAATGAATAAAGAAGAGCAGCACTCCTCCGCTGGTCAAAGCAGAGGTCAAGTGTGGCATTGTGCTTCATAGAGGGGAAGGAGGAACTGATCAGGGGC
ACAAATGCAAAGGCAAGCAATGAGGTTAACGATTTGAGTAGGGACTTTTATCCAAGCACGTAGGAATTACCAGCAGGAATAGTGAGCAGCTTATTAGGTGAAATTAATATCATTTTCAGG
GACTGCATGCAAGGGGCTGAAAATAATCTGAAATCTCTTTGTTACTCGGAATTATTCCTGAGATAATTTCTGTGATTTATTCTTGGTTTGTACCTCATTTCCCAGCTGCCTGCTGTGTGT
GCAGTGCTCAAATAAGGACTGGTTTGTTTTGCTGTGAGAAAGGCCCTGGCTCAAAAAAAAAGCATTTTTTAGGAATTTGTCATTTACTTCTGGAGGTATTCAAGCAACAGCATTCATTTT
TTTTGTTGTTGTTGTTTTAGAATGGTGGTGTTGCTGTGCTAACACTAAATTCGAGTTGAATTAGAAGTGTCCCACAAATGGAAAATGAACGTGGAAGTGGTGCCTTCAGATGAATGCCAT
GAATTTTAGAAATGGCCTCTGTGGGGGAATAAAAGCTTTATTTTCAGTTCACCCACTGAGATTTGTACATTTTCTTTCTCCAGTTGAACCACGCACCAAAACAGGCGTTCCTTTGCAGAG
CTGTACAGGAACAGATTCTGAACGCGTGTTGCACAGCCATCTCCTGGAAATATCACCTCTTTTTCTTCTTACTTTAATTACATTTAAAATCTAAATTTAATTTAATTTCTTCTTTAGAAT
ATCTGTTAGAAAAAGGTGGTCGAGCTGCAAATGGAAATGCAGTTTGACCTGCAGCAGGGTTACTGTGGTGCCTGTCCTCAGGCAGATTTTCTTGAGCTTGGAAGACAAATGAACATCCAA
GTAAATGCACAGTATTTGTTCTCTCTTCCTGCTTTGGAAAGCCACTGATGTTGGTCGGAGTGGTGACACATTCGTAGCCACGTCCCTGCGGGAAGCCATCAGCAGTGTGGACCACGCCAT
CAATTCAACACGCACTGAGCTGTTCAGCAG
GTAAATGCGTGAAGGGATCTCACATCTCAGTGTGAGATGGGGACAGGAGGCACTGAGGGAAGCTTTCTGAATCTCGTTTTATCACTGACA
ATCCGCAAATGAAAGCTACTGTATTGTCCAAGGTATTGAAGGTTGAAGCTGTACCATGTAGATGTAAGGGTGTGCTGGAATTTCATGACAGGAAGGTGTTTGGGATCCTGGAAAAAAATG
GTATATGAATAGCACTTCTTACATCACATGCATCTACTGCATGCTCTTTGTCAACTGGGGTTGGCCCTAGAGACAGTACACAGGCAAAAATAAATCAGCATAGTTTCATGAGTGCAGCTG
ACTTTGTGCAGGAGGAGAGAAATGCTGATACAATTCTTAGCATTTCCTCAATGAAAAATGACATCTAAGAGAGTGAGAATTCCTTCCATTTCAATTCCAAAGTATGGGCTTTGTTGAAAC
AAAAACCAGGTTGTATTGAGCCCCAAACCTCTGGGTTTTGGTGGCTGAAAAATAAATGGCTACAGGAAAAAAAAAACAACCAAACACAGATAGCAAGAAAATTAAATATGGTTACTTTCC
TGGGGGAATATATCCTGTCTTTAATCATCCGTAACATGTGGGCAAGCTGCATTTATGTGTGCTGGTTTCGGGGGTCAAGCACCAAGGCAGGCTGAGAACCCAATTCCTGCAGGGTCCCAT
CGCTCTGAGCACTGTGTATTTATTGTAATGTTCTTCTATTTCCTTCCTTGGGACAGGCGCCCCAAGACACCCAATGACCTGCTGGCCCTCTTCCGCTACCCGCGGGATCCTTACACCATT
GAAACAGCCAGGGCGGGTGAGATCTTTGAGAGGACTTTGCAGCTGATTCAGGAGCACGTGCAGCAAGGTTTGATTGTGGATATGAATGTCACGG
GTAAGGGAGATTTTATTTCCCTTCTT
AACCACATGGGTAGTGTTAAATTAAAGTAACAATGTGTAGGCATGCAGAAAATTTAAAAGGTCTTGTGCAACGTGCCAAAATGTCTCCGTCGATTATAGGTATGGTAAGAAATGTGTTGT
CTGGGTTGCAATTCTATCTAAGATCTCATGGGTGTCATAACAGCCAGAGGGTTGTGTGGCTGCTGAACCAGCTCAGCACTCAGAAGAGTAGTTCAGTTTTGCTAAATGTTTCCTGATTGT
CTATGAAGACATTGATCTTTATAAACCCATCTAACTCCTGCAGCTCCAGAGAGGGGCTGAGCATCAGAGTGCCTCTGTGGGTCTGAGTTTTGGTCCTTCAACAGATGTTCCATAGAACTG
TGATGGTTGGAAAAGACCTCTCAGATCCCCAAGTCCAACCTCAGCCCACCCCACTGTGCCCACTGCCCACGTCCCTCAGTGCCACATCTCCATGGCTCTGGAACACCTCCAGGGACAGTG
ACCCCCCCCAACTACCTGGGCAGTTGTGCCACTGCATCACCTCTGTTTCAGATACGAAATTTTTCCTAATATCCAACCTGATTTCCTGCCTTCCAAGTGGCAGCAAGCAGAATATTGGAA
ACTGGTGTGTTTGGGTGCTGTAACAGCAAAAGGGGATCTCACTCCTGATTTTTGCCATGTGTGGCCTTTGAGCACTTTGACCTCTTAGCTACGAGTTCTCACATGTCCTGGCCATTCAGA
TTCCTCTTTTTAGGACAAGATCTCAAGCACAACAGCAGTGGAACACCATGATGCTGTGCTGGCTGGAGATCACAGAATTGTAGAACACCCTGAGAAGGCACGCTAAGGATCGAGTCCAAC
CCCTGGCTCTGCACAAGACCACCCAAAAACAAGATTGTGTGCCGAGAGCAGTGTCCAAATGCTTGCTGAACTCAGGCAGCCCAGGGCTGTGACCACTGCCCTGGAGAACCTGTTTCATGC
CCACCACCCTCAGGTGCAGAACCATTCCCTGATATCCAGCCCAAACCTCCCCACAGATCCCTGCAGAGATCCACGTGCCCCTCAGTAGCCTTCCTGTGTTTGGACATTTCCATCCACTTC
ACGTTGCCACCTATACCTCTTAGTCATTGTGTAGCAGGAATGTATGTTTGGGCCAGTAAATACTTTATGCCTGCCTGGATCCACTCCAGGCTGCAGGGAATCTCCTAGCAAGCTGCAGGT
CAGGTCTGGGCTCGTTGCCCTGCCAGCCTCTCCCTGTTCCTGCATACACCGCAGCATTATTCAGCACATCGCGAAGTCACCGACAGCTTCCCTGCTGTTCGTCACGTAGAGTTTGGGTGA
TCAGTGGTGCTCAGGGTTGCAGCAGTAACCCAGGGAGATGTGGAATAACCGCAGTGCTGACTGCAGAGCGGGAACCAAGCCACCTTGCTGTTTGGTCTGCCAATCCCAGCAGTTCTGATT
TCCATCTCTGCGTGGTTCACACTAAATCCTTTTCTTTTCAATGGGTCTGATATTATCTTATGCTTCCATACGTTCTGTATTTCACATGTAGCTTGGAGATATGGTCTTCCCATGCCCATC
CTGGGAATCCCATAGCAGGCTTCCAGCAGCACCCTGACATGGGAACCGGATGGCACAGCGATGGGCTCTGACAGTGCACTGTTGGTTCCATTCGCAGGTTATCGTTACAACGATTTGGTG
TCTCCTCACTACCTGAACATGATTGCCAACCTGTCTGGCTGTTCTGCTCACCGCCGCACGCCCAACTGCTCCGATATCTGCTTCCATAAGAAATACAGGACCCACGATGGCTCCTGCAAC
AACCTGCAGCACCCAATGTGGGGCGCTTCTCTCACCGCCTTCCAGAGGCTCCTCAAACCTGCTTACCAGAATGGATTTAACCTCCCTCGAGGGTTTTCCTTGGCAGAAGATGCCAGGGAC
CTGCCCCTTCCCTTACCCAGGCTTGTCTCCACCGCCATGGTCGGGACTGAGACCATCACCCCAGACGAGCAGTTCACACATATGCTCATGCAGTGGGGCCAGTTTCTGGACCATGACATG
GACCAGACGGTGGCAGCCATCAGCATGTCCCGTTTCTCAGACGGAGCACCCTGCAGCCAGGTATGCAGCAATGACCCACCCTGCTTCTCCGTCCTGATCCCCGCCAATGACCCACGTGTC
AGGAATGGGCGCTGCATGTTCTTTGTGCGCTCCAGCCCCGTGTGTGGCAGCGGGATGACCTCCCTGCTGATGAACTCTGTCTACGCCAGGGAGCAGATCAATCACTTGACCTCTTACATC
GATGCCTCCAATGTGTATGGCAGCACCGAGCAGGAATCGCGTGAGCTGCGGGATTTGAGCAGCCAGAATGGGTTGCTGAAGCGAGGGAGGGTGGTGCCCAGCTCAGGGAAGCACCTCCTG
CCCTTCGCTGTGGGGCCTCCCACTGAGTGTATGAGGGATGAGAATGAGAGTCCTGTGCCATGCTTCCTGGCTGGAGACCACCGTGCCAATGAGCAGCTAGGGCTCACGGCCATGCACACA
CTGTGGTTCAGGGAGCACAACCGTGTTGCTGCTGAGCTGTCTGTCCTCAATCCCCACTGGGATGGGGACCTCCTGTACCACGAGGCGCGGAAGATCGTGGGTGCCCAGATGCAGCACATC
ACCTATGCCCACTGGCTCCCCAAGGTCCTTGGGGAAGCAGGGATGAAGATGCTGGGTGAGTACAAAGGCTATGACCCCAATGTCAACGCGGGGATTCTCAACGCTTTCGCCACTGCTGCC
TTCCGCTTTGGGCACACTTTGATCAACCCCATCCTGTACCGGCTGAACGAAACCTTCCAGCCCATCCGCCAGGGCCACGTCCCCCTGCACAAGGCCTTCTTCTCCCCTTTCAGGATCACG
CAGGAGGGTGGGATTGATCCACTCCTCCGTGGGCTCTTTGGGGTTCCTGGGAAAATGCGGGTCCCCTCGGAACTCCTCAACATGGAGCTGACAGAGAAGCTCTTCTCCATGGCGCACTCT
GTCTCCCTGGACTTGGCTGCTATCAATATCCAGAGAGGGCGAGACCATGGCATCCCACCTTACAATGACTTCAGGGTCTTCTGCAACCTCTCGTCTGCACAGGAGTTTGAGGACCTCAGA
AATGAGATAAAGAACTTGGAGATCAGGGAAAAACTCAGGAG
GTACTGTAGCCTGGACTCAGAGGGATCAAAATCACTGGAGTTCAGCTAGTGAAAAGCTGTTGCTCCTCCTAGAGCATCA
ATCAGATAACCTTCCTATGGAATAACCAGATATTGCTGTTCACAGATATTGGGATAAGTTAGTAGCTGTGGCTTGAGAATGGAGTAAGAGAAATAAGGTCTCTCCAAGTGATCAGGCTGT
TTGTGAGGGAAATGTTGTCAGGCACTGCAGTGGTGTAGCCTGGGACCAGACTGAGCCTTGGAGCTATTATCCAGTGAGACTAAACTGCAGTGTATGTACTGGTTGCTATTAGCTTACTCT
TTCCAAGACAGGCCTTTATCACATTGTCTTTTGGATAACACCAAATTAGAAATGTGTTCTAGATTACTTCCTGTCATACACATCCCTACAATGGGATCATATCTTTGCCTTTACTTTTTG
ATAGTTTTTAAATAATGTTTTTAATATATATAATTTATCCTTCAGCCTATATGGAACTACCAAAAATATTGACCTGTTTCCAGCCCTGATGGTGGAGGATCTTGTCCCTGGTACCAGAGT
TGGACCAACGCTGATGTGCCTGTTAACAACACAGTTCAGAAAGCTGAGGGATGGAGATAG
GTATTATCATCAAAGTCAACTCAACCTTCTGTTTGGGGAGATTTGCTCCCTTAGAGGAGC
AAGGAAGGAACAGAACTTGTCACTTTTGATTGTTCTTTGTCTTATGATAACAAGAAGGGTCTGCTCTGCTTGTCACGGTTACTTTCAGTGTGTGCTTTCATGATTTAACAATTCCCTTTC
CACTGAGAATGTGTCCACTGTCTCCTCAGAACTTTAGGGAATATCTGTAGGAGCTTCCTTGTGATTCACAATTTGCTCCTTGTGCAAGTGCCTTGGGATTTCCCTGCACAGGGCTGTGTG
TATGGGTGGTCGCACTCTGCAGCTCACAGGGATTCCTGGGTTCACAGAACTGAACTTTGTGTTCACAGCCTCCTGATAGCAAAAATAAAAGCTCCTTTGGGTGCTGCCATGCAGATGTAG
AGGAACTCTTCTGCCATCTTCCCTCCTTACACATGCTGTGATTACAACCCCCTGCAGATTTTGGTATGAGAACCCAGGAGTCTTCACGCCAGCGCAGCTGACTCAGCTCAGACAGACATC
CCTTGCTCGTGTCATCTGTGACAACAGCGACCACATCCAGCAGCTCCAGAGGGACGTCTTCCGTGTGGCATCGTACCCACAGGGCATGGTGGGCTGCGAGGAGATCCCTGCTGTGGACCT
CCGCTTCTGGCAGGACTGCTGCGAGG
GTAGGGAGCAGTGCCATGGGGTGGCATTGTCACGTGCCATCTCTGGCAGCTCATGCTTAGGGTGTGAAGCTGAACAGGATGCGGGCATGGTGAT
CCCATAACCGAACTTACGTGTTCGAGAGTCTGTAAAGCTCCTCCATTAAACTGAAGATCCTACCATAGTCCCTTTGTGCGATATTCTGGCTGCAAACGCACAAATAAGACATAAGAATCC
ACGCACAATTCATCTTCTTCATTCCGCTGTAAGAGATGCATCAAGGCTGGGTAGTGAAGGAGTGCAGCACTGCCCTGTTCACGTTTTATTTTAAGCCAAATGGTTCTGTTTTCAACACGA
GTACTAACACAGGGTTTCCCTTCCTTGGTCAAGTATTGGCACAGGCTGCCTGGGGAGGTGGTGGGGTCACTGTTCCTGGAGGTGTTCAAGAACTGTGGAGATGTGGCACTGAGAGACATG
GCTAGTGGGCATGATGGAGAGGGTTGGGGTTGGACCTGGGCATCTTAGAGGTCTTTTCCAACTTTAATGACTTGATGCTTCTTTGTGTCCTTCCCTAGACTGCCAAACACGTGGGCAATT
CAGGGCTCTTTCTCAGCGGTTCCGAAGCAAGAGGTCTCCTGGATTCAGCTACCCTGAAGAAAACCCTGCCAAGCACAAGCCTGCCTCCCCCAG
GTGGATATTAACACTTTTAACCTCTGT
TCTGAAGCGTAAGAGAAGTTTTTAACTGCTCAGTCCATTCTTGCCTTTAACACTGGCATTTTGCAGAGACATCTGAAATAGGGAGTGTTTCAGTAATTAAGTGCTGAGCTGGATCAGAGT
TCTCCAACTCTTTAGCAGAGAACAGGACTCTGCTTTTTAAAGATGTGGGCAGATCGGGGTACTGCTGAGTGGCTGTTTGACTGACATCCCTTGGTAGGCATAACCAGGAGTTGGGCCCTT
CAGCGCCCACCTTGTTATTTGGAGGCTGACGTTGGAGAAGGCAGAATCATTCTCTAAACCAGGAAGTCAACGTTGCTGTAATCCCTTTTCCTTTTCATTCCTCACCCCAGAAATGAGGCA
CCTGCTCCAAGGTCTTCTTCCAGAGAGAATCTCGAGTCCCTTGTGGCTGAACTGGAGAAGGCAGTCACTTCCCTACGGAAACAG
GTAAAGCTGTGTGTCCCAGTATTCGTCTTCCGTAGA
GTCAACCTGAGAGCAGGACTTAGCTGTTTGCTATGAGCAGTTTCTGTGCCCTCCAGATCCAGGAGCACAAGTTTGAGACTGAAAGTGACTTGAGCTAGCACTTTTTTCTTGCATTTGGGA
CAAGTTAAAGAGCATTAACCCCAGAAGACATGGTTTAGTGGTAGGACTTGGTAGGTCAGTTTGATGGTTGGAATTGATGATCTTGCAAGTCTTTTCCAACCTGAACGATTTTATGATTCT
CTTCAATAGTGCAGGCTCTACTTAGATCTGCTTTTCATCCCCACCAGGTGCACGTACTAGAGAGCCAGTTGAGGTGGCACCACGGGAACACCAGCACGTATGGACAGGGGAAGAAGACTG
GAGACAAATGGAGAAAACGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGCTCAAACCTTCAGCTCTTCTGGGCTTTTTGTGCTTTCTCCTCCTGCCTGCTTCCTCCCGTTCCTGCCCTCCTCGCTGCCTGTGCTTCAGGACTACAGTAAGATGCATGCATCTG
ATGTTGGAAACCATCCCTGACATCCCACCTCAGACGAGCATACT
AGATTTACGTTTCAACCACATCAGGGAGATACAACCCGGGGCCTTCAGGAGGCTGAAGAACCTCAACACGCTGCTG
CTGAACAATAATCAGATAAAGCACATCGTGAGAAGATCCTTTGAAGATCTGGAGAACCTGAAGTACCT
CTACCTTTATAAAAACGAGATCCAGAGCATCCAGCAACATGCCTTCCATGGG
CTGCGCTCCCTGGAGCAGCT
CTACCTGCACTTCAACAGCCTGGAAACCCTGGAGCCAGAGACGTTCAGTGACCTGCCCAAACTTGAAAGGCTATTCTTGCACAACAACAAAATTTCCAGG
ATTCATCCAGGGACATTCTCTCAACTGGAATCCCTCAAACGACT
GCGGCTGGATTCCAATGCACTGCTCTGCGACTGCGACCTGCTGTGGCTGGCTGAGCTGCTGCAGAAATACGCTGAG
TTGGGCAGCATCCAGACTGCAGCCACCTGCGAGGCCCCGCGGGAGCTGCACGGCCGATCCATTGTCACCCTGACCGCCCAGGAGTTCAACTGTG
AGAGGCCTCGCATCACCTCAGAGCCC
CACGACGTCGATGTCCTCTTGGGAAACACAGTTTATTTCACATGCAGGGCAGAAGGCAACCCAAAGCCTGCGATTATTTGGCTCCACAACAA
TAATGAGATTGACATGAAAGATGACAAC
CGCTTGAACCTGCTGCAAGATGGCACCCTGATGATCCAGAATACCAAGGAGTCGGACAAAGGTGTCTACCAGTGCATGGCCAAGAACATCGCTGGGGAGGTCAAGACCCAAGAAGTCGTT
CTACGCTACTTTGGCACCCCAT
CCAAGCCCACTTTTGTGATCCAGCCGCAGAACACTGAAGTGCTGGTTGGGGAAAGCGTCACCTTGGAGTGTGGGGTCTCTGGGCACCCCCACCCTCGC
ATCAGCTGGACACTTGGCACAGGCTCTCCTTTACCGCAGGATCCCCGCTTTGCTATCACCAGCTCTGGAGGACTCTTCATCCAGAACGTCACCTTCTCAGACCAGGGACAGTACAACTGC
AATGCCAGCAACACTGAGGGATCCATCCAGGCGACAGCGAGGATCATAGTGCAAG
ATTCTCCCAGGTTTCTCCTCGTCCCCACTGATCAGACAGTAACTGAGGGACAAAGCGTGGATTTC
CCCTGCACTGCTGAGGGTCACCCCCCACCTGTGATTGCCTGGACAAGAGCAG
GGGGACCGCTGCCGAGCAACCGGAGGCACAGCATCCTCTCCACGGGGACCCTGCGAGTGATGAGGGTG
GCCCTGCATGACCAAGGGCAGTATGAGTGCCACGCCATCAGTGCCATTGGGGTGAGGACCCTGCCCGTGCAGCTGGCCGTGACCCCGCGGG
TGATTCCTGTGTTCCTTCATCCCCCCCAA
GATGTGGTGGCAGAGACAGGCCAGGACGTGGCGATCACCTGTGCTGCCCAGGGGGACCCACGGCCCACCATCACCTGGGTGAAG
GAGGGGATTCAGATCACGGAGAGCGGCAAGTTCCAC
GTGAGCCAGGACGGGACCCTCTCCATCCAGGATCTTGGCGTGGCTGACCAGGGCAGATATGAGTGCATAGCACGGAACCCCTTTGGCTTCACCTCCAGCGCCATGCAGCTCACCATCACC
G
CCACTGATGTTGGTCGGAGTGGTGACACATTCGTAGCCACGTCCCTGCGGGAAGCCATCAGCAGTGTGGACCACGCCATCAATTCAACACGCACTGAGCTGTTCAGCAGGCGCCCCAAG
ACACCCAATGACCTGCTGGCCCTCTTCCGCTACCCGCGGGATCCTTACACCATTGAAACAGCCAGGGCGGGTGAGATCTTTGAGAGGACTTTGCAGCTGATTCAGGAGCACGTGCAGCAA
GGTTTGATTGTGGATATGAATGTCACGG
GTTATCGTTACAACGATTTGGTGTCTCCTCACTACCTGAACATGATTGCCAACCTGTCTGGCTGTTCTGCTCACCGCCGCACGCCCAACTGC
TCCGATATCTGCTTCCATAAGAAATACAGGACCCACGATGGCTCCTGCAACAACCTGCAGCACCCAATGTGGGGCGCTTCTCTCACCGCCTTCCAGAGGCTCCTCAAACCTGCTTACCAG
AATGGATTTAACCTCCCTCGAGGGTTTTCCTTGGCAGAAGATGCCAGGGACCTGCCCCTTCCCTTACCCAGGCTTGTCTCCACCGCCATGGTCGGGACTGAGACCATCACCCCAGACGAG
CAGTTCACACATATGCTCATGCAGTGGGGCCAGTTTCTGGACCATGACATGGACCAGACGGTGGCAGCCATCAGCATGTCCCGTTTCTCAGACGGAGCACCCTGCAGCCAGGTATGCAGC
AATGACCCACCCTGCTTCTCCGTCCTGATCCCCGCCAATGACCCACGTGTCAGGAATGGGCGCTGCATGTTCTTTGTGCGCTCCAGCCCCGTGTGTGGCAGCGGGATGACCTCCCTGCTG
ATGAACTCTGTCTACGCCAGGGAGCAGATCAATCACTTGACCTCTTACATCGATGCCTCCAATGTGTATGGCAGCACCGAGCAGGAATCGCGTGAGCTGCGGGATTTGAGCAGCCAGAAT
GGGTTGCTGAAGCGAGGGAGGGTGGTGCCCAGCTCAGGGAAGCACCTCCTGCCCTTCGCTGTGGGGCCTCCCACTGAGTGTATGAGGGATGAGAATGAGAGTCCTGTGCCATGCTTCCTG
GCTGGAGACCACCGTGCCAATGAGCAGCTAGGGCTCACGGCCATGCACACACTGTGGTTCAGGGAGCACAACCGTGTTGCTGCTGAGCTGTCTGTCCTCAATCCCCACTGGGATGGGGAC
CTCCTGTACCACGAGGCGCGGAAGATCGTGGGTGCCCAGATGCAGCACATCACCTATGCCCACTGGCTCCCCAAGGTCCTTGGGGAAGCAGGGATGAAGATGCTGGGTGAGTACAAAGGC
TATGACCCCAATGTCAACGCGGGGATTCTCAACGCTTTCGCCACTGCTGCCTTCCGCTTTGGGCACACTTTGATCAACCCCATCCTGTACCGGCTGAACGAAACCTTCCAGCCCATCCGC
CAGGGCCACGTCCCCCTGCACAAGGCCTTCTTCTCCCCTTTCAGGATCACGCAGGAGGGTGGGATTGATCCACTCCTCCGTGGGCTCTTTGGGGTTCCTGGGAAAATGCGGGTCCCCTCG
GAACTCCTCAACATGGAGCTGACAGAGAAGCTCTTCTCCATGGCGCACTCTGTCTCCCTGGACTTGGCTGCTATCAATATCCAGAGAGGGCGAGACCATGGCATCCCACCTTACAATGAC
TTCAGGGTCTTCTGCAACCTCTCGTCTGCACAGGAGTTTGAGGACCTCAGAAATGAGATAAAGAACTTGGAGATCAGGGAAAAACTCAGGAG
CCTATATGGAACTACCAAAAATATTGAC
CTGTTTCCAGCCCTGATGGTGGAGGATCTTGTCCCTGGTACCAGAGTTGGACCAACGCTGATGTGCCTGTTAACAACACAGTTCAGAAAGCTGAGGGATGGAGATAG
ATTTTGGTATGAG
AACCCAGGAGTCTTCACGCCAGCGCAGCTGACTCAGCTCAGACAGACATCCCTTGCTCGTGTCATCTGTGACAACAGCGACCACATCCAGCAGCTCCAGAGGGACGTCTTCCGTGTGGCA
TCGTACCCACAGGGCATGGTGGGCTGCGAGGAGATCCCTGCTGTGGACCTCCGCTTCTGGCAGGACTGCTGCGAGG
ACTGCCAAACACGTGGGCAATTCAGGGCTCTTTCTCAGCGGTTC
CGAAGCAAGAGGTCTCCTGGATTCAGCTACCCTGAAGAAAACCCTGCCAAGCACAAGCCTGCCTCCCCCAG
AAATGAGGCACCTGCTCCAAGGTCTTCTTCCAGAGAGAATCTCGAGTCC
CTTGTGGCTGAACTGGAGAAGGCAGTCACTTCCCTACGGAAACAG
GTGCACGTACTAGAGAGCCAGTTGAGGTGGCACCACGGGAACACCAGCACGTATGGACAGGGGAAGAAGACTGGA
GACAAATGGAGAAAACGTTGA

Retrieve as FASTA