Entry information : TguPxd01
Entry ID 7678
Creation 2010-11-02 (Marcel Zamocky)
Last sequence changes 2016-02-09 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-09 (Achraf Jemmat)
Peroxidase information: TguPxd01
Name TguPxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Chordata Aves Estrildidae Taeniopygia
Organism Taeniopygia guttata (Zebra Finch)    [TaxId: 59729 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TguPxd01
start..stop
S start..stop
GgaPxd01 2808 0 1..1431 49..1447
MdoPxd01 2715 0 1..1431 196..1627
RnoPxd01 2630 0 1..1431 47..1475
MmPxd01 2624 0 1..1431 47..1475
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16256851..16256903 53 N° 2 16230204..16230275 72 N° 3 16228481..16228552 72 N° 4 16222025..16222096 72
N° 5 16214654..16214725 72 N° 6 16214007..16214078 72 N° 7 16213329..16213498 170 N° 8 16211948..16212065 118
N° 9 16209703..16209872 170 N° 10 16208495..16208767 273 N° 11 16207089..16207205 117 N° 12 16205849..16206007 159
N° 13 16202693..16202805 113 N° 14 16201602..16201758 157 N° 15 16198034..16198142 109 N° 16 16197437..16197594 158
N° 17 16191506..16193009 1504 N° 18 16190539..16190673 135 N° 19 16187832..16188040 209 N° 20 16179584..16179704 121
N° 21 16176984..16177116 133 N° 22 16175979..16176092 114 N° 23 16175212..16175334 123  
complement(join(16175212..16175334,16175979..16176092,16176984..16177116,1617958 4..16179704,16187832..16188040,16190539..16190673,16191506..16193009,16197437..1 6197594,16198034..16198142,16201602..16201758,16202693..16202805,16205849..16206 007,16207089..16207205,16208495..16208767,16209703..16209872,16211948..16212065, 16213329..16213498,16214007..16214078,16214654..16214725,16222025..16222096,1622 8481..16228552,16230204..16230275,16256851..16256903))


exon

Literature and cross-references TguPxd01
DNA ref. GenBank:   NW_002198514 (16256978..16172447)
mRNA ref. GenBank:   XM_002195455.1
Cluster/Prediction ref. Genebank:   100230769
Protein sequence: TguPxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1432
PWM (Da):   %s   161445.53  
PI (pH):   %s   6.59
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLMLESVPAVSPQTTILDLRFNRIKEIQPGEFRRLKNLNTLLLNNNQIKRIPSGAFEDLENLKYLYLYKNEIQSIDRQAFKGLASLEQLYLHFNQIETLEPESFTHLPKLERLFLHNNRIAHLIPGTFSHLESMKRLRLDSNALHCDCEILWLAELLKTYAESGNAQAAATCEYPRRIQGRSVATITPEELNERPRITSEPQDVDVTSGNTVYFTCRAEGNPKPEIIWLRNNNELSMKEDSRLNLLDDGTLMIQNTQETDQGIYQCMAKNVAGEVKTQEVTLRYFESARPSFVIHPQNTEVLVGESVTLECSATGHPQPRITWTKGDRTPLPNDPRVTITPSGGLYIQNVKQEDSGEYTCFASNTIDNIHATAYIIVQALPQFTVTPQDKTVIEGQTVDFPCEAQGYPQPVIAWTKGGGQLSVDRRHLVLSSGTLRISRVALHDQGQYECQAVNIIGSQRIVVYLTVQPRVTPVFASVPSDMTVEVGTNVQIPCNAQGEPEPVITWNDGVQVTESGKFHVSPEGFLTIRDVGTADEGRYECVARNTIGYSSVSMVLSVNVPNVSRNGDPFVQTSIVEAIATVDRAINSTRTHLFDSRPRSPNDLLALFRYPRDPYTVEQARAGEIFERTLQLIQEHVQDGLMVDLNGSYHYNDLVSPQYLNLIANLSGCTAHRRVNNCSDMCFHQKYRTHDGTCNNLQHPMWGASLTAFERLLKSVYENGFNLPRGIEPRRLSNGYPLPMPRLVSTTLIGTETVTPDEQYTHMLMQWGQFLDHDLDLTVAALSEARFSDGQHCSSVCTNDPPCFSIMIPPNDPRVRNGARCMFFVRSSPVCGSGMTSLLMNSVYPREQINQLTSYIDASNVYGSSDHEALEIRDLASQRGLLRQGIVQRSGKPLLPFATGPPTECMRDENESPIPCFLAGDQRSNEQLGLTSIHTLWFREHNRIATELLKLNPHWDGDTIYHETRKIVGAEMQHITFSHWLPKIFGEVGMKMLGEYKGYDPSVNSGITNEFATAAFRFGHTLINPFLYRLDENFEPIPQGHLPLHKAFFSPFRIVNEGGIDPLLRGFFGVAGKMRVPSQLLNTELTERLFSMARTVALDLAAMNIQRGRDHGIPPYHDFRVYCNLSSAQTFEDLKNEIKNPEIREKLSRLYGSPLNIDLFPALMVEDLVPGSRLGPTLMCLLSTQFRRIRDGDRLWYENPGVFTPAQLTQIKQTSLARVLCDNGDNITRVQHDVFKVAEFPHGYSSCEDIPKLDLRMWQDCCDCRTRGQFNAFSYHFRGRRSLDYSFQEDKPLKKMKMSKSVSSVKQSKYFRNATSTSNEKRNVPAVNDFKEFVLEMQKTISSLRNIKKLESRLSNSDCTDEEGKSYSSNETWKRDPCTVCECKAGQITCFVESCPPADCEAPVKGKGDCCPVCLQQNTNKKKP*

Retrieve as FASTA  
Remarks Complete from genomic (chromosome 3, 23 introns). No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTGATGCTGGAGAGCGTCCCCGCCGTGTCGCCCCAGACCACCATCCTGTGAGTACCCGGCGAGGGCTGCCGCGGCGGCCCGGGGCAGTGGGGGGCGGAGGGAGGCAGGAAGGGA
GGAGAAGGCGGAGGAGGGGATGGATACCTGGGCTGAGAGGCACTGGGGTGGGTGGCGGCGGAGCCTCAACTCTTTGTCTGCGGTCGGGGGAGGGGGCCGGACCCGAGGCGGTGGCTCTGC
CCGAGGGGCCCGGGCGTCCCTGCGCTGCTCCGGGGCTGCGCTCGCCGCCGCCGGTGCCGCTGCCCGCTCGGCCCCGCGGTCCGGCCGTGCCCCGCGCTCTGCCCGGCTCCGGCGGCGCGG
GGTCGAGCGGGTCGGAGCGGTGCCCCAGGTTCTGCGGGGCTCTTAGAGGTGATGCTCTGCTTAGCGTACGGGGCTTGTGTCCCAGTTTAGTCGTCCCTAGAAGGATTTCAGTACTTTCTT
CTTTCCGTTTGAAAGCATATTCAGGCGGCAGGAGGATCGACAGGGACATGGGTGACGCTTTCTGCTCAATTCTTAGACTTGTTGGGGATGTACGAGCAAACCGCGACTCAGATCCTGGGT
TGCTGAAAACTAACCCGGCGCAGATTCCTACAGGGATTTGCGAACATTAGTTAATAACCAGTTTTCTAGTTCAGACACAAATGTGTAAGTTGAAGTGCCCGGCCGTTCCCCTGGTGACTG
TTTTGGGTGGGATTGCATTGGTATAAATTTCAGTACTGACAATGATTGATATTTAATTAACATTGATTTGACTGAAACAGTTACCTTTCCAGGCATATTTCCCTACTATAAAGGCAAAGT
TCCAAATGAACATCACACGCTATTTTGTTTCGTGGCTTACTAAGAGGAACAGATTTGTTCCACTGACCTGCTTATATGTTACTTGGGCTCAGAAAGCTCTTGGCACCAGCCCTGCCCTTT
CCTTACACACAGGCAGCCGTGGAAGCTGAGCAGAGCTTGGCCCTGGGAATTTTCTGCGGGGCCTCCTGTCATAAATTAACTTGTGACTGTCAGATATTTTCAAAAGGGGTCTATAAAGCT
TTGCTGTGTTTCAGCTTCCAAGTATTATTTAATGTGAAGAGTACAGTCATTTAGCATTAACTGAGCCCCTCTTTGGCAAGAAGTGCAGGCTTTTGGCAGAATTGGATTAGTCCTGCAGTA
CTTGTAAACCTTTTAGGGAACAGTACAGGAAGTGGGTGGTTAATGTTTCTTACATTTGAAACAAAGTACATTTACAGAACACCTTTTGCCTTGAGATTACAGGAAACCGTGTAAAGCTGG
TTTTGTGAATCATCTTAAATGTAAAAAGAAGGGGGAAAAAAAAAGGTCTTAGAATGTGGAGTCAATTCTTGATGGATTGGTTTTGTCTTAAAGGTAGAAGGGTCCGCAACAGCAGAAAAT
ATTAGATTAAACCTCGCCAGGGTGGAGCTCCCCTTACGGTGGGTATTTATAATCTTGCAGTGAGTCAGAGGAGAATGTGTGAACAATGCAAGCATTATACATGTTTAACCTCACTAATAT
ATCAACTTGTCTAGTATCCCAAATCTGAATTATCATTCTGGTATTATGCAAGCTACCATGCTGCAGAAGTAATGCAAAAGAAGTTAAAAATATGTTTTCAGCTTGACAAAGAATGGTCGT
CTTCAAAATATGCCTGCAGATGACCTGCATTCTTCAAAACCTAGTGGTGATGTTACTTGTCATCTAGTAATGGGTATTATCCTTTCTGGACAACTGACTGGGAAACTATTATAAATAAAA
TAGGCAGTATTACATCTGTAAATACTCAGTTACTCCTTCTGCTACAGTTCTGCTGAAAGGCTGTGAATGAAAAGGAGCTGGGTCAGAAGACAGTCGGGCAATATGAGTCTTTGGGACAAA
GAACAATGGTACAATTTATTTAATAATCAGTAGTTTGAAGGTACCAATCATACATAAATAGCTTACCTGTTTTATATTAATTGCCTAGATTTACCTGTGGGATGTACTGTCAGAACAACT
ATTACATGTCTGAGTTACCTACCACTCTTTTTTCTTTACTTACCTGTGATGTTGAACTGTAGTTCTACACTGCAGTGTCACACTTCACAGAGGTAGCCCATCACCTACAGAGGGCTTTCT
ACACTCAAGAACAGTTTCTTTTAAGCATGAAAGCAAGCAGTTATTTAATTTCTGGTTTGACTCTCAATGTTTGTCTTTCAACTGGTGCCTGTATATTAAATGTATTTTCTTTAGTAGTAG
TGTTCATAGTTAGATAATTAAAAATAATAAATTAATTTAAATCAATCACCTTCCCTTTTAAAACAAAAATTTAGGAAGTCCTGCAAAGTGTATTGCTGATGGGTTAAGTCCATTTTTACT
GGCATTGATAAATTCCACATTCTCATCTGTTTTATTTCTTACTTACAACATATATTGACTATACAAGGTAATTTTGTAAAAAAAATATTGCCCTAAGATTTTCCTGGTTTACAAGTATTT
TGTTGAGTACTAATTCTGAAAAATTCCCCATTTTGGAAGCTGAGTTGACTTTGCTCTATTTAATATATAATTTGTTACATGGATTAAAACAGCATGGGGCCCAGACCAATGGTGCAGCCA
AGTGTTTTCTCCCACATATCAAAAATGTTTACTCCTAATCTCAGGCTCTCTTTTGAAAACTGTTTATAACATTACTAGTTGCTGACCTTGCCAGTGCTACTTCAGGCTGTACATTTTCCT
ACTCTCCCCTGCTTCTCCCACTTTCTGAGACTTCCCCTTTCCTGCTGCAGGCTGGGAACCATGGTTTAGATTGCTTCTGCAGGGTGGATGCTGACAGCTTTGAAAGAACTCATGGAGCTT
TGCATAAGCATGTGGTTTCACCCGAGGTGATAATGTTACCTGGGCTCTGTTTTGGACTAGGGCAAACATCCCAGTCCTGTGCCAACTTCCCTTAAAAATGGAGACCCATGTATAAAATAG
TTTGAAAAACTACTTCATGCCATAAATACAATAATGGAAATTTAATTTAGTCTCTGACTAAATATAGAGTGCTTATTTCACAGAAACAGCTGAAACATACTTACATTAAACGATTTAAAC
AGTTGAGGAATGTAAAATTCTTGGTATCCCCTCTTGCTCTCTCCTCCTCCCATAATTGTATCCTTACACTTTTTTAGGGAATTTCTGTGTTCTAGAGCAATTTCTTGTATGTGGTGTTGA
TGATTCTGAGGGGAGACCTTTGAAAATTGATGCAATATGTTACTATTTGTATCTAAACACAATCCAAATCCAAACCTGTCTACAGGACTAGCTACACATACTCAGACCAATACTGAAATT
TGTTCACAGTTTTTCTTGGCAGCACCTCATTGCTCTCTTGTTTCTTGCTAGCTGTACAAACAAAATTGTGTTCACTGCACTTGAGTCTAACAGACTGAACAAGAAAAGAAACTAATGTTC
TGTTAACAGCAGAAAAGGTAAAAATTGACAAAAATAGTTGTCATGAAAGAAAGTGGACTTGATTTGCACTGAGAATGACATGCAAATTATTGAGAAGATTTAATTTTGAAATAAGTAATT
CTGTGATTATTTATGTATTTGCTGTGTGATTATTACTTTGGGTCACCTGCACCTTTGGGTTGTCTGCTACAACTAAAATGCCTTTTCAACATGCAAATATAATTTTAAGTGATCAAACTA
TAAAAGGACTTTTTAAGTTGCAGCCATTCCAGCTGAATAGCTTTTGAAGGTGGGCTCTGAAATGAAATTGAAGGCAACAGTCTGTGTTGCTTGTTACTGCTTTTGTTACGTGATTCTAGC
ATATTCTCAACATTGGATAGTTTAGGGTGCATACTTTTTTATTTACTCATTTATCAATGTATTTTAATTTCTGGTTTGTTCTGTAGATGTCAAAGGGAAAGGGGGAAGTGTTAATAGTTT
AATTCTATGGTGACTTTCTAGACAGCTGAGTAAGAAGTAATTACACTTTTTCATCCCTCAATAAGAACTTTTGGTGGAATCTAATGTACATTCATAATGCTGGTGAAAACCATTACTGAG
GCTTCCCAAGAGTATCTGTCTTAATGCAAAGAACAACCCCAGAACACTGAATTACACAAATCTCATCTATCTGGAGAAGATGTGAATTGCTAAAGAGGTGGGGGTAATGGAAATGTAATG
ACATTTTGCATTTCATTGTTGATTTGTGCTAACATTATACCTCTTAGCAGATGTGTTTAGGAAAACGAAATGGGTGATGTGTATGGAGACTGTCAGTGCAGGAGTCTCTGGGCTATTGTA
GCAGAAATCCTACTGTTTGCACATCTGCTATTTGACATGAGGCATTTTCAGCCCACAAACAACCATCCCATTTTCATCTGAAAATACAATGTCCTTGTGTTCCATTAGATCTTTGAAATC
CTTTTAGAAAAATTCCAGTAGATTAAAATTAAGACAAAATAAAATAAACACACCTCATCACTGTGAAGGGTGAAGGATTGCAATCTCAAATGTGGACTGTAAGTAAACTTGATCACTTTA
TGGGTAAACATCAACTTGGATGTAGGAGTTAGTCACGAGATAACACACCAGAAGATTTTATTCAAGATGCAGGATTTTGTACATACTTAATGTTAAAAAAAGAAGTACAGATACTGAGGA
CTTATTTGAAAGGTTTGAAAATAACTTAATACTGATACAGCTATTGGCACCCCTAGCTGGGCAGCAAAGTGCAGTAGGTGCCAGTGATGATTTGCTTGAATGACACAGAATAGGGAGGTT
AAAGCACAAGATTATTTCAATAAAAAATATCTTACATCTTCCTGCATTGAAATTTTATGAACAAATAAAGAATTAAAATTGAGATTAAAACACCTACCTTTAGGTGTCTATACACAGGAG
TTTACATCTGTATTTGGTTATGCATTTCCCTTCTAATAAGTAGCAACTTAGCCAGTAAGTTCATAGTGCCTGGAGCAGAACTCAGCTCACTCAAAAGGGGACACCTTTATTGGAAATATT
AATTTCTAACCTCAGACTAGGTCCCTCTTGGGCCTGTGTCATAGCTGCTTGCTCTCAGCCTAGGACATCTAAATCAACAATGGGCACCACTGGTCAGACAACTGAATTAATTAGCTACTG
TTTGGGCAGTTTATTAATTTGTTTGTGTCTTCTCCATCCCAAGTGTGGTGACTAGTCAGCTGTTGACAATAAAAGGAGATGAAATGTCTGTATGTAGATATTGGTATTTATTTGTCTAAA
CCAAAGTTTAAAGTATTTTCAGATGAGAATGTTTTCATAGAATTTTCAACAGAAATAAATTCCTTGAAAAAGTAGGCAAAGGAGTCATAAGTGAATTTAAAAAAATAACTTTGGAGTGCT
TAAATTGTTGCTAAAAATTGTTGTTTTCTCTCTATTAAACCCATCCTGAATCCCAACAAAGCAAGTGGATACTGCAAATGATACCAATCCTCGCCAGCAAAGCAGCTGTGGAGGGTGTGT
AGGATGGAAAGCCTGCTGCCATTCCCAGGCAGTCTGCTTGTAGTGCTGATGGAATGAGCCAGGACCAAGGCATGAGTGTGTTAAGGAGACATTTGCAGAGTTTGCAGAATGTGTTTGGTC
ATTAGCAGGGGCCAGAAGGGCACAGCATTGATAGTGTTTGACATTTACTGGGAGATGAGAGGCAAAGCTGCTGAGGGCTGCAACAGAAGGCCCAAACGAGTCTTCACTTCAACTCACTGG
ATTTGCTGGTGGGAAGATATTTTTGTCATCTCAGCAGTATGTTAACCCTCATCAAATTCTTTGTGAAAAATGGGAAAATGTATGGAACAAAATCATATCCATCATTTACTGCAAGTAGCT
TACTGTACCCTTAACACACCGTCATCAGAGGAATACATTGTCATATATTACAGTGGATAAATATGATTTCTTGTTTTCATCTTGTTTACTAAGATATATTTTTGAGCAGTAAATACTTAA
CATTTGAATGTTAAAGTGATAATTATGTGTTTATTTACAGAAAAGATACCTTTAATAAGTAAACCCAAAGACCTGTTTGACCTCATATCTGTTTTTTGATGGTGATGGAAAGCACAGCTT
ATGAACAAGTATAGAGCACCATATGGTTGTTTATACCTATAATAATTTGCAGATGTGGATTTTTGGGGCTAAAGATACTTCTGTATTTTATATAAGTCTTGATGGATCTCTGCTCCACAA
ATTGTTTAACCTCTTTTTTTTTTTTTTTTCCAACTAATTTTGCTGTTAAGTTACATTAAAACTTTCAGTGACAAGGAGTACTACACAAACTACAAGGTGGAAATTGCTGTCTTCTGTTTG
AAGCCTGAAAGTTGTTAGCTTCACTTAGTGTCTCCCGTTTCTTCTGTCGGTAGAGACAGTGAGTCCTTGATCCCGCTCTATCATTCCAATGCCAGCTGTGATCTTTGATACTAAGCTTCT
CCATTCCTTTCTTTTTAAAGTTGGAGTTTTCTCAGTGAAAGGTTGGTATTAATCTCTCATCATCTGGACTGTTGTTTCCCCACTCTGCTGTGTTTGGAGGTGAGGGAATTGTAACTTTAC
CCAGTATTTGTATGGACAAATCTGTTATGAGGTTTCATGAACTAATCAAGGGTAGCTTAAGATCTTGTCTGTAAGTAGTAATGGTCACTTCTAGGCCTGCCATTTTATTTGTGAAGTTTG
ATTTTCTCCATCTACATTATTTTATACAAATACTTGCATTAGGTCTGCATTTTAATAGCCATTTATGGACTGTTGACAGGTCTTTTTGCTGTTCTTCCTGGGTAGACTTTGTTAAAATAG
ACGAATATCATAAGTAAAACTTTGTTCTTTCTGTGGTCATCACTCTTCCATTTAGGAATAAACTGAATAATGCACAACTCAGCACAGCTCTCTGTGAAACTCTACTGGTGACCTTTCCCA
ACTACAAAAATTCTCCATTTAGTGCAAACATCTCTTCATATGCTCATCTGGTATGAAGTATTTGCTTCATAGCTGTTTCAAAAGATTGTCTTCTAATTCCCAAAGCTTTGGGAGTTTGGA
CTGTTGTCAGCACAAGGTTTTTGTTTGTTCTACTGAAATGTTTTAGAAAGCTATAAGGATTATACAGATCAGTGGATTGCTTTGTGTTGTCTACATCCCCAATTCAAAATCTGTTTTAAA
CATTTTTCTGTCTTTCTGATTCTGTTTAACAGAGAGCTTCAGTGTGTCTGCTGTTACACAATTTTCCCAAACAACATAATTAAAATGATGAGTTAAATGAGTTTTCAGCATTACTTTGGG
GAATTTAGGGGCATGAGGGACAGTGAATAAGAAATTTTTGTGTTGCAGAGACAAACATAGAATTACGTATTGGAAAGAGTAGGAAATGGATGCTTGGACATGAGTAAATATATTCTTTCT
TTCTTAATTCCCAAAGGCAGCTGGTGGAAAAATAACAGGGAGATGCCTACCCTTACATCATCAGCAGGGTCTGGATCTGGAATACAAGGAGAGGAGTGTCTCACCTAAAATGGTGGTAAA
CACATGCCTAAGAGAAAAACATGATTAATAAATATTCTAACCTCTTCCATTTTCTGAGTAGCCCCTACGGATTTTTCTCCCAGGTGAGGTCAGTGCTCATTAAGAGATGACATGGGGATA
TCATTAGCCTGCAGAAAACTTTGTTATTTAGGTGTTAAATAAATGTTAGGCTTGTTGCATGTGCTTATGGATTGCCCTGCAAGTAAGTGAAGATTAAATTGAAAGGTTGTAAGTCTAGCA
GAAAAAAAAATCAGGAAATACAGCCAGTAAAGAACAGAGCTTGGCATGAAGATAGAAAGAAACTGCAGAAAGAAACCAAATTAATATAAAAGGAGAAATCGATATTGCTATTATGACATG
AAAAAAAAAAACCAGACAACTATTCAGGAAATAAAAGAAGAGAAGTAGTGTATTTAAAATTACATATTATTTTTTCTTAATTACAAAATAGTCTTTATATGAACATTTTACTGTGTGTAA
TGGGTAAAATGAAAATGCTAGATTAATATTAATATTTTGAGGCTCCAGTTCTGTTTTGAACAACTGAAAAAAACAGCTAAATTTTAATCTATCTTGATTCATGTTTTAATATGGTATTTT
TTCAATTATTTATTTTTGGATTCAAATTTCTGAGACTTTCAAAGCTTATTGCAGTTTGTTTACAGTATTTTGTGATCAAATGTTTTGTACACTCTAGATCTAATCTTGCAGAACTCATGC
ATAGCTTTGTATACATGAGTAATCCCCAGGCTTCTGATTTTTCCCGGACAGGGACATTTGCTGAGTCTCTTTCCAGCAAGCCAAAGTGTTTACATCCTTATAGGAAAAGACTTCACTTAC
AGAAAAGATCAGTTTATAAAGGTAACATTTAAAATCTGTATCACACAATTGAAACATTTAAAGTTGCTTGTCTTTCTGGTGAAGTTTATGTATAAAAAGAAGTTAGTATTTTAAATACTT
GTATGTGTGTTTTAAAAAAGTAATTTTAAATACTTACATAATGTGTGTGTATGCAGATAGATATAGGGAAACAACTAAGCTAAATTGTCGACCATTTCTTCCATTTGGATTCAATAAAAA
AAAACCCAAACCAAAACAAAAATAACTTTAAAGGCTTTCTTATTGCAAATGTGGGCAGGGTTTCAACACAATCCATAGAGATGGTTGCAACGAGAGCTAACTGAGCTGGAACGGAATGAC
TCAAATGTTTCCTTTTCCTTCCTTTGCTTATCAGACTGCCAAAATTGATTTCTTTTTGTGTGGCATTATTATTGCTGCTAATGAGAGTCAAGTGATTCTTTTAAACAGAACACTGAATGT
TTATTACACATAACAAAGAGTCTCAAAATCTTGAGAAAGACACACAGAGGAAAGATTACTGTGGTCTCATCTTCATGTCTTTTTGTTTAATGTTTGTTTACAAAATAAGCAAAGATTAGG
ACATTGAAGAGTTTGTGCAGTGGCTGGCAGAGTTTCTTGAAACTATGTGAAAGGTTGTAGAATAAAAGTGTGAAGTTTTATGCAATGTAGTGTTCTCTTTTAGGTTTTTTTTTCTGAGTT
GTTTTTTAAATTTGACTAAGGAAAACGATGAGCAAATGTTTTTAACTCCAAATTAGTTTTACTGCCTGTGACATTTGTCTCTTTTTTGTTGAGATCTGTTGTTGTAACTTTCAGATTTTT
TATTCTCTTTCCAATTGCCACTCCCTGTATCTTTCGGAAACATTTTCTTTCAGCATTCTTTCCCCTTAAATCACTTATTACAACAGACTGCTTATTGCCTGGCTGGTCTGAAAAAGGAAA
AATATTACTTGGTACACTGTGTTACCTTAACTAATGACTGTTTTTGGTAAGTAGGATGATGACTGCTAAATGTCAAGTTCTTTGCACTGTGTTAGCCAGACTGGATTTAACAACATTTTA
TTGGCCATTTTGCTGCTGGTTTCCTGTGTTGCAGAAAAAATAAAGAATAAATGAGTCCTTGCATGCTTGACTTATCTCTAGGCAGTGTGAGCATTGTGACTGGGACAGCATGAAATTCAG
TGCGGACTTCTCAAAACAGTTAAATTCAGAGTCCTACAGCCCCTGTCCAAGGTCCATCATGCTCTACAGAAGCAAATACTTCACTTTTACAAGATCTTAGTTGTCCACTTTGATATAAAA
TTTCACTATTTGGTGTCTTATGGTGTCTTCTATTTAATGATAGATTATAATGATAATCTGATTAATCAGTCACCAATTTTCACATCTTTAAATTAATATCTTGTCATGTTTTTATGGTGA
GAAGAGAGAACTATTCTTCCCTATTTTTCCAAAATATTTTGAAAAATATGAGGGGGAATGTGTGTTCTGGTACACAGATAACTCTAGTGGGCCATTCAACACTCAAATACAAATAAATGT
CACATTACATTGTCTGCTAAGATAAACTAAAAAGCTAGATTAGCAGTATGATGGTATGACATATGCATATTAAAAAGTACATGCCAGGATACCTTTTAAGGGATGTTTTGTCATTCTTTG
GGACAATAGCTAATTTGGGTTCAAGAAAGAAATTTTGGTTTGATGGTATTTTGATAAACTCTCCAAGAAATTGGAGAGATTATAGTATTTATTTCTTACAGGCATAAATTGAATGAGAAA
ATCCAGATCTTTGACTTTGGTAAGATTCTCAGTCTCCAATAAAAAGGGCCTAGGTAATTGAATTAAAGTGCCAGTAGAAGGAGAGACTTATATTGGGCAAAGAGAACTGCAGAGCTACGA
CAGAGCTGTTAAGAGCAGTGAGAGCAATTTGATTTTGTGAGTTAGTGGCTTGCTCTACATTAACTTCCTGATTTAATTTTATTGCCCTGGGAAAAGCTTAAGAAAATGCAAGAGCAGCTA
TGTAGGGGGTAAAATAAATTAAAATGTTTCCTAGTAAGACTTTTATGTATATCTAAAGCATGTTAGCTTGTGGATTGGAGACTTAGTTGTTAGGTGTGTAAATAATGGCTACCAGGCAAT
TATTAAAGGTCTGTAAATACCTTTCTTAGTATGGTAACATTTGTGATTTAGTTAAACCAATTTTTAAAACTTGGGTTATTATATTTGTTTCCTGAGTTGTTGATCAATAATCTAAATCAC
TTGAAATTTCTCAAATGTTGATACACGTTGAAGCATTTTTCTTGATTCAGTAAACAACAGTTTTGAAAACTTAGCCAGAAAATCTTCTAATCCTCTATTGTGATATTAGTATTTTCTTGG
ATGTTTTATACTATGTCATCTTTGTGTACTTTCTGGAGTAGATGTTTTCTTTTTGATATCCTCTATTTTACTTAAAAAATTTGGATATATCTTGCATGGGAATAATTCAATATAAGATTT
GGAAAGAGAAAAATATGTAAAAAGAGTCCGAGACCCAGTATTCATTAGAGATTTCCAACAAAACAGCAAGGCTGAAAGCAAGGTTTATTAAAAAAAAACCAACAAAACAAACCAGCCTTC
AGTGTCTATCTTTATATTGGTCATATCTGTATAAAAGATATATATTCATCAATAGGTGTAAGATAGACTTGTCTTTTGAACAAATTTGTGGGATTGCCAAACATTTCAGATATTTGCAGG
AGAAATTTTCTGGTTTTGATGAAGTTACAATGTGAAGAACACTTAAAACAGATGACAGGTAGGCAAGTGACTTGTGTACAGCCCCCACACTCAGGTATAGTATGTAGCCAGTTTTATAAC
TCCATGGCACATGTTTATAATCCTTTATTCATCAGAGAAAGAAGTAAGAACTAGTTGTTGTTTTGCACTCACCATTTAACAATAGCAAGTTGAATTCAAACTAGTCTTATCTTTTCAATA
TTGGTAAAAGTTTGAATTCCCACTGTACATGGAACACAGCAATATCTGTGCAACCCAGACTCCTTAGATGAGAGTTTATCTTTCATGTACTTTTTTTTCCCCTCTGAATACCCACAAGGA
ATTATTTTGTAATAGTGCTAGAATAGAGCAAGTGCCTGTCTCACATGTCAGATATTGCCTGTGACAGAATTTGTATCCTGGTTGGTTGGTTAATTAAATAACTTTTATATACTTAGTGGC
TTTTGCAGGCTGACTTCTCTTTAAAAATATCCATATTTCTCTGAAAGAATATTTCATTTTTCAGGAATAAATCTTCTAGACAGTGTAAACAAAAAATTTCTTTTAAAAGGAGGTCATAAT
TCGAGTGGAATTAATTTATTTTATTTTTTTAACTTTAAAATTTCGAGATAGTTTGACATGATGGTAGACCCGTAAAATAAATTTGTTTACCATCCAGATCCACATGTAAGAAATTTCTGA
TAGCATCAGGATTTGTAAATCTTGATGAATGCCTTTGGGGATTTAAAATTCAGGGGTTTGTTTTGTTTTGTTTTTTTCTTGATTGGTGTCTCTTTCATTATGTAAATCTGTTGGTTTTAA
CTGCATAGTGATGAAGCTTCAGTGGCCAGGAAATAAAACGTTCATTCAGTTCAGGCTTATCTTTAGCTGTATGGTTTGGACATGGGCAGGACATGCCCCTGCAGAGACCAGAGCTCTGTA
TGATCTCAGGAGAGATTCCAGCCACAGGACTGCTGTAGTGGCACAGCATCTGACGCCTGAGGAAACTTTACCAGCAGAAAGTTTTTCACTTAAGTGCTGAGTGCTGGGTTTGTGGCTTGC
AGTCTTCAGCCTCCCCAGTCCTTGAAGTGTCTTAAGTATTTGTGGAAATCCCAGCCATAAATTGGTGTTTGTATGCCTTTGGATCAGAGGGTATATTTGTACTTCTGACCACTCTTAGAG
CAATGATCATTTAACTGTGGAGCCAGAGGATTCTTGTGCAGTTGAACTTAAAATTTGGTGATTAATGCTTCTGGGAAATAATTTTTTCACAGGCTTTTAAGCCAAATATATGACATAGCA
GTGGTCTTAGTCAAGTGGAATACTATTAATTTATACATTTTCCAGTCATGTAGATGTGTTTTTCAGTAGTAGAAACATTGCAAGAATCTTTTATTCAAAGCTGGAAATTATTTGGTAGAT
ATATGTGCTTGAATTGAAAATATTGAAACTAAGATTTTGGTAGATATGTGCACTTGAATTGAAAATATTGAAACTAAGATTAAAAATAATTGGCTGCAGATAGTAGACCTTTTTTTTTTA
CTATTTAGATTGCATATTAAAATAAAATAGTAAGTCAAATGTATTTAAGTAACTGGTCTATTTAGTATATTGATGCTAGTATATACCTACTTGCTTTCTTCCAACTTTCTTTTTTAATTT
ACAAAACAGAGATTCTACCTCTTTGCAGTAAAACAAAACAAAGCAAACCAAAAATAACTCAGAAACATCCTGTGAAGGCATCTTGGCTTTCTTTTGGCCAGCAGTAGTTGTTCACTCCTG
TGCGTGGTCTTCATCAGTTCTCAGAGTCAGCTGAGAAATAAGCAAGGGAAGAACATTTGGTTTTAGTCTGAATCATTTCCCTGGTTTGGTGGCCTGGTGGTGATGTTTGAGAGAGAGGAG
GAGCTGCCTCCTGCACAAACCAGCTGACCTGCCCCTGGGGCCTCATCAAACAGGACCTGCCCTCAGAGAAAACCATAAAATAAGCTGAATCTGTGGTGCAGCTTGAAGGGGCAGGTTTGG
GCAAACAGGGAACTCTAATGCCCCTTCTGGAGAAAAAGCCCCCTTGCACTTTCCTTCCTTGCCAGGGATGCAAGTGCCAGCAGCCGCTGCTCTGTGCTTCCCTGGGCTACTGCACCCACC
TGCCAGAGCAAACGTTCTACCCCAGAAATGTCTGCAATTTTAAGTTCCACAAAATAATTTTTAATTAATATCCCCTCTACTGAGTTGTTATGCTAGATATTTATTATTTGGATATTTTAA
ACTATCTGATATTCCTTAAAGGGAGGTTTGTACTTAATTGAATATTTTAGAGATATTTCTGGTATTTTCATGCTACTTTGGCAAGAGTAATCAAATATTTGAACTTTTTTTACATACACA
CTAGGTCAAAAGTGTTGTTCTTTATGTTTGAGCTGAGGAAAGACCCCTTGAGAATCCGTTTGCAATTATGTGTTACTGGGCAGCATGGCTGCTCTCCATGTGGCCCAAATGGTGTTTATA
TGGCCTGGGTATAGCTAGTTTGTATGGGGTAATAAAAGCAAGAATGTAAATTGAAACGTGTTCAAAATAGAAAAATCAGATTGAGTTATAACTTTAAAAATGGCATTACAGTGTGATGAC
TGAAGAAGGATAAACTTGGATTTTATTCAGAAATTACCTTTTTTGTATTATTAACAACATGAAGTGTGTAAAAACATTATTCTGTCTGCAGATGTTTCATACTTTTTTCTGGTATCTTCA
GTATTTTGTCAATAGAATGGAATAATTACAGAGAGATCCATAGAAGAGTGCCTTCTAATTGATTGTTGGCTTAATGCTGCCAATATTAGAACTGCTAGGAAGAGGGTGCATGACAATGCA
AAGTAGGTGAGCTCTCCTGAGGCCACTGGAATTAAAAATACTGACAAGACTAGTAAGATATACTTTGAAACTTCAGATACATCCATAACTTTCAGTTTTCCAAACTGTTTTTTAAGATGG
CAAATCAATTTAATCTATGTAGAGAAAGAAGAAAAGAAATGTGCAGGGGAAGAAGTTGTAGGCTAGTATTACTTAGTTCTGCTTTTGCAATGTGAGGTAAGAGATGATGGGTATGGATTG
AGGCATGCTATGGAATATAATAAAATGTATAAATCATAATGTTTATTATTAATCTTTTCTTATTCTCTTGATGCATTCTGTAAGGTAACTTATGCATTCTGTAGGGTAACTTGTTAATGA
GTAGTAGCTCCAAAACTGCTTTTTGTTTATAATTTTGATATCTGTGTGAGGATGGACTTGACTTAAGAAGAAAAGTGAAACAATAATCTGTTCCCAGACATTCCCTTCTCTGCATGGCAT
TAGGCTGGGTCTTCTAGTAGCCACTTGCATTACTCTTCCTGGGGAGAAAACGACTTCTCCCAAGAGAAGCGACCAGTTGCCTGCCTTGGGGCTGTCTGCACTCCTGAGGACTGGGGAGAT
AAGTATCAGAGGAGTCCTAAGACCCCTGTTCCTCTGAGTTTTCTTTGCCAGGAGCAGGAGGAGCTGGAGGCAGAGTCAGAAAGTAGCTAATTTATCTGCTCTTGCAGCCTGTTGTTAACC
TCAGGAAGCAGAAAGTTCCATTCCAAGAGTTGCAGCTTTTTCATTGAGGTGACCTGGGATTTTCCATGGAGTGGAAGGAAGAGCTGTTGCTTTGTCTGAAACCAGGAATTCCAGTCTGCA
GCCAAGGGATAGAGTACCTGAGTTTTTGGTGTTACTTTTTGTGCAAGCCAACAGTGTTTCCATTTTGATAGTAAAATGTCCCTTAGCATTCTACAAGAACAGCTATCCATATAAATTCTA
ACACCTCTATTGGAATCTAATAAGCTTATCACTATTGGAAATAAGTGGGAAGTACAAAACAGTTGGAAATATATTCCAACAAAATCTGCCTAGCGTAGGGGGAAGAGTGACACATACATT
TACAATGAATAAAAGCTTTTGAGTCCAATTTAGATGTTATTTTTAGATGCAGTAATTCCTTCAATTTTCCACATCCTTTGGCTTGATGTTGGTCCTGAATTGCAGAACTTCTTTTTTAGT
TGAAGAAAACAAAAAGGGCATTTTTTAGTAAGGTCATTGGCATCTTAGATGCCGGATGTTATTTATTGGCATATTAAATATAATACAAGCTCACATGCACTGCATCAATGAGGCTGCCTG
CCCTGAGGAAAGAAGTCCTTAAAACTGCAGGGATGGGGAAACCACACTTTTATTCTGGTTTATTAGTTCCCTTGTCCAGCTTGTTCATTCAGAGCCCTCACTCTCACACCTGTTTTCAGA
TGTAGGATCTGTGTTGCTGAGAGCTCAGCCCTGCACTGATACCTCACCCAGCATACGGCATACCCAGCTGTGTGCTTCTGTGGGAGAAGTGCTGATGTGGCAGAGTTAAGGAAGCTTAAG
GCACTGTGGTAAAACACGGGATTATTCTGTGTTGTTTTTCAATTATGATTATGCACACTATTTGCATGTATTTTCCAGAGAGAACTAATCTGCTACAGAATAAAATCAGAGTTGTATTTT
TTCCTACCCATCCCTATTTGAAGTTTTATGGTTTATTTATTTTTAAATCATTCAAGAGCTGCTGCTGCAAAAGAATTATGCATAAACTTCAGCATTTGGATTTTTTAAAGGAAAATGGTC
AGTGCTATTCCTCACTTAAAGGTGTTTGTTTCTGCTGAGCAGAAACTGAAAACAAACATGCTGAAGCTGAAGTTTGGAAGCAGGATGAGACTATCCCATTTTTAACAGTGAATATCCCAT
TTTTAACAGTGAAAGTTTACTACTGGAATGATTAACAAGTCGTGATTTTGCTTGATTAATGGTCTTGAATCACACTTTTATATATTTCTCAAATGGATGGCTGAGCTCTGACAGCAATAA
TTGCGTAAAGACACGAATTTCTCTATTGTTGTGTGACTTATTTTGTGTGAGAGGTTCAGGGATGATAATGTTTCTTTCTGGCTTTCATTTTTTTCCTCTGAGAATATCAGTATTTCATGG
ATATAGAGTTTAGAATTAAGAATTCCTGTGAGACAGAGAAGTGCAGAAACAATATTTATTCTACAGAATGGTACATGGGAGGAAAATTAGACTAATTTATGACTGTAGCGTAACAGCAGA
ATTTCTGTGGGCTTTTCACAGTAGTAATTCACAGGTCTGCTAACTTTAAAAGCAAACAAAACTAGTGCATTTGTTTCTGTGGCTCATGCTGAGCCATAAGCTAGTCAGCTTCCTATTTGG
TGTCTTCTTTAGCCTACTACAGAATAGAAACTTAAGTTTTTATTCAAAAGTCCAGTTGAAACTGCATATTCTTAAATATTTAAAAGGAAACCAAAAAAAAGGTTGCATCTCCAACTGCCA
CTAGTCCTCTAAAATATTTCAATGTGTCATAGCTCTTTACACAGACTGTGCCAACCTTTAGTTTGATCCAACACCTTTGCTGTCTCAGATTTGTGTTAGTACAGCACACAGACACAACTG
TTGTGCTCTGTTTTATTGGGCATAGCACAAACACAGGACAAAACATCAGCCCTTTCCCAAGGTTATTTCTGTGAAAAATAATCAGTAATGAAACATATGGCTGTGTTGTCAACAGCCTTT
TCATTGTTTGGTTTTAGCAGTAGATCCCCCTGAGAGAAATAAAGACAGATCTTGCCTTTTTGTGGCAGAAAAGGCAAAAGCTGCAATTTTGCAGAAACAGCGTTTGCATCTCTGAATTCT
GTCCATGCTGGTAAAAGGAGGGGATTTGGTTGTGTGGGTTTGGTGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTTTTTTTAAGATAGCATGAGAATTAGAAAACATTATA
AAATAAAATTTCTAATATCAGAATTATCAGAATAATTTCTGTAGTGGATGAATATTGAAGGACTCTGAAAGTGGATGAAACAAAGAGCCACAATCACACCAGGGTAGACTTTCCATGTAT
AATTTTTGGCAAGCCTACAGGCCTAAAACTTTGGACCAGCAAATCCCACTTGAGTCCTTTAATGGCACTTTTAATGGCTGGTTAGAAATGTTGGCGACAAGGGCAGCAAAGGGATCTAAA
GACTTAGTAAGACAATACTGTAGTGCATGTCATTGAATTAACATTTAAATGTTTTCCTTTCAACTGTAATGGCAAAATAATTGTTAGTTAAAACAAATCCTTAGCTCTTGGAGAAGGATA
TATCATAAGCTCTGCATTCACCAAAGCTATAGCTGATAAAATAGTTTTTAAGACATGTGAACTCAAAATTCCTGTTAACAAATCTTACATATTTGTGCAAATCAGATATTATTTTAATTA
GATAATTGATATATCATATAGACTTTATGAAGCATGGGTTTATGATCAAGGCGAGTACTTCCAAATGCTCTTCATCCTGTTTGACAGATTTCAGTATTTTTGTGGCCCTACAATTTACTT
TTGGTACTGAAATTACAGTATACTAAGTACTGTTGACTATGGTACCCCCTCACCATGTAAGAATAACCTTTTAATTTTCCATCTCAAAATGTGGTGGCTTTTTTTATGTGCTGCATGCTA
ATGTACAAATAATGAAAATATCTCAATATAAATTAGAGAAAATTACATAGTGTACGTAATAATTAGACTGGGGAAGATTAATCCAGAAAATGAATGTCCAATAAAATAAGAATTACAGAA
TTTTGTTTGTAAAAGAAGCTCTAGGGCTAAATCTGAAAAGGATGCAAAAATCCCACAAAAATTTAATTCCTGTATTCTAGCAAATGTTACACTGCTAACAGAGATGATTACTATAAGTAG
TGCTATATCTCCAAGTAGGGTTTGGTTTTATTTTTTTTAAGTGGTGGCTGTGTCTTTGTTTGTTCAACAAAGTGACACATTTTTTTACAGGGCAGTAGTTAAAGCAGCATTAAAGTGCCA
TTGACATCATCCAGTTACTCCACTGACTTGATTATATAACCTCTTTTGTGCAATTTTCATGCTCTGCTCTGTTTGAATGTTTTTACTATGCTGATGGCTGTTTTTCATTTCCTGCTGGGA
TGACCTTGAATAAAAAAAGAATAAGAATAAAGTAGACATAAGCAGTGTAGTCTTGCTGGCATTTGCAGATCTTTTGTTCTGTATTGAGAAACATAGCAGTTTGGTGTTCAAGGTATAGGT
TATTTCTGCTGGGTAGTAATTATCTGCAGTGGTTAGGAAAAAAATGTGACTTATTTTGTTCTTTTGGCTTTAGCAATGGTAAAATCATCTGGTTATGACAATTCTTACCTTACGAACATG
TCAGAATAAGTGCTAAATACATGATGGCAATTATGTAAACTTAAATTATTGATTTACCTTTTGAATATAATAGGGCTACAAATCTAATATTTATCTATTAAATTGCTCCCTATTTTTTAT
TTTTTAAAGGAAAATGCAAAGGAAAAAAGGAAAACTTTACATTTTAAAGGAAAAAAACCTAGTTTGCACCTCTTTTCCAGCTGAAGGAATTTATTTTCTATTTTATCTTGTTGCAACTTC
TTGTTGCTAATCAGGATTTCATAGCTAGCCTTACAGATGAATAAGTGCACTTATTCATCTGTAACACTTATGTGTTTCACATAAGCATCTTTCTGAGACTGTTTATATCCCTCAATATCA
GAATGTTGTGATAATGATAAATCAATAATTTTAAGGCTTGCCCTATTTCTGCCACTACTTCCTCTTTTAGTTTGTCAGATAAAAGTAATGATGATTATATTACCATACACTTTACAATCA
CTTATAGAGGAAGAGGTTTAGCTTTAAATAATTTTCACTCGACCTTTTAAAAACATCTAGCTTTGCAGCAGAGCTTGGACATTTGAGAACCTGTCAATTTTTAAAATACTTAAGACAATA
GTGTTCTTTTAGATTTTTCCGTTTTGCTGCTGTGGTGATTTTGCTTAGCTGAGGAAATAACTTAAAATTTAAAGTTAATTCATATCTTAAACCAGTGCTGAAGTACTGGTTAGCCCTTGA
AACAAGGTAATGAGATACTTACCTTCATTGCTAATAAAAATCAGGATTTGGTTTCGTTGGTAAATGCTTTAGTATTTTGCTTTAAAATGAAGACTGGTAATAAAAGTCCTTAATGGGTCA
GCATGGCTTTTGAAGCAGCGTATTGTATGACTAAGTTGGTTTCATCCAAATTGCCTTTGTCTTGTCCAAAGCTAACAGATACACAACTATTTTCAATTTAAAGTATGTAATCAGATGCTT
TCAATATGACAGGCTAAAAAAAAAGCAGCTCTTCAAAACTTCAGTTTAAATACTTTATACTAGTTTGCCAGTGGTAAATTTGCTTTATTCTTTATTTACAGATACAGGTTTTGGAGACAC
TGCTTTTTAAAAATTACTTTGTTTTACTTACTCTCCTTTTCATGTAGTGTTCCTTAGCATGAATGTGTGAATATGATCTTTACTCTGTGATACCTGGGTGCAATATGCTGGTCATTAAGT
CCCTAGAACAAATATAACAAGTGTAAGTGAATTCAGTGTTTAAGTTGTTCTGTTGTTTGCATTTAGTCTTATTAAGCAATGTAAGAGGATACTTTCATTTTTGGGCTAGAAAAGCTTACA
ACAGATCCTCAAAGATTAACAAATTATTAAAGGGATCTTCTCAAGTTGGGAAGTCCAGGTGATATGAAATAGTAGGTCTAACCAAAAAGTACTAAGTAAGACATAGCTTCGTGTTGCACA
ATTGGTTGGCGTCAGTGCAGCTAATGCATGCTTGGTTTGACCAGTGTCCTTCTCAGCCCTAACAGTTAAAACAATAACAAACTTATTATTTAATGTGAGAAGGAAATAGGATCAAAAGTC
TATTTTTGCATTTATTTTTTTCAGTATCGGGAGAGGTATAAACAGAAGGTCAAATTACATGTTGTGCTTTAAATCTTCCTTTTGCATATAGAATTCTCCTCTCAAGCATTTATCTCAAGG
AATAGAAGTGTCAAAGCAAACTAAATTATCTCCCTTACTTTGGTTTAAGATTTTGGGGCTGTGTTGGTAATTCTAGCAGCTACAGTTAGAAACTCTTTCCTTATACTACATTTTGTTAAT
CTTATTGTTACACCCAAGAAATGAGCCTTAAATAAAATAATTTCTATTTTTGCTTTCATTTCTATCCTGTAGCTAGGAGTAACCAAGAATACTTGTAGTTATGATACTAGATTTGAAATC
TCTTGAATTGTCTCATTTCTGTGACATGCAGAGTGAGTTATTTTTGTGAATGCCCTGATGTTATGCTTTGCATACATACAGTATCTCCCAAGATAAATGTTTTTAATTACATCAGCACTT
AATACAGTGTTTCTATATCCGTGTTACAATTGGCTAATTATACATGTATATATAGAGAAAGATGACTTTAGAAGAAGCAGTAGCATAGCACATTAAATTTTGGGTTTAATTTTTTTATTA
AATATCTTAGTATTGGGTCATGACAAATTTTTTTCTGACACAGATTAAAATTGAAAAAATGAAAGCCATTTTTAATATACTTTCTAGCAATGGGGGGATCTCTGGGATGTCCTCCAAGCC
CTAGTAAGTCACAGGATGCCCAGTCCTCAGGGAGAGATGAGAAGAACATAAGCAGAGTAGAAGCCCTGGTGTCTTTCCCATTGCTGCTCCATCAGTTCTTTATAAGGAATTTTCACATCT
GTCCTGCTTAGGATGACACTTTTTGTCATAACTGCCAACTAATGAGTGCTTATTATTTGAGATCAGTAGGTTATCACTGGTGGAGCAATGACTGTGAGTGCCCAGTTTTGGTGTTGAGTA
TCCACAATCTGATGCAAAGGTGGCTGTCTTTTGAGGTGCATGATAAGAGCACACGCTATGTTCTTCACAACCCTACTTCAAATACTTTTGACTTAGAACAGTTAATGATTTTTCTGATTT
TGATGAAGCAACAGAATCTTTAAAATTCAAGCATGCGTAAAAATGCATCTGAAATAATATTGATGTACCTGAAGTCTTTATACTTTATAAAAGTACTGTGCTTTATAAAAATAATGGAAT
TATAATCTTTACCTTTCCACCCTGTATGTTGCTTAGCAATAACTAGAAAAAAAAGAATAAAGGAAAACTGCACTTTAGGCATTTTATGTAAAAAGTTGCACTTTTACGTTCAGCTCATGG
TTTGATCTCAGTAAAAGCAATCGCTTCTCTCAGAGATTTCAAACAGAAACTTCTTTAATTTGTTCTTCTTGTAAGTTGCTTGATGTTTAAGGTCAATTTTGTACTGTTTGCTGTGTACCT
TGTGTGACTGTCCTATATCCAAATATTTATTAAGGTCTTTAGTATTTATAAAGTGTTATTTTGTAAAGTTGCAATGAATTCATATGGCCTGATGTTGCCATACCCTATCGGATGTTTTAA
GAGAGAAACCCTATCTTTCATTACTGCACACTGCTAGTGCAAACTTTAAAGAATGTCCTGCAGTGCAGGATATGCCACAGTAGCATTGGATCTTATGGGTCAGTAATGTTTTTTTAATTT
TTATAGACCTAGAAATTTTCACTGTGTTTAATTAAATAAAAATATTGTTAAGAGTTAATTTTCAATGCTAAATTGGAAATAGTTAAAAATGGGCAGTGTAAAGATGGGAGACAAATGGAT
GCTGTTAGTTGAAATAAAGAATTTATTAAAAACAGGATTCATTTTCATCCAGACAAAAAGTGTCAGCAGCACATTTCTCGTTTGCTTTGTGACAGAAAAGGAAACGTATACAAATACTGT
ATTTATTTACATGCCATACATCTGGGCCTTACAGATCTTCCCAGAGCCCTGTTCAGGTAACGGAATGCAGGAAGCCTGCAAAGCCAGCGTGTGTGCACTCCCTGGCTGGCTCGTGTCCTG
GCCATGGCTGTGGGACCACGGCCATTCCGAGGCGCTGGAATGCGAATCTCAAGGGCATCCAATTGCTAAATTGACCGCCTGCTCCCTGGCACGTTCTTGGCCCACGCAGCCTCGCGCTCT
GCCGAACATTTCCTGGTCATGCTCCATGGATTAGCGCAGAACAGACTCCTGAGTGCAGCCAGGAAAATAACCCTTGAGAGCAGTCAGTTTACTGGCTATCATGGACATGTTTTGTTTGTG
TTATTCAGGCAATCCGCGCTTCAAAATGATGGGCTTAACTTCTGTGGAAGCCTGTGCGGCTGAAGTGGATTTTTCAACTTGAATTATGTTGTCCAGCTACTATTTCAAGAAGTAAATGTT
TTCACTTTGAAACACGTAATAAAAGAGACAATCGGAATTATATGTAATAGATTTTTATTTTAAAAACAAAATGCAAGACATTTAGCTTTGAATCATTATTGCCCTAAAATTTAATGCCAG
CATCACAGGTGTTTGCATTTCTTTAATTGGTCGTTTCACTTACTGTTTAGAGATTAATAGGGGGAAAAAATGACAGTCGACAGCTGAGTGGCGCTTCCCTCAGTCTGCTGTTTTAACCTC
CTGGTGCACTCTGGCTGGTCAGTGGGAGTCAGGCTTGCCCTGGTCCAAAGCACAGCATCCAGCCAGGATATATCAGTTTGTAATAGTGAAATGGGGAGCAGCAAAAAAGGTGAAAGAGAA
TGAATGGGCAGGGAACAGGCTTTTGTGAGTGAAAGTCGTGGCGTGGTTGGGCCGGAACTAGTCAGAGAAAAAGGGTCAAGAAACCTCATCATGCTGATTGACCACAATTATTTCAGCAAC
AGAAAATGCATTTGAAGTTCTGCTCTATAATGGCCTATTTGTGCTACCCATACTCATATTTCAGTTTTAACACAATCCTCATTCCTGCCATTTGCTCTCCAAGGGGATGTTTCCGATTGC
TGTTGGGCTTTTGCTCTGAGCTCTTCTGTTCCCTGAAATCATTCTGTTATCACAAGCTGGATATGGTGCCAGTGCTATGGGAGCATGACATTTCAAGCCTGAGAAATGGTGCATTCTGTT
TATGGAATGGGTTTGTTGTTTTTTTGTTTTTTTGGTTTTTTTTTTCCTATGATGGTATGACAGTGGTAGCTAAATTTTTTGCTTTTTTTTTTTTTCTTCTACTGAATCTGATTTCTGCCA
ATTCGGTTTGGCAGTGAACCTTTCACTTCATTAACTGGTCTTGCATATTTTTTCCTCTAGCAGTTGAATTTTACACTGAGCTCATGGCCATTCTGCCCCCCTTTCCTGGGACCCTGTGAC
TCTGATCAAGATAACCCCGGACCCTCCTTCCTACCCCAACGGGGTTGGCAGAGAGCCAGGAAAGCCCACCCTGTCCAAAGTCTATATAGACCCCTGACATTTCCTGTTCTCGTTCTCTTT
TCCCCCGCTCTCCCCCAAGGACATCACAGAATAAAGAGAGCTGAACCAACCTACCCTGGGGTGAGAGCCTCTTTTGAATATCTTTACCCTTCTCCTGATATTCCTCCCCTCACAGCCCCT
TATCTCTGAGCTAGTCGGATTATTCGGGGGTCTGTGTGAGGGGGGGAACCACAGTTGAACACTTGGTTTACGGAGATTTCCTCTATTGTTTATGTGAATGGCATATACCACACTCCCTAA
ACTAATGCATGCAATGTAAATTCTATTTCCTTTATCCTCTTGTTTATTATCTTGTTTTATAGGGAAATTATCACGGTTTGACAGATTTCTTCTTTGGAAATCTTCAATGTTTATGATTTA
AGTTTTATCCTCTTAATTTGTGAGCTGTTTAACTCTTTATTTTGGGGGATTTTGTGCTGAAAATTAATGAAAATACTTTGAGTAAACACTGATAAGTGTTACTTCCTTTGAAGAAGGAAA
TATTCTTTGAAAGAATGGATAATAAATATGGATAATAATAAAACTATAATTCTAAATTTTAGTAAGGTTAACATTGTTTTTTCTCTCCAATTTTAATTTAATTGTAGTACTGACTTTGAA
CAAAACATATATATTCTTTATAATTTTACTTACAGATACAAAATTTACTGTGCTCTAGAGAAAATTTATGTGCTGTGTTTTATTGCAGCTCCTTTTTCTCATATCTTTATGTAGAATGAA
AATGAATGGGTAGAATTTCAAACTTGGTGTGTTCTTTAGCTTTTACAGCTTCATATGAGAAGAGCAGTAGTATTATGCTTCGAGATAAATACCACTAGATATAGTATTACATGCAGCTTG
GTGCTGCATGTAATAATGCATGTAATTGCTTGGTGTTCCTAATCCCCAGTTATCCTCATGAGTTACTGCAGAGTAGACTGGATACATCAAAAGGGGGTTCATTTTGCTGCTGACCCAGTG
GACTGCCTCCTTGCTTGCCTTCAGAAAAGTTAAATTTTTATTTATTGTCTTTGCACCCATGTAGGGAATAGGCCTGCTTGTCATATGGATGAATGTATATTATTTTATATCTAAAAAAGA
GGTTTTTAGAAGCTAAATATTGCTAGTTGTTATAGTAGTTTGAGGCTTTTGAAAAATACTTGGTTTCCAATATTCCATTAATGAATGTTGAATTTTTTTTCACTTTTGACTATTTTGGTC
AAAACTAAAATGCTCCTTTAGAACACAATAAACTTTCAGATAATCTAGAAAAAGCAAGAAAAATAAAGTAGTATGTCATGTCCAATGATTCTTACAGAGGGATCTGCTGTATCTTCTCAC
AGTGCAGGGTATGACATTCCATGGTTGTTTAGAATATCTTGGAACCTGAGGTTCAGAGGCAGTGTCTCATTCTCATCAAGAACATATATCTATGACACATAAAACATAAAACAGTGATGA
GCAAACATAATGCTGTTAAAGCAGAACTAAAGAAGTGCTCTTGTGAAGAACAAGTTAGGGCTGTGAAAATTTGTGTTTCTAAATATGGAAATCCTCAGTTCGCTGAGTGTTGTGTAAACG
GGCTGTCCAGCATATCTATAGGCAGTTAGCTACATATCTAAATAAGAAATAGAGTTTGCATCCCTCATTTATTCCAGTCACTGATCAAGTATTTTGGTGAAGTGTAATGCAAACAGAACC
ACATGTCTAATCCTTTCCTTGCAGTCCTTCTGAGGCCATTATTCCAGAGCTGAATAAGTCTTGACGGGTGGATCCATGAGAAATGATGCTCAAGTATGGTCTTTATAAAAGACTTCCAAC
AACTATACCTGCCATTAATACAGCCTCAGCCAGTGGGGTTGCATGGGATTAGGATGCAGCTGACATATTGTCTGCTCTTCTGTATTTCCTTTGACCAAATTGCAGAGAGACTTTTGTTAA
CATATTACTTGTTAAAATGCAGAGGATATTTGTTTTAACTGAGACCAGGTGTGGTGCAAAGATTACAGTTGTGACATGTTTATGTCCTACTTTTTGAAAACAATTGGTAAGCATGTGTTC
TAAGATACATGATCACAGTCTTTTAGATTTTACTTACTTTCCATTTGCTTCCCTTCTGTTTGCTTACCAAACACTATAAGGTCGTGGTGTCCTCGCTCTGTTTCTAGGGAAGAGGACAGA
CCTATTACCCTGCTTCCTTTCCCCTGCTCCTGAAGTCCTCCTTTCACCTAAATGCTCTCCCAAGAAGCCTGTCCATTTTGCTTACCAAGCAGAAAATTATTTCCTGCTTGTTTTGGGTTC
TTTTGCATGAGGTTGTGCTGGTCTGACCAGTTGGTTAATTCAAATTTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCATTAGAAAGTTGTTTCACCTGTGGGAAGAGAGAACATACTTCATGACCACAGGTTTAACTTATATAGAGCCTCATCTGACACTGAG
GCTGGATTGACATATCATGCCATTACTATATAGAGCCATCATGAGGCTGATTGTGATTCTCTGCCTAAACTTCGACCACAAAGAAAAAAATAGTCACAGCGGTTCTTAAACGACAGCCAG
GCACTTAAGCTTCCCAGAATAAAGAATTGAGTAGCAAGTTTAACCTGTTTTTTTTTCCGATGTTTTTTTTTTTTCCAATGCAAATGTTTCTATATCTGTTTATTTATAAATATGCATTTT
TGTCTGATGGTAATATTTACAAACAGCTTTTAAAGTACAGAGACTATTCAATTTAGTGAAATACTAAACAATCCATTAGAAGTTGTTTCACTGTGGAAGAGAACATACTTCATGACCACA
GGTTTAACTTATATAGAGCCTTCATCTGACCACTGAGGCTGGATTTGGTGAATCCTCTGCCTAAACTTGTCAAACAGCACTTGGGTTTGTTTTGCTTTGGTCAAAAGCTGTGTTATATGG
ACAGAGTCTGGTCAGTCATCACAAAGGACTTGTGCTTAGTTCATTTTTCCATATGAAAAAATATATAGCTTTTTAATAACTAGATTTTATTTTTTTTTAATTCTACAGAGATCTAAGATT
TAATAGGATTAAAGAAATCCAGCCTGGAGAGTTTAGACGGCTTAAAAACCTGAACACACT
GTAAGTCCTTTTTCAACCCTAAGACCCTTTCCCTTTTGACTTAATATGATCAATTTGATA
ATGTGTCATATTTGCTCACTTTTCACAGGGAAGTAGTGTCATAAATTTGAGCAGTAGCATTTACACAGGTGGAACTGGGGGTTAGAACCAAAATATTTGAAGGCAGAAACACGCATATGT
CTATCAAAATAAAAATAAAATTATTTGCATATTAGTATTTTACTAATATACTTTAATAGAATTTCATGAAAAAATTCAGGCCATTATTGTAAGATTTTTTTGACGTGGTGCTAAATTGTT
TTGCTGGAATATCACATAATAATCCATGGGGTTACAAAAATGCTGTTCAAAGGCTGAGATGTGCAAATGTGTTACAGCTACAAAATATTTGACAAATTCTAATATTCTAAACTTTCCTAT
TCTAATGTGCTTACCAGGACTGGCAGGAGTCAGATGGTTTTGTTCCTACTGAGCTGCCTTTTATGGAGGTCTTTGTTATCATATATGATTGTAAAGAAAAGTCTCTCTAAAAGTCTGTCT
TACCACCAAATACAATTAGTATGAGTCTTATCATTTTAACTTTGTATCTTTTCTATCATTCCTTCAGGCATTACTTTTAAAACAAATGCATGCATGTTTCTCTTCTTTAATATATTAGCA
GGCATGAGGAGGAATTAAGGCAGACAATTATTTTTACTTTTAAATGTACGTAACTTATGATTGCAAATGTGACTGTTTCCCAGAAGAAAAGTAGTGTATGAGTTGAAATGCAGTAGTGAT
GTCAGTGAGCTTTGGATCACTATTTATCTGCAGGCAGTCATGACAAATATACTGACAGATCTTTTACTCTATATTCACCTCAGAAGAAAAGATAAGGCCTTCCCTGAAATGTATGATGTC
CAAATCTGTGCTGCCAGGATATTCTTACTAACTGTCCTATTTCCAGTCTCCTTTGATCGTACCTCTCTTTGCAGCTGATCCCCAGTTTTGAATTACAATTTCTGCCAGATATCCAGCTCA
AATTTTAACTTCCCAGATCACTGATCTGATATTCACAAGTCCCAGATAAAGACAGGATACGTTAAGTTTGAATTCCCTTCTCTTTGTAAAACCAGTGTATGAGGGATGAGTGCAAATCTG
TGCATACAAATAGTTGTGTTCCTGTACAATGTAGAGGACCCAGTACACAAGAAACATCTGGGAAAAGTCACTTTAATGCACCTGCTAGTGACAAATCTTTGTTTTTGTCAGTTTCAAACT
GATGTGTATACTTGATGCAGAAAGTTTTTTCCTCCCCTTCATCTACATCATAGATAACTGCAAGAAACTACATTATTCCATTTCTGGGTGGGCCTTTTTGTTTTTTGTTTGGGTTTGGGG
TTTTGTTTATCTTTGTTGCTATTTTTATGGGTTTGGGTATTTTTTAATTTATTTTTTTACAATTCTAATTTTTTTACAAGTCTAATTTTTTCAGGTTTTTGCCTGCAAGATAGTGGTTGA
GCAGCCGTAAGCACATAACCTTTTTTTCTCTAACAGTTACTCTTAGGGGAAAAAGCATTTTCTCTTTAATACTACATTGCCCTTGCTTTTACACTTTTTTCCCTAGTGACTCTTTATGTT
AAAATAAATGGTTGTTTATTTCTTTTTGCAGGCTTCTAAACAACAATCAAATCAAACGAATTCCTAGTGGGGCATTTGAAGATCTTGAAAATCTGAAATATCTGTAAGTTAAATGAAATG
TCACTTCACTGTGTAACAGCTTCTTCAGTGAGAAAGTGTTCTAATCACCGATGGTGATTTCTATCTGACTCACTCTATCAGGAGATAAACTGCACTGAAAATCTGTGAAATGAATTTATG
GGGTGGGGGCAACTGTGTTTCTCTTAGTAGCTGATAATAAAAGACTGTTATCTGTTGGCAATACATTTTAAAGGACTGACTAGTTGTGGTGGCAGCTCTCTGGTCATAGAGAAAGAAAGC
TAGATAAGCTTTCCCATGGGTCGCCTGAGAAGCTTTCCGGAGTGGGAGAGAAAGAATTCTAAACAATCTGCACCTGGTGTTTTGCAATAAACTCTTTTACCCATAAGGTTGTTTACAAAC
AGGTGTCTTGATAATTAACCAATCATGTGAAATGTATTGATTACATGACCAATCAAGTCCACCTGTAGTGAACTATGCTATAAGAGAGGAGAGGATGAAATAAATGAGGCTTATGCTAAT
TAGCCTTCTGAGAATGCATAAAGTGTGTCACTAACTAGGTCTTCAGTCAGCCTGTATATTTTAAGCCTAACTTCTCTCTTTTTTAACAAACATACCAATGTTATTAATTATATGAATAAA
CAAAAGGCATCAAAAATGTTTTTGTCTGTATAATAGACTAAAGGTGCATAGTTGGTTGTCATGGATTCTCAGCTCTAGTTTCTGGAGTTGACCTTATGGAGTGTCATTTAGAAAAGTTTC
AATCCATTGTCTTGGAGTATTGATTGATGGTTAGTTGAAAGAAAAGGTCACATTGAAATTTCATTGCTTTGGAAACAATTCAGAAGCTGAGATTTCCATGCAGTTTCCAAGAATACAGCC
AGAAGACTTCCAAGGAGGTGGGAGCAGGGAGAAAAATCACATAAATTTGTGCAGACACATTTGCCTGTTTTGCCAAGTTGTGCTTGATTGCGTTTCCTGTTCTCATTTTTATGTGTATTG
TCTTTCAGTAATGAAATTGTTTAACCTATACACAATAGAATATTGAACAGACTGTCGCCAATGAGTGATTAAAGTCCAGGATGATTGTATTACAAGAAATGTCTGTATGATGGTTCTGGT
AGTGTAGTACATAAGGTTTTACTATGTGAAGTTTGCTAAACTTCTTTAGCAGACTGACTACGAAGTCAGCAATTCTACAAAGATTTTTCTTGTTTTGTATTACTTTTTTTGTTTTCACAT
GCTTGCCTTTTTCTAGCTGTAGTAAACATGATGTAAAGCTTAACAATGCAGTGTGTTCAGTTCAAAAGTGAAAAAAGATAACTGAACTCTGATTTGTTCTCATATACATGTAGTAATAGC
TGTCACTATCTATACTGTTAAGAGGAAGATCTTTTTATTTTCCTGGTGTTCCCTGGAAAATTTAATTATAAAGTTCAATGTAGTAATTTTTTCTTCTGCAGAGAGCTCTTTAAAGCTATC
CTTTGTTTTGAAAAAATAAACTAAGGGGTTTTTTTTGCCTGTTTCAATGGCTGTAACAAATGTTTAAATTGAACAGCCTTAAAGTTAGAAAATTTCTGGTACTGGTTAGATTATCAATAC
AGAGCACTTAAATGTAACAAATCAATACAATACAATCAGCAGTGAAAGTTTCAGCTGAGTAACTGAAGTCTAACTGTATTCTGTGAAATGAAGGAAACAAATCAAAAAACATTTCTTTCC
ACTAGGATTCACTGAAGGAGAAATCAGGGGGGAGAGATTGTGAAAAGTTAGAAATACTGCTCAGAATGTATTATTATAAAGTCAAATCACCTGGAAAAATGGAGGTTTAGTATCATCTGG
TCCTGTACGTATTTGCAAACCTAACTTGTACTGTCATGTTTCATAAAACTAGATCATTGATCCATGATGTTACTTCTGTTCTTATGACAGCTTGTACTGGGTTGCATGTGGTTCTGAAAA
TGTATAATTTCCTCACTAATTTAAAAAAACCCTGTCATTTCTCAGTGGCTCTGATTTAGCAAAATGTGAGTATATATAAATATAAGATCTGTAACAATTTTTAAACATGCATATATAAAA
CTAAGTAAAAATATTCATGATTCTATATTTTATATAAATATAACACAGCATATTTATATTTTTAGAAGCCAGTCTCTGAGAGATAGCTGTTAAGATCCATTCCTGTGTGACTGCTGAAGA
TCAGTGTTTTGCTTTCAAACAAAATTTTTTTCAGCAGGATCTAAATCAGAATTTTCAAATGCTTCTTTGTACTATTCCTTTCTGAAGCTGAGCTTAGAGTTTTATGAGGAGTATATGAGA
ACTGTCTAAAGAACACTTTTTGACGAAGAGTAATATTTTCTCAATTTTCTCTGCGTTGAAAGTATTCATCACTGTAAAAGTTGGTGTTTACATCACAAAAAGAAAACTGCACATAATTTT
TTAACCTTTTTTTTAGGATTTTTTATTATCTTGTTCTTTATGTAATTGAAATTCTGGCAATTATAAAAGCAGATTTTACTGCTCTGTTTGTGGTAATAATTTGGTTTTGTATTAATATAC
TAAAGGTTGGAATGAAAGAAATGTAATTATTGTTTTGTTGTGAAACTAAGAGGGTACTTTTTTTTTCTTGTGCTTCTCTGCTTTTCTGTCCATCTGTCTTTACTCCATATACCTCAGTGT
TGGCAATAAAGATCTTTGGTAAGCTTCTCAACCTTATGATATAGATGCAGGTAAATTTGTAGAAACTTGATAGGATAATTCTTCCTAAGCCTAAAAATGAACAATTTATTCTCCAAGAGA
GAAGACAGTTGGGAATTGAGGGTAGACACATTATTATCATTTCAATGTGTAGAATACTAGAAGATTTGGAATCAGAAGTGGAAAAAATGAAGGTAAGTTAAAAAAAGAAGTCGTCAGGGG
GAGATACGGAAAAATATATAATATAGGTTAGCTATTAAAAACCTTTCCAGATAAAGAGAAACATCTATTAGACATTTACAGAGCAGTGAGCTAGAAGATAACATGAAGGAAGTGAAAGAA
ATAAAACCGGGGAATGAAATTAACTTTGTCAACAATGTATGTTCGCCTGGTATGAAATGCATAGAGGAGGAAACAGACATGAAATTATTACCATAAGCGTATGGTAAATGCTCATTGAGA
CTGTATGAAGTGTATCAGTTCCAGAAATGCCAACAGGGAGCATGCAAGTTTTGTTTTGTGGCTGGTGAATGAAGTAATAGTGGTAGATGATGTGTTTGAGATTGGGTCTCATTTCCTTCT
GTGCCTTCTGCCACTCTTGCTGTCTTGGTGATGTTACTTGGTCCTCAGGGCACCTCCAGTGGTTCCAGATCGCTTTTCTTTGCACTTCATGTTGCTGGTTCCACTGTCCTTCATGTTCCC
ATGTAAACCTGTCTTTGGGTGCTTATTTACTTGTGAGATTTAACACTGCAATGCCTGTTACTTTTTGCCTTTTTTTCTCTCCAGTTCCAAGCAAGTATATCTGAATCTTACTTTCCTTAA
ATCGTATGATTTTTAATATGGCCCATAAAGAAAAAGAAAAAAAGAACCCCCCAATAATGTCCTCATAGACAATCTAGCACATTTGTTAACTGAAGCTACTTTTTCTCCCAAGTTTTCTGA
TACCTGATTACCTATTTGTTCATTTCTGAAGTATATGACCAATACCTCTGATCTCTAGCAGCCTTGCATTTCTGGGAAAAAAAAAGCTTTTCTTTTTAACATTTCTAAAAATGGATATTA
GTAATTGTCAAAAAATAATTTAATGTCTTAATAGAATATATCCCTTTTTCATATTAATCCACTGTTTATTCATCTCCTGTAAAATTCTAATATTTAGTTCTGTAAGAGAGCTTTTAGGTA
AATTAAATGATAAATCATTTTTACCCTAATTGTACTGCATTTGTTTTCTGATAATGTAACTGAGATAAGTTTTGAGAATGTTTGTTAAAAGTTTACTTCTATAACACTGTATGTGCATGG
TACCATTTTAGAGGGACAATTTTTTTTTGTGAATGATACCTATTTGTACTTTATATTCTGTCATGTCTCTGTCCATTAGGCAAATAATTATATGTTTTCCTTTCTGTTAATGTCCTCAGT
GAAAATAGCTGCACAATTAAATGGAAGTCTGGTTAACACATTTGTCATAGGACATGTAGCCCTGAGGTTGCTGGGGTTTCTCTGTGAAGGGAGGATATAGTTGACTGAGGTTGGTTGAGT
TCCCTGCAGCTGAGGGTTTGCTGGTCAGAATGGAAAAAGCTCTGTAAAGCTGAATCTCAAATAAAGGCTCACTGCAGTGGCTTGGTAAGAACCCCTAAAGGCTTCTCCCTTCCCTGCAGT
ATGGTGGTAAAAGTCTGCAGTACTACAGTCATTATCCCAGTCTAACTCAACTCTGATTTTCACTCTGTGCCTTCTTCTGTCTGCAGAGAGTAAATAAAAGTTCTATGAATGGCTATGGTA
AAACTTTTTTAAAAATTTGATTAATTCAGATTTTTTGAATAAAATTGTTGAAATGCAGAAAGAGATAATTAACTGAGGGCAGTTTTCAAAACTGTCTAAGCCCACTTTTGTTCTCTGGTC
TGACCAGAAGTTTAGTACTCAGAAGTAAGAGGGATTTCCACAATTCCAAGTGGAGTTAAGTGTATTAGGAAAAATAAATAACATTTCAGCTATTCAGTCCTCGACATTTTCTAAGGAGTA
AAAAGGTGTGTTTAAAATTCTCACAGGAAAATAAGATAGGAATTAAATATCAAACAGAGAGGAAAATTAAGGAGAGAAAATTGTAATGACTGTGATCCTCAAATGAATTGATAAATCTGA
GCCAAAACAAATATTTTAATATTCATGATTTTTTTTTTCAAATAGAATAAAAACCAGTTCCACATACAAAATCACTGTTTTCAAATTATTATTAAAGTTTTTGCAGTAATTTCACATTAC
ATTAATTTTTTCTTGTTTTGAATATTTTAAAAACCTCAGAAATTTTTACTTCCGTGTTGCCTGTTCTTGGAAGAACTCTGCTTTTTTATTTACATGCATATCCATGTTAATAAAGCACAC
AGGAATCTCAGTATATTAATGTGTTGGATTCTCAGAAAGTAGTGCATTGGAAAAGTTAATTTAGATTTAAAGGAAGGATACTACTTATTATTCCCCAAAGTTTTCGTTAGTTGAATATCA
AATACCTACAACTTCTTTCCTTGTTAAAACTTATTGTGAAATGTTGCCTAATGTCACATCTGTGTAAAAACTGCCACCACCTCTAGCTGAGCCAGTATTTTTTCCTGTTGCACCAAAAGG
AGTTTGCAATATTTCCCATAAGTTACTGAAAACTGTAATAGAAAATCCAAAACCACTACTAATAAGATGCCTGCTAATAAAGTCATTTGTGGTACAAAGTCTCTTCATCCCTTTTCCATA
GAAACCCATGTCTGATTAACTGAGTTTCAAATCATTTGTCAAATAATTGTGAAAAAGTTCTTAACCAGAAACCTGTGCCTATCCTAACACAAAAAGAGTGACTGACACTGAACTCCCAAA
GTATTTTCATTTGCTGCCTCCATGCAGAAGCCGTAGTCATCAGCTAAACTGTGTGATTTTTCTCCAATATCCCCTCACTAAACCATCCTTACTGCTAAGAGCACGATGAACATGAGCACA
TACACTCATGCTTCCTGATTTATTTTAATTCCATAAAAAAGGTGTAGACAACACGTGTGATCATACTGATACTCTGCATATGTATTCTGTTTATATTATAGAGTATCAATGGGGACCTAA
TGTCCATCTTCTACACAGTGGTAAAACAAATATACAGTGCTGCTTTATGGATGTGATACCAATATTCCAACTTGTGTTTTTTTGTGAATATTCCAAAGGTGACACAGGTAGAGTTACAGA
AATTTCTCACTGTTTGTTCTCCAAGTCCAGTAAAAGACTCACTCTGTCTGAATTTGAATATTTACACCAGTATTCAGATGACCTATTTTAAAGAAAACAAGAGACCAGTGGCATCCCTGG
TGTGTTCTGGTAGAGGCACTTCTAATGCAATTCTGTCCCATTAAGTTTAACTTATTTTGACTTTTGGCAAACCAATCAAGAGAACAAGGGACAAAAATCAGTAAGTAGTGCCATGAGCAC
TGGGAAGCCCAAGTACATCCGGGTGTTTGCCTCAGGGCCTTCAAGGCTCCAGGCTTTTGTCTTTCCTAGTAGTCATTTGGGATGAAATCTCATGGACAGAATGTTTTTATGTTTTTAGTT
TTTTATTTGTATTTTTTTTCTAATATGTAGTTGAAAAACTGTCTTCACGTGTCAACTTAATTCTTCTTTTCCACCTTCATGTAGCTCTTGTTTGTGTACTAATATTACTGATTGTTTCTT
GTTTCAGCTATTTGTACAAGAATGAAATCCAGTCAATTGACAGGCAAGCATTTAAAGGACTTGCCTCTCTAGAACAACTGTAAGTGCCTTTTCTCTTCTGTGCTGTCATCTCCATGGTTC
CCCTGCAGAGGAAAAGTGCACGCCTTGATCCATACATCCTACCTGCATGCTCTGCACGTCTGCACTCCCTGGGGTGGGCAGAGAGCCCCATAATCATTTGCATGTGAAAAAACCACAATT
GATCTCTGTGTCAAATTCCTCATTTCTGTGTTTGTCTTTTATTTGTTATTTGCATTCCTGATATCCCTATACATTGTTACGTAGCTTTGACAAAGGAGAATTATTGTGGAAAATGTTGAA
AACTGATGTGTATTGCTTAGAGATAGATTCTGCTTTCGTTTCTGCTGGTTTTTATAATATCTCAAGTCGTTTCACTGCAGCAGTTACTGTGTTTTATGCAGCATAACTAAAGCAAAATTA
GCCTCTGCAAATTCAATCCTGTTCTGTTATACCTTGAAACAAGAATAGTTTTTTAAATAAAAACCTTGCTATTATTATATGTGTTAATCATTGCCACATACAGATATAGATGTTTAAAAA
GTAAGGAAGTTCATAATTTGCAATGTAGATGTTTCAGTAATGTCCTCCAGAAAGATAGATTGATTAAAATCATACTTTTTTTCCTGTAAAATTAAGAATAATTTCTACTAAAAAAGAATG
AAAAATACAGTCCTAAACATGACAAGACCCAGCTGTGTTGATTCCATTAAGTTCAACTATGTTTTGTTTTATAATCACTATAGGAGAGACATTGAATTGCTGGCGCGAGTCCAGAGAAGG
GCAGTGAAGTGAGCGAAGGGGCTGGAGCATAAATCCTGTGAGAAGTAGCTGAGGGAGCTGGGGTTGTTTAGTATGGGGAAAAGGAGGCTCAGTGGAGACCTCATTTCTCTCTACAACTAC
TTGAAATGAGGTTGTAGTGAGTTGGGGAGTGATCTCTTCTCCCAGGTAACAAGTGACAGGACAAGAAGAAAGGGCCTCAAGTTGCACCAGGAGAGGTTTAGATTGGTGTTAGGAAAAATG
TTTCCATGTGACAGGTGGTAGCACATTGAAACAGGCTGCCCAGGGAAGCAGTGGAGTCACTCTTTCTGGAAGTGTTCAAGAATGACTGGTTATGGCACTTTGAGGTCATGGTTTAGTGAT
GAACATGATAGTGGTGCTAGGTTGGTGGTTAGACTTGAAAATCCTAAATGCCTTTTCTAGCCTTAACCATTCTGTGACTTTTTGATCAGAAAGCATTGCTCTACATTCATTGTGATAATG
TTTAGAAAAAGGAAAAAGCTGTAAATGTGTAGTTTTTTCACTGTTTGACTACCAAACCAGTAGTACCAGTGCAGTAAACCACTCAGTTTTGTAGTGTATAAATTTATATTGTGGGCTGAA
TATAAATTTTTTAACTCCTGAAAGGTATCAGTGTGTTACAAGTGTTCTATATGTACTGGTTTCCTTGCTCTAAGGATATTAGTAGACACAGAATATATATGAAATAAAATGACATTTCAT
ATGGGTACAAAATCATACATGCTCCTTTTAGAGCGCAATAGATGCCTTTTGAAGGAGGGGCTTCTGTGTAAAACAGAAGTGTTAATTATAAAAAGTATATAAATATGTAATTTTTTTTCT
TAATTCCTTTATCTTCCTTCTCCTTTGACTCTAGAAATTATTACTGCACCATATTGACAGCAACTGGTAGGGCTTACTTGCATGCTAATAGCAATACATAATTTTTGTGTAGAATTTGGG
ATACTGAAGTCCATTTATTGAATTACTAATGTTTCCACAATAATGTTCTTCCTCATGCCGCAAGCCTCATATACTGTAAGTGGCAATATTTATCCTTTTTTCTTATGCTCTTTTTTCCTG
TTGACTTATGTTACTACTGAAAGACATAAATCAGTTTGAAATATTAGCATCTTCTGAATGCACTTTTCCACTATGTGCAGTTAAGCCTCTCTGCCTACAGTGACATCAGCTTAAGCTCAA
ACTTTTGAGACATCCACATTATTCAGTATGGAATTGAGATTCAGACTCAAGGCTTGAGTCTCATCTCTAGCTAGGAAGATTGGAAATGGAGCTTGGCAGAGTCACTGTTCATTTTCTGCC
CATGTGTCATGTCAGCTGGGGGATGGGGGGCAGGTGCTTCCCCACTGCCTGCATCAGAGCTCGCTGCTTTATAGATCTCTTCTTCTCTCCTAAACAGAGAGCTTGCCAGGAGGGAAAATG
GGAACACATGAAGGCAGTGGCAAGCACAGAAATAAATTTAACGGAGAGTACACTTTGAGATTTTTAGTTTAGGAGAGATTTGGCATTTATGCATCTTTAGCATAAAATACGTTCTGACTC
TACAGGGTCTGTTTTTCATTAACTTTGGAGAAAAACTGCTGATAAGACAAGACTTGCTCTTGACAAAGAAGTTCCTAAGTGTCCTAATTTCAGTTTTGAACTGTATTGACAGCCAATGCA
TCTGCATTTGAAGTCTCTCTGGACACAAGTTATTGAACACATTTTGCTACTGGTTGTGTTAACTCAGCCAAGTGCTGTTCTCAGTGCTCAGCAGAGTTCTCAGAAGTAGACACTGTGGAC
CATATTTCAGGGAATGACTTGTTTCACAGCAATTTCTTCTATTCCAGTGAAGCAGAATTCAACTCATAGTTCCTTTTTAAAAAATACCCGAACAGCAAAGCAAACACATTTTTGGTGATT
GTTGTTACCAGAAACTAAATGTAGTTAAATGTAACTAAATTACACTAACTAAAACTTAAATTTACTGTTGCAGGTATAAGGGACAAAATCCCCCCAAGTATTTACTGCAGCTGGCAGGTT
CCTCCTTAAACCTCTGAAGCAGAATTCTTAGCTGCTGATGTCGTCAAAATAGCTTTTCCTTTGGAAATTTCTGCCAAGGGAATAAGATCTTTGAATCATATCTTGAAGCCTGTTTGCTAG
GGTGAATTCTGAAGAAAAATTGGTAGTTTTAGGTACTTGAGCACACTGAGCCACACATATTTCATCACCTAACTTTTCACCTGTGGCTGGGCATGAAGGGAGAAAGTCAGTTGATGAAAA
GTAGCTGCTTAGTACCAGTTTAGATGCTGTTAAATCTGCAAGACATATGTTTGGGTCTGGCACAGACAGCAGAAAGCTGCAGGAAACTTGCATTTTTTCAGAGCGGCAGCCGGAAGGCAG
CCAGAACACCCGAAAGGCAAGGAGGGCTGTGTGTGCCTGGGCTCAGAGAGCTGCTCTGTGCCTCTGTGCCTGCGCCTGACACCTGAATCCCACCTGAAATGTCACAAATACCCTGCTTGA
CAGGTCCTGAGTTTGGATCCCAAGCTCTAGCTCTAAATGGAGTCCATTTCCAGATGTGTATATGTTGCTTTCCTTCCAAATAATATCTGTCATATTTTTGAGATCTCAGCTTATGAATTG
TATGTATCAGGGGCACTATTTAACTAGCGGCATCCCCAAATATTAATGGAATTATTTAAATCTCTTTACCTAATCCTAGTTATGCATTTTCTTTTAACTTTTGTATTAACATACTAATTT
TGTTCTTTATAAGCAGTTATTAGTTATGATGTAGTTTATGTATACATGTACATATTTAGAGGGAATTAATAGATAAAAACCTTAACTAAGATATAGTGATACAATTTGTTATATTAAGTT
TATTTACCTCAATTCAGTTTTCAGTATTTTTGAAGTGTTGCTATTTATTTTCTTGTTTTATACTACAAGTTCCTGATTTTTGCATGAGTCTGTGTCAGATAATTAATTAATAAACAAACA
AGGGAACCCAAAAGGTATGACAGGGGCCTTGAGAAATTTATCCTTATTATTCTGCAATAAGATCAGCTAGGGACAACAAAATGGAAACAGATACTTGCCTTATTTTAAAAGCCTTCAGTG
AGGATTCCATAATCTCCTTAAATATCCTGTTCTGATATTTCATATCATTGTCACAACATACATTAAAATATTTTTCCTTGTAGTTTAAGGTTGCTACTTGTAGTCCCTGAGCAGGGAAAG
CTCTTTGATAAATATGGAACATATATGTTCATTCATTCTTATTCAAATAATCAAAAGGGCAAACATACTATTCAAATATTTGGAACACAGATTACTCAGCTAATGGGTGAGTACTTCCTC
AAAGATGTGATGATACTATTAGAAAAAGAATATATATATATAATAAAAGTCCTCACCTACAAAAACTACTAGGTTACATAAGATGTAATCCTATCTTTAGTGCTGTGAAAAATGCCACTG
GGACTAAATTTTACTGTAAATTTTTGCCCTATAAGATTAATAGTAAGAAAGACAATCTATACTATGCTTAGTTGATAAAATCTTGATATTCCTCTTGAGGTGTTTCCTTTGGACTATTTT
TTCACTATAAGTATTTCCTTTCCTTCCGTTTAATTCTTGATAGCGAGTTTAGAATTAAAAACTAAAGACATGTAGGTCTTTAAAAATCACTCTTGCATGCTTTGTCTTTCAATTTTCATT
CTGAAAGTCTTTTTAATATCTAATTTATTAGATGATACTACTATTTTTAGTGCTTTGTACTCTGAATATAAAAGATGCCTATAAAGATATGCCAGTGTGAGATTATTTCCTGAATATGGC
TACCTTTAAAATGAATTTTAAATCCAGGAAATTACCATATTAATTAAAATATTAAAATATACCTTTACAAAACTTTAATGTGGTACATAGAAGAAAATAATAGAAGTGATAAACCTAAGT
TATAAAATAGGATTAATGTGTAGGCCATAATGCCAAGGATTTTTTATTCTCTTTATTGTAGACTTAAAATGCAATCTGGTTTCTGCATCTATTTATTTTGAATTACAGATTATTTTAGCC
AGATATTTAGCACCTTGTTCTATTAATAAATTGCATGATAAGTTGCTCAGGACTATTTTAGGTCATAAAGACCTGCAAAACTCAACTAACTTGTGCAGCCCAACTACTGTGAAGGAGTTA
AGAGTATTTTCCAGCTGGACTTCATTATTTGATTTTTTTTAGCTGCTTTAGACAGTGTGATATCTGATGAGGTAAAGTTAGCTGTTAAAATGTTCTTCAGCACCTGAATTATTGTATCTG
CAATGGTATGAGCTTGTAAACAAGGCAAGGTTTATAACAATTATTTTTTTTTATTTGTTTGGAAAACCAAGGTAACTTTTCAGGCATATATTGATTGCATCTGTAATTCTAATAGTCCTG
AGTAGTAAACAACCATTATGGGCTGCTGCTTTGAGTTTTGAAATGTATATACTACTTAAACTATCTGAGAGAGGTGTTCTTTCTTTTTCTCTCATTCTAATTTCACCCCAATTTGTGGCA
CTGAAGAATGGGTTGTGCGCCAAAATGTGTCTGCTTTTACTGATGATATTTTTTGTTCCAATAAGAAGTGCCTACAAATCTTGCCTTGTCAATGCCAAAGTACAAGAGATTAATTTATTT
GGGATATAAAGAGATGTGTTTGCAAGGTGCTCATGAGGCATACAAATGCAAGAAGCATTAAGAAAGTTAAAAAGGAAAAAATCACTGCTGCCTGCAAAAGAAGTAGTGTTTGTAATTTTT
TTCCAAAATGAAGCTGCTTCAGAGATAACAAACCCTCTAGTTGTGCTTGGTTTTCCCCTTTGTCCTTCTACATTGATCCCCACCTTGCCTTGCCCATATGCTGCTGATCCTTGAAGGTAG
GTGAGCAGAGTCCTGGCTCCTGGCAAGCAGTGCCTGCCCACCTCATGGCTGGACCTTGCCCAGTCCTTGTCCTGCCAGTCCTTCCTCACTGTGGTCTCTCTTCTGTCTGCTGGCAAATTG
AATGAACCTTGCAGGAAATATCTGCCTTTGAGATCTGTCTTTTTAATTTAGAAGAAATCGCCCTGTATTTTTAAAGGGGAGCTGAAAACTGGCAGTCCCAGCAAGGTGATGCAGTTCTTG
GTTCTTCATGCTAACAAGACCATACTCTGTGCTCAAGATCCTCTGTGGCCACGCGTTGCACTGGCAGTAGGCAGGCTTGACACTCTGATGTGCTTGATCACTCCTGTGCTGATTTATTGG
CTTTTTCTGTGGTCCCCATTCACGGCTCCCTGGCATCGCTCACTGGCTTGGCTTGTCCTGGGAGGCTGCCAGGCACGTGCCCGGCTTCCCCCTGCACGCGCCTTCCTGCAAGGCCTTGGC
CGGCATCGCCGCTTCTCCCGCTTTTCTCTCTGCGCAGCCACCGTCTGGCTCAGCACGGGTGAATCCTCATGTCCTTGTCCTTGTCATGCTGAGGAATTGATGTTTCAGGAGATACTGAGC
TTGGAGTTGTTCTCACTGTTTTTAAATGACAGGCTTTTCTGTTCTTCAGACTACAGTGCTTACTGTATATACAAATTCTCCAGAGGTTCCTGAGTTTGTCAGAAGTCAAATAGGAAACTT
AAAAGAGTTTTGAACACATTTGGATATAATCAAGATCCAAAGTCTATAAATCATTTTCTCAGTTTCTTGTGCCAGTCTTATCTATTACATCTTGTTTTCTCATCTGTAAGGTTCAGGGGT
ATCTCCACAAAATAGTAGATGCTGCAATGATCCTGCCTTTGCAGTCCATTTTCACAGCAGTTACAGGTTAATAGTCTAGTTAATTGTCTTGTTATGTTAACTTTCTCAATTTTACTGCAT
TAACAGCTGTAGATTTATTGTTGTGTAATGTTAATAGCTTGCATAAGCATCAAGAGAGCATCAAACAGCACCAATTGCTAGGAAGCCATTTATCTAAAGTCAAATTAGTCAAACTTGGGT
TTATATGACAAATTTGGTTTTGAGAATGTTCACAGCTTTAATTGCCAGTGTTCATGGACTAGAGAAGATGATTTCTCAGCATCTTTTGAAATTTTCGCTCATGGAAGTGAAAGCATTTGG
CCACGAAAAATGTTATTGTGCTGGAAACTGTAAATGTTTTCTAAATAGCCAACAACATTTTTCCTATAAAAATAATTTTTTTGGATAAATTGTTTCAAGCATGCATACAGTAAGCACCAG
ACTTGGCAAAATAGTGTTCAAAGTATTATCTCTAAAATCTCCAAAGCACTGTTTAGGGTTTTTTGCTAATGTATGTACACACACACACTCCATATAATGATTGGCAAACACATCTTTGTT
TGTCATGTCTTTGATTTCTCAGATTCAAGTATGAGATTCATATGGTAACAGAAAAAACTGCTATATCAGTATGGCCATTTAGATCTGTAAACAGTATGGAAACAATAAATTATTTTAAAT
ACTTCACCAATTAAGAAAATTGTTTCAGTATTTTTCTTTTTGTTTCACATATTTTCAGGTATCTGCACTTTAATCAAATAGAAACATTGGAACCTGAATCCTTTACTCATCTTCCAAAAC
TTGAAAGGCT
GTAAGTTTGTTTTTCTTGGGGTAAGATTCAGAAGACAGCTTGCTTCCTTGTTTGAATGAAATCAAGCATTTGAAACTAAAAAATAATATTTTTATCATTGCCATAGATTG
TTTTTAAGCCAATTTTTTTTCTGTAACTACTACATTGTCTTTCCAAGAACACATTGGTGAGATTGACCTTTGAGGCATGCAGAAGTGAGCATTGCCTGTGGTTTATTTTTCTTTTGCAAA
ACTACTTCCCAAAGATCTGTGATCAACGTTTGGCCTAAAATAAATGTTGTGAATGAAGAACTAGACTATTTATTTAAGACCTTTTTTAAAAATTTCTGATTTGAATGCTTATGAGCTCCC
TTCCTTGTAATTACTTGTGGCTTCTTTTTGCCCACATGGACATGTCCAAGTACACCTTGGAGGCTCCTTAAAAAATAGCAGTCAATGAGTTGATGAACTGGTTCAATTATTTTTCTTAAA
TTTTTTTAGATTACTTTCACTTGAAAACCTTCCAGAAGGATGTAAATTAAATGAATGCATCACAAAATCTGAATTATTACATGAATATTTCTGTGTTTTTAACAGGTTTTTGCATAACAA
CAGAATAGCTCATTTGATTCCTGGAACATTTAGTCACTTAGAATCTATGAAGAGACT
GTAAGTAAATTGAATTATTATTGAGCGAATGAAATATTAAATCAATTAGACTATCTTCTCTTG
CAGTATTTATCTTCCTTGCAAATGCCTTTTACAGTATTTAAATATTAATTTTTATTTAAAATATTAAATATTAATTAATTTTTAATTTTTTTTCTTAACTGTGCTTCAGTTGTTTGTGTG
CATAGATTGAGACTATTGTTCTATATCTATTTTCTTTAGTTACTGAAAGTCTTGAGTTTATTTCCTGTATTGGGATTATTTGTAATCATTGTTTTATAGATTAAATAGTATATCTAGATT
GTTCTTTGGGCAGTAAAAATAACTTACATTCTTCTAATACAAACTACCAGAATGCCTATAAGCATGTAACCACCACCTGTATTGCATGTTGGCTGTTGTCTGTATTCACAGATAAAGGCA
TTGCTCCATTTACAGAACCATGTTGACCCTAGCAAAATGGCTGGGGCTTGCTAACAGAGCTCTGGCTGCTCCTTGTTTTGTGCAGGCGTTTGGACTCGAACGCTCTCCACTGCGACTGTG
AGATCCTGTGGCTGGCGGAGCTGCTGAAGACGTACGCGGAGTCGGGTAACGCTCAGGCAGCAGCCACCTGTGAGTATCCGCGGAGGATCCAGGGAAGATCGGTGGCCACAATAACACCAG
AAGAATTGAACTGTG
GTGGGTTTGCCACTTCCTTATGGCTTATTTTTAATGGGTTGCATGTACCTAAACTGTGTTTTTGGGGGGAGTTAGAATTTGTTGTTCTGTTTGTTAACACTGACC
ACCTCTGGTTAATATTGGTTATTTCCAGAAATCTCTTTGTGTTCCTCTTCTGGTTTTGTGTCCTGACAGGATTGATTGCTTTTACCCTTCAGCCTATCTTTAATGAAACAAATATAACCA
TGTTTTAAATTTCTCCTTGAAGAAGAGAAGGTGATTATCCTGAAGGAGTTTATTTTTCCCTTTTGTATTTCAGTTCTGACCATAACAGGGTCTATGGTGTTGCATTAACATTATTGTCCT
TTATTCCCTTCTGTATGAGGGAAAGGAAGGAAAGAGGCTTTACTGAATTGCCCCTGATGACACAGTTCTGGCCTTTAAAATTTTTGTAGATGTAGGAATTGGGGTTGGGCCACTGAATTT
TTTTTTTTACTCACCTATAGGTGAGTATAGGAGTGCCCCACACAGGCACTGTAATCCTTTGCCACTGAGGATTAATGGACCATAGCTTGGCCCCATGGGCACTGTGTGACTTGGCCCAGT
ACCTCTTGTGCTCTGAAATCAAAATGCAGATTTCTCATCAAGCTATGGGCATTTGCCTGCCCACTCACATAATGAAGCCAAGGTATAAAATAAGTAAATTGTCCTTTTGGATATGTGGTG
GATGTAATTCTGATCAAGAGAATTATGACCATAAGCATCTACAAGGTTCTTGAAAAAGATAGTACAAGGGGAATTTGGTGCAAGTATAATGCACATGGCATGCTACCAGCTCCTTGCACA
TCTAAGGAGCCTGGATAAGGAAACTGCAGGAAGCAGGCTGTACAAATTATTCTGTGAGGTAGGTTAGGCACTGATACTTATCTAGAGGAAGTTGTTTTAAATGGCACTTGTGCTTGCTGC
TTTAAAGTTTTTCCTTCATAGGCAATTTGAATCTCTGTTCAAATAAATAAAACAGCTGCTTTAGAACCTGATACAAATTTGCACAATCTATTTCCAGTCTGCTGAAAGATCCTAAGGAGC
AATGAAGAAGGTCAGAAATCCCACAGTCACTTTTGCACAGGGAAAAGTGCATTTAATCCTGACTAAGCATATACATAATTTAAGTCAAAACATTTGTGAAAAATATTTTTACAAGATGTG
TGGAAATGTTTTTATTTACCAGTTTTTAGTAGTTTTAAAATAAGTAAGAGTTCCTTGTATGTTTTATTGTTGATATAGAGAGGCCAAGAATTACATCAGAGCCTCAGGATGTGGATGTTA
CCTCAGGGAATACAGTGTACTTCACTTGCAGGGCTGAAGGCAATCCTAAACCAGAAATTATCTGGCTTCGAAACAA
GTAAGTTTGAAAGAGGAAGAGAGAAACTTGATGCAATTACATTT
GTCTGTGTGTGTACATTTCTGGGTGCATGTCCATGTGCTGTATATGGTACTATATGAAATAGTTACAGCAAAAACATGCTATAATTAAAATAAGCATATGAAGTAATGATGGCCCATAGC
TCTTTTATTAATAATTTAAAATATTTAAGAGGTTGTAACTAGAAAGTATTGTTACTCTACTACTATTTGTAAGATGTTCAGCTGTAGTATACCTGCAAAGCTGCTCACAGCTGTAATACT
AAATCATTTATATATAAGTACCAGTATATGTGGACATGTATATACAGTCCGTGAATTACTTAGCATTTGCATATGTCTTGGGGTGGAGCAAAAGATACTTTTTTTTAAGTACTCCAGCTG
GATACAATTAAAGTTTCAGAGAACTCTTTCTGGAGCCCCAGCTTGTCAGAGGTACCTTCCCTCCAAAGTTGAGCTCTGTCCCAGGAGAGGAGAGAGACATCTGTTTCCAGCCTCCTCAGA
CCAGTACATGCAGGGCAGGCAAGTCTTTATATCACAAGACTGTAGTGTAATTCACGTTGGAGGAGGTCTCCAAGGTTGGAGTAGGTCTCCATTGCAGCCTTCTGCTCAAAGGTATTATAG
CAGGTTGCTTTATCCAGATGGGTCTTAAAAGCCTCTAGGGGTGGAGATAGCACAAGTTGTCTGACCAACCTACTGCATTTCTTTCCCTTACCACTTAGAAGATTGGGAAGGTTTTGTAAA
GGATGACTATCTTTAAACAGCCCAAGGGCCAGCCTGCTGCAGAGTGGCTGCTCAGGCTGTGCCCAGAATTCGGCTCCCTCCAGCTGCACTGGGCACGGCACAACACAGCTGAAGCAGCCT
TGTGCCAGTGCATCACCCCCTTAAACTGAGGTGAACCTACAATGGACACATGAATTGTGAATTTACTATCAGCAAATCGGACTTTGGCTTAATAACGCTCTTATACAATCCTGACCTGGA
ACATAAATTCCCTTACAGTTTCTATAAAGCAATTTAGTTTGTCAGTTGCTGATGAAATGGCATGATTTAGAGTCCTGCTTCTATATCTTTCTGCTGATGTCAGTGAGAACCCCCTGTGCA
GCAAAGGTACAGCATTTATGGAGTATGTCAAGAACAGAGCCTTGAACTCGAATGGGATAATTATTTTTTCAAAATTTTCTCTGGCTCAAGTATTTATAATACACAAAGAAAACATGTTCA
GAATACACATATGAGTTTTAAGAAGAAACTTGAGCTTGGGGTGAGGGATTATTGACTCTGGCTCATTTCCTGGCTGCAGGAATGGGAGCGAAACTGTTTGCAAGGCAGTTGAATATGCCA
GGATTTCAGTCAAAAGCCATCACCCTGTTGAGCAGTATGTTGAATAGATTAGTAGGCTGTGTTTTGTACATAAGATGTGTGGTGTCAGCCCTCCTCTGTGCTTTCTTCATCGTGTAGTAA
AGGGTGGACTGAGAAACAGTTCCTTTAATAAAACCCCTTAAGGCTTAGGTTACATCACAGAAACTCATTCATGACCTTACCTTAAGACCTGACCTTAATTTACATTTTAAACCAGTACAA
AATACAATCAGCTTAATTAGTGCTCCTTGAACTGTCCAGGCAGAGGTTGGCACAAAGATGGTTTTAAAACAGCTAACCTCTCTCCTAGTAGACGGTATCTTGAATATTGAACTTGTATGG
CATACTTCCAGTGGAAACAGTTTTAATTGTTTTGCCAACTAGAACAGCCTTTTAAAGACCAGGTATGTGTATTTGTTGACTGTAATTTTTCCCTGTAAGCTTTTCCTCATAAAATTATTT
TAACTTTTCATTTTGAAGATGCATTACTTGCATTAGCAAAATAGTTTCATGATTTGTTTTTCCTCTTCTTCTCTTTAGGAGAAAATGTAAAGTTCCATTATTTTTAACAAAGTAAAACTT
CTTTTATCCCACAAGTTATTATGGGTAATTTATCTCCTGGGTTTTATTATTTGGCAGTTTTCTGCGCTTGTGATTTAAAGATTTAACTCTAGCAGATCCTTTTCTTCTCAGTAATGAGCT
CAGCATGAAAGAAGATTCCCGTCTAAACTTGCTAGATGATGGCACACTGATGATCCAGAATACTCAAGAAACAGACCAAGGCATTTACCAATGCATGGCAAAAAATGTGGCTGGAGAAGT
GAAAACTCAGGAAGTTACTCTTAGATACTTTGAGTCACCAG
GTAAAGAACATTAAGTCTGAATTTTGCATTCAGATGGAGAGTTATCTTAATAATAAGATTGTTAAAAAATAATATGCTT
TGGTGCTTGATATGTGGATTTGTTGGGCTTGGACATCTTAAGACCTAGATTATGAAGCTATAATATCCCTAGAACAAAATAATATAATATCCCTAGAACAAAAATATAACTCAGACAGTT
AATTAATATGTTTATTGTAGTATGCAATTTTTATAATAGTCTCATAGGCTGTAGAAGGGTTAGGAAAAGAGGCTTTGCATTGCAACATTTCTCAGTGCAATATCTCTCTGGATACTGAAA
ACCACAAGCTGCTGAAGAGGCCACTTATGGAAGTTTCGGCACATCCTGTGCAGCCATCCTTGCTCAAGAACCTTTTAGCTCTGTCTAGCCAAGGCCTCATGTTTGTAAGGACTAAATTCC
TGTCCTGGACTGTAATGTTTTTAAAACACAGTCTTTGCTGTGAGAACATTTTATTTTGACACACAGCATCAGGTAAACTTAAAATGTCACTGCATATTACTCATGTACTTGAGAAAAGTT
ACTTAAAATGTAGCTTAATTAGTTTTGGCTTTTGTGCACTTACAGCAATTTTTAGTCTGTTTGTGTTTTGGGTCTCAATGTCCATGCCTCTGAAGAGATCTTTCTAAAGATCAGCACAGG
AGAGCAAAATGTTTGGAAATAGTTTTAATGGGAGTTGAGAAAAGGAACTTTAGAGCAATTAAGAGTTTTTGTTTTTATCTATTGATGTCTGCAGTTAGATTAGACTTATAGCAAGGCAGA
GTTTGCACCAAGATTAGAGGTATGTTGGAACACAGCTATTAAACCCCCCCAGGTGTCCCCAGTTTTAGACTATATTTGTCTAAATCAGAACTGTGCAAGCTAAAAGCTGCATTTAGGCAT
TGCTGTTTTCTCACAGCCAGGCCAAGTTTTGTGATTCACCCACAAAATACCGAAGTGCTGGTTGGAGAGAGTGTTACCTTGGAGTGCAGCGCAACCGGGCACCCTCAGCCACGAATTACC
TGGACCAAAGGCGACAGAACCCCTCTACCAAATGACCCTCGTGTCACAATAACTCCATCAGGAGGACTTTACATACAAAATGTGAAGCAGGAGGACAGTGGCGAGTACACCTGTTTTGCA
TCTAACACCATAGATAACATCCATGCGACTGCATACATCATAGTCCAAG
GTAAAAAATGTTAAACTGGGAGAGACGTATTACTTGAAATTGTGTGGATTTTTCTTTTCTTCTGAGTTGAC
AGAGCCAAACTAAAAACGTAAGAGTTTTTACTTCTAATTTCACTATTGTAGTCCATAGGGAAGTTGCTATACTTCACACAGAGTAAGGTATTATATACTATTTCCCTGAAAATTGCATTT
AATTGATTATTATCAGAAGTTTAATGTTTTAAAATGTTAACTTCTTATGTTTTGTTGGCATGGAGGAACAAACAAGCAGTGTCAAATTTTTGAATGATTAAATATTTTCTGTAACGGGCA
GCAATGGTAGAGATTAGAATTTGTGCCTTGAGAACTCGAAATGAAGTTTTGAATACAGATCTGTGCCACTTTTCTTTTGTAGACACTTCAGTGAATGTGGAAACATTTTCTGCTGGGTTT
TATAGAAACTATCATACTGCCAACTGAGGCATTAGACAGCTTTTCTACAAAGCAAAAGTCAAAGTACTCTAACTTGTGATTGCAAAAATTTTGATATTGTATGTCAATAGTGTGATTATA
AAATATTTGAGATCAACTATCAGAAGTCTCCTGTGTATATAGATAATATTCTTTGCAAACATTTTCACGCTGGAACTTCTATTTCCACAATACTTTACATAACCTTTAAATTTAGTTGCT
TCTGTTCCCATATTAAAGTCTTTATCTGGCAAACAGTTAAGATTGCAAATGCCTTTTCAATGAGTTCTAAAGCTATACCAAACAACTTGTCTGTGTGGTGTTCATTTATTACCAGTGGAT
AATTTTGTTTTGAGAGCTGAACAAATACTTCTAACATAGTGAGTAGTTAATTAGTGCATAGTGCTACTGCAGAATCTGGCCCACGCTCCACTCATTGCTTTCATGGAAGAAAACAGGCAG
CTCAAGAAGGTTTTTATTACATAACTTCCTCTTCACAATTTAACTGGGAAGTTCTGAGAGAAAGAGAAGAAAATATTTTCAATCCAGGGAAGACTCTTTGTTTGATTCTACAAGTGTTAC
TATACCTCTTATTTTGGATCTGTCACAGAAGATCCCACATGCCTTCACGGACATCAGGGCCAGGTTGTGAGAGAGATGTTCCTTTTGCATAAGTGGTTGCCCTAGCTCTCTTCTCTTTAG
GGGTAACAATATAAAAGAATTCCATTAGCATCTCTTTTCCCACCAATACGAGCTATTTCAACTTACACAGGAAATACTATATAATTTAGTCATGCATATTTCAGTTGTTTTTTTGAAATG
GCTTTCTCTCTTCTGTAGCTCTACCTCAGTTTACTGTCACTCCACAAGACAAAACAGTGATTGAGGGACAAACTGTTGACTTCCCTTGTGAAGCACAAGGTTATCCCCAGCCTGTTATTG
CCTGGACTAAAGGAG
GTAAGTGTGTTCCATTCTTACTTTTAAACTACCAGGATAGTTTATCAGTCATATTGGAATCACTTCTTTACTGAAAGGAACTGCATGGATTTATTTAGTTGTTTC
AGTCTCTGAAGGAAACAGAGTTAAGTAAAAAAAGAGTCACTAAAATATGTATCCATAATAGATTCATATTAATAAATGTTCAAGAAATATGAGGCAAATTACATGGAGCAGTATGCATCA
CTGTTGTTGTACTGCAGAAGAAATGCAGATGGCTGTCATTAGCTGGAGGTCTGAAATTAGGTGGGATGTGCTCTCTTCAGAAACCAGAACAGTACAGCCTGTAAGTGTACCAGCATCTCT
GTCACTTACTGCACATTGACAGAAACAACGGGGTGCATTCTGCTGACTATTCTATCAAGTTATAGCTCTAAAGGCGTTAAGCCAAATACAGAAGGAAGAAATATTGTAGTGGATGTTTTA
TCAGTAAATAAAAATTCTGTTTGATTTGAGTGAAAAAACTCTAGTGGGCTAAATAACTCTTAGGAAATTCTAAATTATGCTACATAAAGCAGATTCTTAACAAATTGTTCATCATTTTGA
TGCTGATAATGTCCCTGTTTCTCCCTCTACTTAGATTGCTCCAATCAAATGAAATAGCTAGAAAGGGTGGATAGGGTACAGACACTGATATAAATTGATTTTTCTTATATTACGTTTTTT
TTCAGGGCCATGTCTAATGGCAATAATACGACATGAGCAGTAACACATGTTGGTGTTTTTATACCTTCTCATTTGGATGCTTTAGCATGCTCCTTAAATGAAAATATTTATTTCTACCAC
AAACAGGGAAGTGATAAGGATTATGATTGTGTGCATATGTATAATGTGTTTGCTTTTCATGTTTATCTTCTTAGAAGTAAAGGTTTGAAACTTTTTTCTTTTTTTTCTTTTTTTTTCTTT
TTTTTTTGTTTGTTTTTTTTTAAGAAGCATTAATAATTTCCAGTGTTCTATAAAACTTAAAACCTGGGCTTCCGTTTTTCTGACACCAAGGGGCTTTGTTGCTATAAAGAGCAAATGATG
TTGTTGTGTGTTTCAGGAGGCCAGCTGTCTGTTGACAGAAGACACTTAGTTCTGTCCTCCGGAACGCTGAGGATTTCCAGGGTTGCTCTGCATGACCAGGGACAGTATGAATGCCAAGCT
GTCAACATCATTGGATCCCAGCGGATCGTTGTGTACCTGACTGTGCAGCCTAGAG
GTACAGCCCAGGGACAGCTGCTGGGAAGGAAAAAAAAGAAAAAAGAGAACAATTTAAGCTTACAC
TAAAATACACAGTACTGTGTGTGATTGTTTCTGAGTATATCTCCTTTTAGATCCCAGGTGATTTCCAACAAACAAGTCTGGAAACTTGCCAGTATTTGTGCAGGGTATCACTCCATTAGA
ACAGTCTGTCTTCTGGGAAAGAGGTTTATCTGATTTACTTTTTTTTTTTTTGTAAGAAGTGGAGGTGTGCTTTGAGGACGACAGTATTCCTATGCATTAGAAAATTTCCTATTTTGTGAA
AAGTCTAGTTTCTAAATAAGGCTCTATGATGTTAGTTAAGTGGTATTATTAACACATTTATAATGTTTGCTGCCCAGAAACAGAACACTTTATTTTACAGAAGCAGAACGAACTTCATAA
AGAAAAGTCATTTCTTGTGCTGAAAATAAACTGACACAAAATAAAGTCCTAAAACACTAACCCCAAAATCCATTTTTATGCTTTTTTTTCAATTAAATTCTAAGTAAGTTACTTCCAGGA
TAAATTATAATCATATTACCATTCATACTTTATTTAGGTACTTTTATGGTTAACTGAATTCAAGTAGATAAAACATGTAATTCAAAGCATTTCTTTTTAGTGACCTAATTTAAAATTAAT
GTATATTAGTAAAAGGGGCTCAAATGAGCTTAGATGTTTGTCAGAAAAAAAATTCTATTGATTTTTCTTAGTTTAAGATTGTCAAAATGGAGATGATTTTTTTAACCTATATAAGATGTT
TGTTAAAATTATATAAAACAAGTATCAGTTTAAAAGTTTCATAGCTTTCCAGCTGTGTTAAATTCCACTAGACTTGAGTAAAGTTTAATAAAACAATTTTTGTGCAACTCAGGTTGCTAA
ATTCAGTCACCAAAAGATAGTAAATTCAAGATTGAAGGCTGAATATGTGGCATGAAATTGGAGCTCTCCACAGATTATTTGCAATGCTGTTTTCAATTGTGCAAGAAGAGAAATTTTCTT
TTGGGCTTCTAACAAAAGGACAGTTCACCTGAGGAATGTTTAGTCATTGGTCACTGTGGTTCAATCAGTGTTAATAAACACAGATTAATGCTCCAGGTCTGTTTGCTGGCATGACTCAGC
TCACATCCACAGAGCCAGACTCTCTTACCTCCCAGTCCTGGACACCTGCCTCTGGATGCCTTATTTGAACTGATTTCTGGTCCTTTACAGGCATTTGTGTACAGTTTAACAGTAGGGCCA
GATTTGGTTGGTAGTATAAATGACTGCAGTGGAGCCAAATACTTTTCTGTAAAAGCACAGCCCTCCGCCCTCTCCCACTCCCCCCTAAATATCAGTATCATGACATCAGTATAGCAGTAC
ATGTTACAGCAGAAATAGAATTCTTAATGTCTTCATAATCTTATATGTGCTTCTTATGATGATATCTGAGTGCCAGGCATCAGTTTGGATTTGAAGACAAATAGAGTTTAAAAACACATT
AAGTTTATTCACAGTGGATTTAGGTAACAGTGTATTCTGGCCTTAGAATTTAAGGTGATTTTTTCATGTTTTAAGGGCTGAGGCTTATAGGTTTCATGGAGGTAGGAGCTCTGTCAAGAC
TCAGCGCCTCAGCAAGTCAAGCTGAGAGACTCATTTGAATGAGTTGTGGAAGGTTTTGCTTTTGTCTTCTGCGAAATTGCAGTCATTGCTACTTAAAAGAATTAAAACAACAACAACAAA
AAAAAGATGACCAATTAATGCAATATTCATTTTGATGACTTTGTACAGGTTTAGCTATTAAAAGAAATATTTTTCAGAGCCCTTAATGCATGGAACTTAAGTGGTTTTGACAACTACTAG
CCTATTATGTTAGAAGTTAGTTAAAAGTTTAGGATGATTTTAAAGTACTTTAAAATCATCCTGAAGCAGACATCAGAAATAAGGTCATAGAATCATTAAGGTTGGAAAAGACCTTTCATC
AAGTCCAACTGCCAGTGTAGCACTACCACCATGTTCACCATTAAACCGTGTCCTTAAGTGCTATATCCACACATTTTTGAACACTTCCAGGGATAGTGGCTGTACAATTTCCCTGGACAG
TCTGTTCCAGTGCTTGACAGCCCTTTCTATGCAAAACTATTTTCCCTTTATCTAATCTAACTTCCTCTGGTGCAACTTAGGTGCATTTCATCTTGTCCTGTCACTTGTTACCAGCCCTTC
TCTGGACATGCTCCAGCACTACAATGTCATTTATGTAGTGAGGGGCCACAGCTGGACACAGGACTCAAGGTGTGGCTTCACCAGTGCTGAGTACAGGGGGAAGATCCCTGCCCTGCTCCT
GCTGCCACACTTGCTGATCTGGGCCAGGATGCCATTGGCCTTTCTGGCCACCTGGGCACAGCTGGCTCATGTTCAGCTGCTGTCAACCATCACCCTCAGGTTCTTTTCCATGGGGCAGCT
TTCCAGCCACTCTGCCATCAGCCTGCAGCACTGCAGGGGGTTGTTGTGCTCCAAGGGCAGCACCTGGCTCTTGGCCTTGTTGTACCTCATACAATTGGCCTCAGCCCATTTATTCAGCCT
GTCCAGCTCCCTCTGTAGAGTCTTTCTACTCTCCAGCAGATCAACACTCCCAACTTGGTGTTGTCTATGACGTTGCTTAGGGTGCACTTGATCCCCTCAGTCAGGTTGTCAATGAAAATA
TTAAACAAGTCCGGCCCTATTACTGAGCCCTGGGGAACACCACTTGTTACTGGCCACCAATTGGATGTAACTTCATTCACTGCTGTCTCTGGGCCTGATAATGCAGCCAGCTTTTTATCC
ACAGAATATACATCCATGCCATGGGAAGCTAGTTTCTTAGAGGAGAATTTAATCCCTAAGATTAAGTTATAAGCATCTAAAAGCCTGAAGATAGAATCATGTAACAGATCAAGAAGTGTT
CAGCAACTGATAAAACCAGAGTGCTGACCTATGTTTTGATCATCTTTTGCACAAGTTGTGTTTCATATTTCATACAGTGTATCATTTGGCTTTTTTAGTGACTCCTGTATTTGCCAGTGT
TCCCAGTGATATGACAGTGGAGGTTGGCACAAACGTGCAGATCCCATGCAATGCTCAAGGAGAGCCGGAGCCAGTCATTACATGGAATAAG
GTATTACATATTCAGTTATTGCAGAAAGG
CAGTGGCCTTACCATCTCTTCATAATTAATTATTGAAAGTGCAGATTTCCAAATTATTGCTTCCTATGGTGTCTAAAAACATTATCTGAAGTACAATCGGTAAGTATTTAATACAGAGCG
TGTATTATATAGATACAAAACCTGAATTTTATAGAGATAAATATACATATGTATTTATGCAAATTATTATGCAGCCCAGCTACAGTTCATAATGTATGCCTTAAAAGGTCTGTACTTAGT
AACAGTTTGGTGTGAATAGCCTCATACTTTCAATGATATTATAGATATAAAACAATAAGAAATGCTGTACTGGAGCCATTTGCTACTGCTAGGTTGAGACCAACCAGGACAGGCTTTGGT
AACTTTCTGGTAACCTCTTTGTGGCTTTGATTTTCATTGATGTAATAATTGCTTTATCAAACTATGGAGTGTTAGCAGAGTTACCAGGGAATTAAAGAATTGCTAATATTGATAGTCAAT
TTTTCTGATTATATTCTTCTTTTCAAGTAGTGAATATTAGAAATTTACTCTAATTAACCTTAAATAGCTTCTAAATGTACTGCATTCTAAATGTACATGAAGAACTGATATACGTAAAAC
TCTTGAGAAAAATAAAATATTTGTGTTCTCAAGTGGTATTTTTTGGTCATAGATCTTATGTGGTGAAAGCCTATTAAAATACTTTTATTTGTAATAAAGAGTAATTTTAGAAGCAAAGAA
ATACACTGTACAATTAGAAGTACTTGTGATTTTTCTGTATAAGTTTATCTAAATCTATCTGACTGTAAACTTGGCATACAAAATAGAAATATAAAAAATAAAAGCAGAAGAGAAAAAGAT
GACAAAAAAAATCATGTATGAAAATGAGTGTATTTTGAATAAGTCAACTTTGGGCTTTCCTGCAGGATGGAGTACAGGTAACTGAGAGTGGAAAATTTCACGTTAGTCCCGAGGGATTTC
TCACCATCCGCGATGTTGGCACAGCCGATGAAGGTCGCTATGAGTGTGTTGCCCGCAACACCATAGGCTACTCCTCTGTTAGTATGGTGCTTAGTGTAAATG
GTAAGATACATGACTCAG
TAGGACTTGGATTGTTAGTTTTGTCCTAATTGTCTAACCCGTAAGATTAAACAAAGTTGTAAAGATACTAAATTAGTTATTTTATTCATGTGGTTATTTTCCTCCCATGATGTTTTTTTT
CCCCCATACTTTAGTAAGATGGTAATGTTGTAATAAGAATATCTCTAGGTGTTAAACTCCAAAACCAACAATGCTTTGGGCTCAAGTGAATCTTTTAACTTTCTTCCTGAGATATTATTT
AGAGCTTTTAGAATTTGCTAGGCAAATACCCAGTCTAATTTTTAGAAATAACTTGACAAATGTCTTCTGGCATCTTCAAAGGGACACTTGCAGCACTTCGTTGCAAATTCGGCTGCAACT
ATTGCAAAACAGTTCAGGAATATAATATGGACCTCAAGAAGCTAAAAGAGAAAACAAAAAGAAGAGGAGAATATTTTATCTTGTTCTAATTATTTGAAATTAATAATGGCAAATAATAGT
TATTAATTATTACTATGTAATAAATGTCAATAAAGCAGCAGAAGAGCCTAAGGAAATAAATTTTCTACAAAGATTGACCATTTCCTACTTATTACTGAAACTGCTGATTTTTAAGTTTAA
TTTTGATGGAAAATAAAAGAAAACTGTATAATTTCTGTCTCTGAATAGGGAATATAAGACAATATCTTTATATCTTCAAAAAATTAGTATAGAACAGTGATTTTTTTTTGGTATTTTGAA
GATTAGTGTGAAGATATCGTCAATATATTGGGTATTTTTTCCCAGTGCTATTTGGGATGTTCTGTACTTTGTTTACTAAATTGATAATGATGTACCAGTGATTTTTCCAATGTATTGTGT
GCCATAGCATCAACATAATTATGACGTTACCTGTCTTAGGTTCCTTTTAGCAGATTTTTAATCTGTACTTTCTTCTATGAAAATTATTTCTTTAATCTGTAAAGATTACTCAGGAGAGAA
AAATTATAAGGCTAGGAATCATTCAGTAATAAGATTCCTATATCTACTTGTATGAAGTAGGAAAGGAAAGAAAGTCTATGAATATCAGTTAATCTGGCTACTCTGGAGATGCATAGCAAA
AAAACATTTTTGTTTAGGAAAGATTACCTAGTTCTCAAGTCACTAAGATTGCTGAAAAATGAAATAATGAGTTGAAATAAAACCCCAGTTTCATTCACTTAATACAGGTGTAGATTCATC
ATTCTAATCTGCTGAAATCAGCAAACTAGAAAACTACTTATTTGCTGATTTGCAGTTAATAATTGTAATATGGGTAATTTCTTCTAAACTGTAGCATAAATATACCTAAAATTAGTGAAA
CTACACTGAATTAATCTGCATTCCATCTGAAACTTTAAATGAAATTTCTCCTTCATACTAGTGGGATGTGAGATGCTGTTTTGCTATGGCTACTTTAAAAACTGGTGGTGTCAGGGGATC
AAGGAGGACAAGTGGACAGAATATAAGTATTGGTTAATTGCTGTGTGGATAGTATATATAATGACAATAGACAGAAATTACTAAAATCTTGCATGGCATCATTTCTTTTAAAAAGGGTAA
TGTTTTATGAATGTTTCTAAACCAAAACACTTTCCTAAGACTGAGGCAAAATAAAGGCATGTGTATAGAAGCTGGGAACAGGTTTGCCTGGCTGTGTTGGATAATATTTTAAAGATGCTT
TCCTTTAGCCATTCTTTTCTATTGTTTTTAAGAGTCATTCCCCCTCCCTGCCCAAATTAAAAAAAAAAAAAGTATTGTGGGAGACTCTTACAAGAAGCTTTAACTTCTAACATTTATCAG
TCTAAAAAAAGAACTGCTAGCAATAAATAATCTAAACAAAAATAAAGTACAGAATAGTTAACTGTCTGAGAAAGGTTTATACTTCAGCCCACGTATAATGTATACCATTAATCAGATAGC
CCTCCAAGTAAACACCAAGTTTACATCTAATGTAGACAGCATTAAGGAGGGTAACCAGCCCCTGGATTTCTAAAGGCTGTGATTTTGCACTGTTCACATCATTCAAGGCACGCAAACATG
CTGAAACAACTAAAATTTAAACCTGTAAATGGCATTTCTTCCTGAAATAAGTAGCTTATCTGACAGTGTTTCTGTGTGGTTGCTGTTGAAAATGAAGCTGTCAAGCAAGTACAGTTGGTA
ATTAGGACAGATCAGGGTCCACTGCCCTCAGGCAGTGTGGAAAGGGCAGCTGATTTTGGATGCTGAGAATATATTGCCAAAAGCCTGAGACTGGCCTCTGGGCACAGAAAGGGTCTTCAT
CTGCAGCTATAGAGTTCCAGGGACTGTTTTATTTGATGGTATAGATGGTTAAGTTTGATTAAGTGGGCCCAGACTTTGAAACTCATGTAGAGACAATTTAAGCTGACACTTAAGAAGGAA
TAATGAAAAGTTATCTAGGGAAAAATAAAAAAAGAAGTAATGAAAAGCTTATAAACAACATTTTTTATGTCAGATGATTTTGTACATCTGCTGATTTTATACCAGTATATTTGCTTTGGA
CTTTTCCCCTACTTTACCCTTCTTCCTGTGTGACTTTTCCAATCTAAACACACTCTGGAAATTGTTAGCTTTTGCCCCTGGATCTGGTAATTCTTAGTTTAGACTGAAAGGAAGGTTATT
AGTCCTACATAGTTTGTACAAACATCCAGCTGCAGCAAAGCACTGTATAAAAAGGCCTATGCATTATTAAGTTTCCAGTGTTGTATATGGTTATTAAATAGTATTAAGTATGTGAGTTTT
AATCTAGTATTTAAAGGATAATTGTAAAGTAGGAAACAAAATAGTGATCTAAATAAAAAAAATATTTACTGCCCTTTAAAATTAATCTGTGTTGCTTATTATACTAAGACCAGGAGAAGA
ACAATGCTAATTTGTGTTCATTCAGTTACATAAATTTTGTTCATTATGTACCACTTGCAGCACATTCCTGTAAGCCCTTTAAGCTGTTACATTGAATTCAATACTAATTCAGAACTAGCT
GAAATCAAAGGGGAAATATGCATTGATTTCAGTGGTTATAGATCAGGCTCTTGATACCAACACCTGAAACCTGATAATACACCAGAAAAAAACCCTTAATAATAATAATAATAATTAGTT
TTTGATTTGGTCATCTGCATTTGAAATTGTAGGACAGCTAAACACTCTATGCATTTATCTTTATCTTGGTTTTGAGTTATAAGCTAGATGACTTTTAAACTTAGATTAACTTCTGTTTTA
AATTAATTTTTATTCTACTTTAATATACCTTGATAGAATTCCAACATGGTTAAGAATTTTATATTTGGTTGAACTAACATTTATAGAACAAGGGTTTACTTTGTAGAACTGAAATGATGT
CGTGTCTAGACTCTGTTTTATGGAAGTATCTTTTTGTGTGTGGCCATTTTTGCAATAACATGTGAATTCCTTTTTCTCTAGTTCCTAATGTCAGCCGAAATGGAGATCCTTTTGTACAAA
CGTCAATTGTAGAAGCAATTGCAACTGTTGACAGAGCAATAAATTCAACACGTACACATCTGTTTGACAG
GTATCCCCTTTTTTTTTCTTTTTAATTGAGAAGTCAGATTTAATTTTGTA
TATACCAGAAATAATGTGAGATTTATTAAACAATAAACCATTTTGTTACTTAAAAGATATTGATAGTGTCTGGTTGTTTCTGAGAATACTAACAGTTTGACATATAAGGATTGTTATTGT
TCATACACTCTTGTTGAGATCTCTCTTTGTTGCAGCAGCTCTTCTGCTGAGATAATGTGTATTAAAATGCTAATAAATATCTAATTACTACTAAATATTTAATTTTTTATTATTTTATTT
AATTTTTTCTTCTTGGTTTGCCTTCCACTTTGAGCTGAGTAATGAAGGTATGTACTAATCATGTTGCTGAACATTTATATGATTTATGTAGTGTTGTTGTTTTGTAACCCCTGTGTACAC
TTACTGTTTTTTTCCAAATTATCTATCAGTCGTCCTCGTTCTCCAAATGATTTGCTAGCCTTATTTCGATACCCAAGGGACCCATACACTGTTGAGCAAGCAAGAGCTGGGGAAATATTT
GAAAGGACCTTACAGCTTATTCAAGAGCATGTACAAGACGGTCTAATGGTTGACCTGAATGGAACAA
GTCAGTATGCTTTCCTTTTTCTTCTGTTTTGACATGTATTTGCCTTTTTAAGT
CATTATACTTCAGGAGACATTAATTCTCTGAGGTTTGGTCCCAACTGCAGAACCATTACATTAAAAATAGTGAAGTATTTGACTTTGTAAAACTTTAACAAATTCCATCCTTGGTTTGTA
CATTGCTCACTATATAACTCTGAGCTCTCTAAGTGTAGTGTTTTTTCTCACACTGACATATTAGGAAAAAGTTCAGATTCTGATTCTTCTGCTGGTCAAACTTAGTATAATGGAAGGACA
TAAAGTATCCTCTTTTTTAATTCTCTGTGTGTTTATTTATTAGGATCACTGTCACATAGTCTCACAACAGAACAGACTTTTCTCTTGTGTGGTAAAAATAAGAAGTGTTCCTGTTTCTTT
AAGAAAAACCATTTAATATCAGCGTGCCTTGGCAAAGAGAAAATATGACATAACAAGAAGGATTTGTATACCTTACAAACCAAGGATTCTGCATGTACCACAATAGTATTCAAAGAATTA
TTTTCTACTTTATGAGTGTCAAACTAAGCTAATTGCTTTGTTTAACACTGACATGATGTAATGAGAAATACAGTTCTTGTTGCTTTTTATTACTAGCAAAAAAAGGTGTGAGGTTTAATT
TCTGCCTTTTAGGTATTGGATTCCTGTCAAACTCATGAAGTCCAGCTGGAGTACGTACAGCTAATGTGTGTAGATAAATGGGTGGATAGGCTTGAAACATAGGATTGAAGCATTTGGAAA
TAATGATAGAGTTTTAGGAGAGCTTTTGAGACTTGAGACCTAGCCAAAAACTACCCTGACAATCTAGAGGAAATACTTTTACTCATTACATTCATTTTGATATTTATAATTGAGTATTTA
TTGTAACTTCTGAAAATTTTAACACTGACCATGAACTATCAAGTATTTATAAGACCAAAGACAACAAGCTTTGTGGTGTACTGTCACATTTGCTAGTAAAAGCAGCTTGTTACTCATTAT
TAGAGCCTAGTAGATAATTCTTTATGAATTGTTTGCCACAAAAACTTACTCAAAATGCTTTGAAAGCGGATGTATTATAAGAGACACCCCATTTGGTTTGGTTCTCTGATTAGATGCATA
TGCAAGAATATTGAATATATATGCTATAAATATATAGTACTAGCAATATATAAAATGTGATATGTGAGAACTGGTTGACTAGGATTCATAATAGTGAAACACCTAAGGTTTACCAAAAAT
TGGCATTAAAACTTATGGATACTAGTTAATAAAAACAAAAATAGGCAACTTTTTGTGATACTGGAAATTCTGTTTGCAATCAGATCTTGCTTTTTAGACCTACAGAATCCAAAGAAACCT
GTCTTTTAGGGAAACTTGAATAGTAAAATAAATCTGTTTTCATTTAAGTTGCCCAATACTCCAATTTTTAATAGTAAATTTTGTCCTTATTTCATTTTATTTTGAAATATAGAGCCAAAT
GAAAGGTGTTATTTAGCAGTTTAGTACTGAGAACAGTTGAGAAACGTGACAGTTTCCCAGTCAGAGATTTTTTTTTGGTTGCAAAATCTTTGAATATCCCAAGGAGAGATTATGGAGCCA
AATTCTCCTCCGCAGTGCCAGACTGTATAACAAGGGGAATGGCCATTAATGGAGGTTCAGATTAGACATTAGGAAACAGTTTCTCACCAGAAGACCAGTGCAGCATTGAAACAACTAATC
CAGAAAGGTGGAGGAGTCTCAGACTTGGCAGGTTTCAAGCCTGCTGGATCAGCTATACAGGTATCAAGTGCTGGAAACAGCTCTACTTCTAGCAGGAGCTTGGTCTGGATAAGAGGTCCC
TTATAATCTATATTTCTATGACTCTATGAAATATCTTCCTTGCTTCAAAAAGAAGGTAATATGTGAATTGAGCTAGCCAGCTTCTAAGCACTGGAAATGCCCAGTGCCCAGCCATTTAGA
GAGCAGAGGCAAAGTTAGTGCCTACAATGGGAGAGGAAATTAAGGATTAGCAACTGGCATCAGAAAGCTAAAATTTAATCCATCATGAGATATTACATCCCACTTGAGCTTCTAAAGAGA
GAACCTGAGCCTTTTATTATAAATTAGTACTGAAGGTCATTCCACCCAAAAGGTTCACAGTCAAGTTTTGCTCAAAACTTGATTTCAGAAATGGGGATGGCAATCAGGATCACCAGAAAT
GTTCGTTTGAATGAATAATTATCATAAGCAAATAACTCCATAATGAATGATGATCATTTAAACAGGAGGGTTATTATAAAGAAGATAAGTTTTCTGGACATAATTCTAGAATTAAACTGG
TAGCTAGGTAGCCCTGGTAACCAGGATATTTTAATATGCTGCCAATTATATCCTCAAAGTGTGTATTTTGCTGCATTACCCAGTGGCACTTACAGGTTTTGCTCTGTGATTTGATTTTCT
TTTTCCTAGTATGGAATATTCCATAAAATAATTTCTGTATGTCTGCATGAGCGTGTTAGCTTTGCCTAATGCAAGCACTAAATATCTGATATCTTTGCTTTGACTTGTTTGTAAACCATG
TGGAGTACTCATAGCCTAAGGCTGGGAAACAGCTTCCCTGGCTGAGCACAGCTCCTGTCCCAGCTGGACAACTTTGAGCAACACAGTCCCTTTCAAGGCAAAGACAAGGCTGGGCTTAGG
TAGTTTGTTTGCAATTGCTCTGCATTGTGGAGGTTGGCAGAGAGCCAGTTGTGCCTAGCACATGTTTATGTGTTGAATTTAGATGAAGACCATTGTCTTTGCAGGCACACTGGGACTGAG
CTCAGGACTAAAAGTAACATTTCCCAGCTGTGTGCAATCAACCAATACTGACCTCTTGCAAAACTGCATTCAGTTCATATTTTTGAGTGTTTGCCATCATGCTGGGAACCCCTGAAGTCT
GTGGGAGCACAGTACCCCTCTACACTCACTCATTTACTTTTTTCCTTTTGCCTTTATACTGCTTGTTTGATTTTATTGCTGACTGCAAGCTTTCCAGATCAAGATCCATGGTGGTGTATG
ATGGTTTCTAATTAGCTAAATGTACATCAACACTGCCAAATACTCCACCTCCTGGACTTTCTCCTGGATCCTGGAACCTTGTTCATCCACGCTCTTTATCCATTAGTCACTCATAGTGTG
CCTTTTGCTGTGGACCACTGGCTCTTTTTAGCATTTGTCCTCACTTACTGTGCTTTGGTATGATTTGTTATAGGGTCTTGAACAATGTGAATTCTTTTAAACTTAAATGAAAAATTGGGT
CCAGGCCCACATTCAAGTCCAGGAGTACAAAGTAAAGATTTTCTGAAGGAAGCCTACTCTTGGATACAGTAGATGTGTCTTACTCAGCAGCAAAAATTTCACTTTACTGAGACATTTCTG
TTGATCTACAAAAGTTGATAATGTAGATGTAGCCAGAATTTTTCCCCCTGAAATAAAATCCAAATGTTACTAAGTAAAAATCATTTTTACAATGATTCCTAATAGGCAGCAAGGACAAGG
TCAGGCTGACTCTTCTACTATTTGCAGTCAGCCAACTCTGTACTGGGAGGCCTTATGGTCTTCAGTCCTTCCACATGCCATCATACCACAACAGAGATCATACAGTATGTAACCTTTGTT
TGAGGTTCTCAAAACACAATTCTAATGAATTACAGTATATATTTTGTAGGTATTATTTTTCTATGAACTGAGAAAAAAATACAGGAAAATGATAACTATGTTTTAGTCCCAGAGGTGAAT
GGTGTGGATTGCAGAAGAAATCTGTGCCAAATGCTACACAAACACTACTTTTGTATGGAAACTCGTCCAGGGTAATGTGAATATGAGTTACTCCACAACATTTGTCCTAGAGATCATTCC
ACGTTTGGCTCTATTGCTGGTGGTTATTTTATTTTTTATTGTTTTTTTTTTTTTTCTTAAAATCTGAAACTTTCATTGTAATGAAGCAAAACAAAATAGTATTGTCCAGTGAATGAGCCA
GTCTCAAAAACTAAAGTCTTGAAGTCCATTTAAGTGTTACTTTTTAAAAATGCTTTTACTAACATGAGGAAAATGTTCTATTTGTCTCAATATGAAGCTTTTATTTCTGAAAATGTCTCT
GCTTTTTTAAATAAAAAAATGAACTCCTTTTGTGATCATTTTGTAAAAGTTGCACTTGAATTGGCATTTTAGTTTCCTCCTCACCCAGTGGTGCTGAAGTTGTTCAAATGACCTAATGCT
CAAATATACATATATGATTATTGCTGTCCTTATCTAAAAGTAGGGATGTTTAATCTTGATGGGAAATGTAAAATAAAAAAAGAAAAATAACATTTCAAATATGTTTGTGATCTGTGGGGG
GACTGTGAGTCTATGAATTCTCTGATAGTTTTATTTCTCTGTTTTCTCTTTCAGGTTATCACTATAATGACCTTGTATCCCCACAGTACTTGAATCTGATAGCCAATCTCTCAGGCTGTA
CAGCTCATCGACGAGTGAACAACTGCTCCGATATGTGCTTCCACCAGAAGTACAGGACACATGATGGAACCTGCAACAACCTTCAGCATCCCATGTGGGGCGCATCTCTGACAGCTTTTG
AACGTCTGTTAAAGTCAGTCTATGAAAATGGATTTAATTTGCCTCGGGGAATTGAACCCAGAAGACTCTCTAATGGCTACCCACTCCCAATGCCTCGCTTGGTTTCAACTACTCTGATCG
GCACGGAAACCGTAACTCCTGACGAGCAGTACACTCACATGCTCATGCAGTGGGGTCAGTTTCTTGACCATGACCTTGACCTCACCGTGGCTGCACTAAGCGAGGCCAGGTTTTCAGATG
GTCAGCATTGCAGTTCTGTTTGTACAAATGATCCTCCATGCTTTTCAATCATGATACCTCCAAATGATCCCAGAGTTAGAAATGGTGCACGCTGCATGTTTTTCGTACGCTCCAGCCCGG
TTTGTGGAAGTGGCATGACATCTCTCCTGATGAATTCTGTGTACCCACGAGAACAGATCAACCAGCTGACTTCATACATTGATGCGTCCAATGTGTATGGCAGTTCGGACCATGAAGCAC
TAGAAATCAGAGACTTGGCAAGTCAAAGGGGTCTTCTGAGGCAGGGCATTGTACAGAGATCTGGCAAGCCCCTTCTTCCATTTGCCACTGGCCCACCAACAGAATGTATGAGAGATGAAA
ATGAAAGCCCAATACCCTGCTTCTTGGCTGGTGATCAGCGCTCTAATGAACAGTTGGGTCTTACCAGCATCCACACATTGTGGTTTAGAGAACACAACAGAATTGCCACAGAGCTACTGA
AACTCAATCCTCACTGGGACGGTGACACAATATATCACGAAACACGCAAAATTGTTGGGGCAGAAATGCAACACATAACATTTAGCCACTGGCTCCCTAAGATCTTTGGAGAGGTAGGCA
TGAAGATGCTTGGCGAATATAAGGGTTATGATCCCAGTGTTAATTCTGGCATAACTAATGAGTTTGCAACTGCCGCTTTTAGGTTTGGTCACACACTCATTAATCCTTTTCTGTATCGAC
TGGATGAAAACTTTGAACCTATTCCACAAGGCCACCTACCTCTTCACAAGGCATTCTTCTCTCCATTTCGGATTGTAAATGAAGGAGGCATTGATCCACTTCTAAGGGGATTTTTTGGTG
TTGCTGGTAAGATGCGTGTCCCCTCACAATTACTCAATACAGAATTAACAGAAAGACTCTTCTCCATGGCACGTACTGTGGCTTTAGATCTGGCAGCTATGAATATTCAGAGAGGCAGAG
ATCATGGAATTCCTCCCTACCATGATTTTAGAGTTTACTGTAATCTTTCTTCAGCTCAGACTTTTGAAGATCTGAAAAATGAAATTAAGAATCCTGAAATCAGGGAGAAACTTAGCAG
GT
GAGCCTGAGGTGAAGAAAAAGTCAATTATCTCAATGTGCATGCAAAAACCATATCTGAATGTCTTATCTAGAAAAAGATACTTGCTAAGACTTAATGGATTTTTAAGAAACTTCCATCAG
TACCAGAAAATAGATGTTAACAATTCCCACATTCAGATAATTTCTCTGCTTCTACATCTCTACGAACAGTAAGAATATATACAGTATATATACAGTAATATATACTGCATGTGTTCATGA
AATTATTAATTGGAAATGCCTAGTTTTGTAAATGCTGTTACATATGAATGCTAAGGTCATATTAAATGACAACTTCATGCAAGTTTTAGATGTTCAATTCCATTAATACTGTACAGTGAA
ACAAATGTCAGTAGCGTCCACTGTACTGTCATGTCGACATCCTTCACTACCAGTAATGAGTTCTTCTTTAGAGATTTGGTGTTTGAAATTAAATCTACATCTACTAGCCCCCCCAGCTTA
TTTGCTCAAAATTAAAGACAGAGAATTAGTCTCAGCTATAGAAATATAAAATTGGTGTACAGAGGCACAGGAAATAGAAGCTATAAAAAAGAAACAATTCTAAGAAATCAGAAGAAGGCT
GCTAGGAGAAAAAAATTTGCAGGCTAGACGTGCAGACCCACATGGTGTGTAGAAACTGCATTGCAGGATTTCTTGTGTGTACACTCACAACTTGTTCACAAAAGATGTAGTGCTATCACT
ACATTTTTTCCTGTGAGTTTTTTGTTAATTATTTTAGCTTCATCATTTACTGCTTAGTTTGTAAATAAAAAAATATTTGTTATTCTGTATTTGTATTTTTCAATTTATAGGTTGTATGGC
TCCCCACTGAACATAGACCTATTTCCTGCTCTGATGGTGGAAGACTTAGTTCCAGGGAGTCGACTGGGGCCGACTCTGATGTGTCTGTTAAGCACGCAGTTCAGGCGTATTCGGGATGGA
GACAG
GTACGTTAAAATACCATGGAAACCAAAATGAATTTTAACTTAAGGATGCTAATAACAGTTTAAGGTCTCGTTTCCAAAACAAACTCCATTTTATGTTCATTTATGATTTTAAGAT
ATTAATGAAAAGATGAAGAATACATGTTTGAAACATTGTTAGAAGCCATGATTATTAATTCTGTTACTTTTTGTGGTGAATATCATACTGACTCCCAAAAACATGACAGCCAACACATGC
TGAGTTTCCTTTTGCCAAATATTCAAGTAATTTACCTTTTTGAAGCAATGATGCTTCTTTCATTGTTATCGAGTTATTTTATTGGCAAAGAAATTGTGGTTCTTACTTAAGCATAGGTTG
GAACAGTATCACTCTGTATATATAACCCCTATGCATACTACAATATAACAGTCTATGCACCAAAAAAAGTGTTAAAAACAGGTTAATTCAAAGACCATAATTTGATAATTGTTTTTAAAT
TACTTCAAATTGTTTTTAAATTACTTTAAATTCTAATTATAAATATAATTATATATATATATAATTAGAATGATTCAAAGTAAAAATACTCTAAATATATGCAAATATAAATTAAATAAT
TATAAATATAAATGAATATATATTTAATTTTGAAGAAATTCTCATTTTCAGTTTTTAGAATACCTGAAATAAGAGAGTAGTCATTTCTCTTGTCACAGCAACCAGATGTCCTTTGCACAC
TTTCAACACACTTGTTCAGCATCTGAAAATCAACATTTCCCTCATTTTAGCATAATTTATGACCTAGAATCCTGTTCATTTCATGGCATGAGAGTACATAGACTTAGGCTGGTTAATTCA
ATCCTAGTGAAAGCAAAACAGAGGAAGAATTAGGAAATTAGATTTTATTCTCTTTATTTAATGCTATTTTCTTGCATTAAGTTATTAAATTGCTACTTAGAATACTATAAAGGCTTTTTA
ATTTTTGTAATCAATAACCCAAACTTTTTTCTGTGCTGTTTTAAAAGATTCCCTGAACTTTTTTACATCAAATATGTTTAAAAATAAAGCTGTGAAGCATAGAACTCTCATGCCTGGAGG
TAGAGAGAGTAAAAAGGGAAGAAATATATGCACTATGAGCTCCAGATTACTGGTGACAAGTACCTATTTGTGTCACAACAGGTTATCTATACTTCTTTTTGTTTATATATGTTTGCATTT
TTTCTGCAAAAGCACCTTTTCCTGTTTTGTTTTCTGATACAACATTTAGAAACAATATGTAAACATTGAATATTTAGGAAAGCGGATTCTGCTGTCCAAGGAATACAAATATTTGGAAGT
AACATGTCAGCAAATACTAAAACATTATTAGAGATAATGAAAGCAACTCTTACTTCTTTGAAAAGCCTTTTCAATGGGCAGAGGATCAAAGCTGATAACACCATGCAAAGCAGATCTGTC
CGTGCATGACAAAGGACTGATATATGAAGGGAGCATAACTTTATGTGAAGATGGAAATTTGAGAATCTGATTCTAGTACTTGGAAATCCATTGGCCACTGTCAATACTTTATGAAAATTA
TACACTAAATAGGTAAAATGAAAAAATGTCTTGAACATTCTTCTAAGTTTTCTACTGTTTTTGATTTTTCATAAAGTTTAAAGGTCTGTCTTTTTTTTTTGTTTTGTTTTGGTTTGGTTT
GGTTTGGTTTGGTTTTGGTTTAACATAGGTGGGTGTAAAAGTATCAATATTGATACAGCTTTGGGAGACCAAAAAAATGTCCCAGTGAGCAGTTCCTATGTGTTAGAATGGTGTAAAATG
TTTTCAGATTCTGGGCAGGAACTTAAGAAATTTTCTTTTCCATGTAAAGCTTCCTTTTTATAGTAATGTATTATTTATATTTGCTATTGATAACAGGCTTTTAGCCCTTTGAGTATGAAA
AACGAACTATTTGAAACCATAGTGTTTTCTTCTTGAATATAATGAATTAACTGAGCATGTATGAGAAAGTCCCTGAATCAATATAGTCATGAAAATAGTTTAAAAGAAGAAAAATCATTA
GTAAATTAAATCATCTTACTTATCTTGATAGTAAACTAGAAATAGATTAACCATTCTTCTAATCTCATCAATTCCATCAAAAGGTTTTCATGACCATAAGAAAGTTGCCTAAAGAAAGAA
ATCATGGTCATTTAAGTTTCCAACTTAAAAGAATCCTTAACTTGGTAGTCTGGTGGTGTTTTAGATGTCCAGAGATACTCAAGACATCAAAATGAGACTAAAAGAGAAATCAAATAATTT
TTTGAAGATTTCATGCCTTTCAGAGTGTCAAAATGACACCAGCTAGTGCTCAAGTGACACTAGGAACTAACATTTTTGCATTTGGATCAGTCCCTTGATTGAATGTTGAGAGCAGGATTT
ATGAGATAATTCATTTCATTCTGAACACAGTATTGAAATATCTTTGAAAAACTGCCACTTGTTTCTTTTCACTAGCAGACTTGTCTTTTCTGTGAGATTACAGGTTATGGTATGAAAACC
CAGGTGTGTTCACACCTGCCCAGCTCACTCAGATCAAGCAGACATCTCTTGCCAGAGTTTTGTGTGACAATGGTGACAACATAACCAGGGTACAACATGATGTCTTTAAGGTGGCTGAAT
TCCCACATGGATATAGTAGCTGTGAAGATATTCCTAAACTGGACCTCAGGATGTGGCAGGATTGCTGTGAAG
GTCTGTATAGAGGTGGATTTGGGGGCAGTGAGGTGTGTGCATTTTGTT
AAGTGTCTACTTTATTTTAAGAAGATATTTTACTATTTCTGGGATTTAGTTAAGATATTGCAAATTCTAATCTGAAGCATAGCCCCTATTAAGTGGGAAATCATTCCATATTCTATATTA
AATAAACATCTCATAAAAATAGCATAGATTTGTGCTTTGCAAGGTGTAGATTATTGTTTACTTGTTTTCTTTCTTTTGCGGATAAATAGTCTTGTTCGTTTCCATCTCCTTCAAAAGTTG
GGAGTATGGGGTAATTTCTTTTTCCTGAAAAATAAGCTTTTTTTCTCCCAAAATAGGATTTGTTTAGCTGCATGGAGCACAGGACACTGCTTGGTGGCCTGTATGTTGGCTTCTGTCTCA
CAGATTTTCTGCGTGGCCTCTCTTCAGCCATCGTCACATCAGAATTCTCTGCAACTGTTACATAGTTAGAGTCCATTCCCAAGAGAATCTTCTGGATGATGCAGAATGATTTTCAGTAGC
ATCAACAACAAAATGCTTCAGAGGACAATGACCTCTCTTTCTTGAGATCTCCTTGACAATGTTGTTATCATTTTCTTTGGACAAAATTCAAATGACATGCCCAGGCTGTAAAAGTATATT
CAGGAATTTTAGGAACTTTGCTCTTGAACTCTTACTATTGAGAAATTGCTGTCAAACATAGTATGTTCCTAGTATGAAAAGCCTTGCTCTTATTTCAGAGGATAAGGGTAGTATTGGCTG
ATATTATTAGAATTTGATAATTTCCCTGATATATTTCAGTACTAATATCCTTGTAGATTTACTGATGAAAGGTATCCAGATCTGTGTTCTTCATCTTTTCTACTGCTGATTCTCTTGAGT
TTACTACTGCTGAGTAGGTTATTTAATATTCTGTTGAAAGTAGGTTATTTAATATTCTTATACATATAAAGAACTGGTGGATTTCATTTTTGAAAGAAGTCACCCACTAGTGTTTTGACT
ATTTAACTCTTTTGGTAAGATAGAATTGTCCACAATGACAAAGTTATTGTGTGATACAGCTCAGAATTTAATGCAGAAGGTAAAAGTTAAACTGATGGAGGATGTCTCTTCAGTCTGCTA
CAAATGCAGTAAATCCTGAGGGAGGATTTATAGCCATGTGACTGTACCATGAGAATAAACTCATATATAATTAACAATTAAACAGGTAGATAGAGATTTACTATTCAAAGTTACTTCATA
ACTTAGCTTTTAAACTGATTACTGTATTGTCTTATTCAGTAAACAAGTCTTTAAAAATAATCACTCTCTAAGAAAATTCTTCCTTGAAGACTGTTCAAAATGTCAGTTATCAGTGTGAGA
CTAACAGAAATAAATACTTTTCAATAAGATCTTGTACAGTATTCCCCATATACAATATCCTTCAGGCCTTACTCTAATTTTTACAGCTTCTTTTTATTGGTAGGTTACTTGTGTTTTTTA
AACGTTTACCAGGTTTGCAATCCCCGAATTAATGATAATAGTTTCTAAAAAGCTAGACATGATAGACACATTGTAATTTTAATACAAAGGCTTCCAGAACCTCTTCAAAAATTCCCTGAC
ATATGCCAGAAGCATTGGGAGAAAATCAATTTTCACCTTTCAGTGCTTTACCATAAATAAAGCACATTCATCCAATTCGGCAGAAATTCACTTTGCCATGGTTCATGAAGTGAACAGACA
GTTTCACAAATACATTTTTTATATTTATTTGTGAAAAAGGTAAAGCTGTTCTGAGAAATTACGTGTTGATTCTCTAAATGTTTATGCTATCACTGAGCCCTTTAGAAGAGATGTTATCTT
TGGAAAGTCTTTAAAGTATTTTTGTGTCCAACAACCCAGTTTGCATTTTCTTCCAAGAGAGTTGCTACCAGAGAGTACCACTGGATGCAGCACAGTTAGACAACTGTCAAACAAAAGAAA
GGGTAAATAAGTACTGTTTTGTAAAAAATTTCCTATTTTTATCCCCTTTTTCTGAATTTCTGAAGACTTGCAGGGGTTAATGAAGAGAAAGTGAAGTATCCATGGCTGGAACTGCTTTCT
TGCATGGATGAATGACTGTGACATTTTCTGTGGGAATCCAGTTTAAAGTAACTGATGTAAAAAATTTCTTTCCTTCTGTAGCCACCGCTCCTCCGAGGTGGAGTATACACTCAGGAACAG
CATTTACTTTGAGTTGAATACCTTAAAGGGGTTTGTTTATTTAAATTTATTACTGTTCATTATTTAAAGGAAAAATAATTAAACCCTTCTCCACATTTAAAACGCTTCTAATGATTTTAA
AATTAAAATTAGCCTAATTTCAAGTACAGAATATTGCTCATTGCACTTTATGTATGTTTCATAAGTGACCCATGTGTTCAGCTGTTTCAGCCTGGTTAAAAACACATCTGGTTTTGTTGT
CTTTCCTGTTTTGTTAAAAGTCAAAATACTTTTCCATATGAAGAATAGAAAAATTTCTTAGTTATAAAAATCTGCCTTGTACATTTTTTGAGTAAAGCTAGTATTTACTTCTTACAAAAC
AAAGAATTATTACTCTTTATAATAATTAAAAAACAGATTACCTTTAGATTTCAGTTGGCAAATCATACAACAGAGTTACTAGTTTATTATGGCAAAAAGTAGGAGTTCCACTGAAGTGCA
TAAATTTTCTTCTGTTTTCCTTCACTTTCTACCTTTGTCTTGTAAGAGATAATGAGTAATTGCTGGATTTGCTGCTGCTCTTTATTTGTGCAAAGAGCACTTGAGCATCAGATTTTCCAA
ACAAGAAACTTTTGGTGCTTTATTTCAGGCTCTCTAGTGCAAGAAGTGTATTTTAAATCTTTTTTTTTTTTTAAGTAATCAGCATATGCTTTCATGATTACTAAAATGTGAATCCTTAAA
AGTTTCACACTTCTTGGTTTGGTTTTCTTTTGTTTTGTGGGGGCATTTTTTGTAAGTTGAAGTAAAAAATTTCTTTAACCTTTTGTTTTATGTCAAAACCCATGAGGTTTCACATGGACC
CAGGAGGACAATGGACAATGACCCTGGAGGAAGTGATTCAGATAAGATGCAAGTCATCCTTATAAGTGTAAACTGATTTGGAAAGATTTTTCTTAACTATTTCTCAGTGAACAGCCTATC
TTCTCTGTCAGAAGATAGGCTTCTTCTTTCTATATCTTCTCTGTCTCTGTCTTCCCTATTTTTTTCTTTGTTTGTTTGTTTAATTCAGAAATGCAGCCTTATACCAGTTATGATCAAACG
TTCAAATCCCACTGAATTTCATTAGAAGAGTTAAGACACATTCTTAATCTGAATGCTTTCAGTAGATTAGACCTATATTTATGAACTCTTTTATTTTAAGACCAGAGGAACAATTATGCT
GTCTATTGCTTCTGTACGGACAACATTAATCTCTTACTATGCACTTCTCATTATGTCCTTTAATCTTTAATGAGAACACTAAACAGCACTGGGCAAAGCACTAAATACTGCGGAATATAG
TGTAAATAATACTTTAAAATGTTAGCAGAAATCTCAGTGTGAGACTGGAAGTTCTTTTTTGACTAAGGATATTGTTCATCAATAACTCTCAAAATACAAAAATTATGTGATTTGTGCCTG
AAAAGGTCTTGTCTTTACCCAGAACTTTTATGCTTTGGTCAGGTCATATATTTTTGCTTTCTACATTCAAATTTTCTTTTTTCATTCAAATTTACATTTAAAGATAGTGTCAGCTTAGTA
ACAATTCAGTCTATGCCAAGCTACTAAAATTATAAGGATGTCATCCTTTTTATCCTTGAGTGGAAGTATCTAATACAGCCCAGTGTTTTTGTATGATTAAAAATTTTACTGAGAGAATCA
GTATTTTTATCTGTATTTCATCCAAACAAAAAATATTTTAGCTTTCCCAGGTATTTACGATCTATTAAATACAATTCTACATTCATAAACATAAAATAAGGAGACTTAAGTTATGACATT
GCTTTGTCTTTGCTACCAGGAGTTTCATGCCAGTGGTTGTCATCCCTTCCAAAGAGCAACAGGGAAGCAATAGGCTTCAATCATTGTGTGTAAATTCAAACTTCAGATCTGTCAAAGTTC
CACTGCTGGCAATAAAGAGATGTCTGTGGAGAACAGTCAGGCTGCAATCTCGACTTATTGTCAGTGTTCATTGACTCTAAAATCAACACGGGTAGGAAAGCATCTCAGTGAAGTGTCTCA
GTGATTTCTACAAATCTAGGCAGCTGGAGGATTTCCTTCTTTCCTGTGGACTGCCTTTCTAAGACACTGTTGACTTCACAGTCTAGTGGTCAGGACAGTTCTTAGGGTTTTTATTTTAAA
AATTTCCATGGATTTTCAGTCTGTCTGAAATTACTTATTCTTACTGATTTGTATTCCAAAAGCTGCATATTTTTAATCTTCAAAATTCCCTAACTAGGCCTATTTAACTTTTCCACTGGA
GAGGTTGGATTTGCATTGTTTTGGGGTCAAGAACCTAATGTTTCTCCTTTATCTACCTGAAGACCATTCAAAACCTATTTAGATCATTGAAAGCATGACATGTTTTTAAATGTCTTTAGT
GTGTCATTAGCTATATATTAACAAACTGGACATTTGCTTTCCCAACAACATCTGAACCTTCTAGTTCTGGTAGTAGACTGATCTCGAAGCTCAGTGTGTGAGTTTTGAGATAAACTACAG
GAAACATCTTTTTTATTAAAATTCCCGAGTATAGCAGCTGGCAGATGACAATCTGATTTGTTACTTCATCTTTTACCTTCTATACATTTTCCTTTTCAGATGTTTAACTAACCTTTTCAT
AAAATACATCTGTTCTGATCTGAGCAGATTAGTGTTGGATTTCAGACCACCACATTACATTTTTGGTGGTGTTTATCTTTTGTTAGAAAGTCTCATTCAACAGAAGAAATGAAGATATGC
TGTGCAATGTGAAGGATTGTGGCCCATTTAGGCAATAACAAAACTAGCTATTTTGGGTTAGGGCTTCATTTTATGTGTAAAGTCACTTTCCTATATTGTGCAATTTTTAAATAGCTGCTT
TGTGAAAACATCTACTCAAAAAAATCATTTTACATCAGATATTTTCAGTGTTTCTCCACCCTTTTACTTGTCCCACTGGCATGTCTACAAGTTCTTAATACAAATGCTTACAGTAAAAGC
AAACTAATTCACTACAATAAATCCTGGAGAATCAAACTAGTATCAAATAGATATATGTGCTTTGCTTCACATTTCCTCAGTCTTTTAAGTTGTTTTGTTTTAATCTACCATTAGAATAAT
TCTCCATGGCCTAGATTTTGAGGAGTGATTCATAGAGAATTAAGACTGCACTATGATTCTCTATCAGTTTTTTTATTATCCAATTTACATAATAATTGCATTTTTAAAACCTTGTGGGAA
ACAGGATTTTCTAAAGATATGAACATGGCTTCCATATACAAATAGAAATGCTGGTATCTTTATGGAAAGGGTTGTTATACATTGGAACAGGTTGCCCAGGGACAAGGAAGGATCATCATC
GCTGGAAATGTTCAAGAAATGACTGGATATGGTATTCAGTACCATGGTCTCGTTGACAAGGTGATGTTTGGTCAAAGATTGGATCTGAAGATACCGGGATCTTTTCCAACATAAATTATT
CTGTGATTATTTGTGATTCTGTAAATGGATCAGCTTGACACTTGCAGTGTAACAGTAGCTAACTTCTGGAAGAAAAAACTGTCCACAGAGAAAAAGAATGGTTAGGTTGCTTTTAAGTAT
TCACTTTTTCTGCAGACAATTAAATGGATGGGTATAGCTAATCTGGGGACATATTACTTATTAGGGAAAAAAAAGCCCAGAGTTTCAGTCTTATTTTTTCTATTTACTGCTACTGCTAAG
GTATTCATCATTAAGAATAAAAGTTAAAAAAAAAAAAAAAAGGAATGAGAAGAAATTTCTTGATTTAGGCTGTCTGAAAGCTGATGCATTTTGTCCTGCACCTCTCAGCAGTGACATTCC
TCCCTGTTGTACCTGAAAGAGAAGCTAATAAGAGCTGGTAATTTGGCAAGTTGACATATTTGAGTTTTAAAAAACTTGGAAAGTCAGATCTGTGTACTTAAAGCTGTCACTGAACATGTG
GTTCTCATATTTACCAGTCTAAGGTGATAAAATCATCCCAAGATTTCAGACATTTGTTTCTAAGAAACAACCTAGGAATGAAAAAAACAATGGGCCATTGTATTATTGTACAAAAAAAAC
CAAAAAAAATCTGTATTATGCAAGATGACTATAGCAGTTACTAAACAAAGTAGGATAGCAGAAGCCTTTCACATATTGCTTCCAAGAGAAAACAGAGATTTTGTGATACTCAGGAAAACT
TTAAGCAGTACATTGCTTTGAGAAAATTCCTCTGACCAAAATTAGTTCTTTCTTCAGGAACCCTTCAGTATGATCCTTTTTCTCATCATACTAAATATAGAAGTGTCTAAGGGTGTTCAA
AAATGCCTTCATGCCGAGCTTCTTACAGACACATCGGTCTGTTCCCATCTAAACCAGTTTACTTTCTGAGTGGACAGCAAGGAGGTTATGTGGGAAACAGCAGAACACACGAGAAGAATG
AACAATATATTGGCAGCAAATAGCATGTATTTCTTTGGTGGATGCTGTTATTATAGGAGGAAAGTAATGCGTTTATTAAAGAATCAGACAAGCTGCAAGGAAAGCACAGGGAAGGGGAAT
TGTGGATAACTTGTGTTCAAGAACAATCTGTAGATATTGTTTTTGATCTGAATTTTTTTTTGGTCAGTTATCTTCTTCTCTTTTTGTGTCTTAAATGATATGAAGCCATTAAGACAAACT
TAAATTTTTACTAACAGAGAAATTATAATATTTTAATATACATAAAAGTTCAACACAATTAAAAGTAGTCCAAGATACCTAATTTTGTATAGTCAGAGCAATCTTCCATTTGTTTCTCTA
GTTCCTTATTTCAGCAGTGTTTATAGACTTGAAATTTTTGCAGTAATTTGTGTTTATAGTATAGGTATTCAATCTAAATTCCAGAAAAATACTTTATAAATGTTACTGAGTTTCTGATTT
GATTTGTTTTGGTGCAAATTAAGAGAAACATTATGGAACATGACTCCTTCCCATGTTCAGTTGCTTTCATGGCTCATTCTGCTAATACCAGACTTAGCTGAGAAATGTCTATGGTACTCT
GTATTTAGGCTTTCTCTTTGGTTTTAGCAGACTCTGCTGCTAGCAGTTGATCATGTAGTTTGTTCCTGCTTCAGCTTGGCTCATTATAAGTTTTAGCTTTAAAGCTTCTGTGAACAGAAA
TGAGAAAACTTCTATTTTCTCATTGTCTTCTCTATCAAGTGCTGTTGCAGTTTTGTTTTCCTTTCCTTTCTTAAATGGGACTCTTTCCAAATACTCACTGTGTTTGAAAGGCTAAATAAA
GTGAACTGGAAGAAAGCACACTTCATCTTGCCAAGACGTCCTCTTTGGATCATAGGAGAAGTAGCTCATTTCCAGGCTTGAGATTTTTGCTCTGTGGTGGTAGGAGTCTTAGCGTCTAGT
GATACATTCAGATTCCTCATATTTGGAAATAAGACTCATCAACCTATAAAGCATGTCTGCAAATTTGGAATTAAATTGAAAATTCTCTTTCAGATGGCAAAAATAACAAATAATAATGGC
TGGGATAGATGAGGTACCCACAGAGTGGTTTTTCTGTCATTGGTTTTTCTTCATATGTAGCTGTCCTGTTTGCACAGAAAATAATTAAAAACCAAGTGAGTGAAAATTTCAGAAGTGAAA
AAATAGTTAAAGTAGCACTATATGGGTTTGTTAAAATTGTATTTATTTCTTTTTGTTTCCCACTAAAAAGCTGGTCTGTGGGTAAACACATTCTCTGCATCTAACTAGCTTAAACATTCT
ATCACTGAGATCTATCCATCTGCCATCAACCAATTCTAAGGGGATCAGAATGAATGTATGACTTGCCTTCTCCAAATCAGAAAACACTGCAAACCCATATTAATATTATAGCTGCTGAAA
TATGCTGTAGTTTATGTGTAATTTCTTGTCTGTTTTCAGACTGTAGAACCAGAGGGCAGTTTAATGCATTTTCATATCACTTTCGGGGAAGACGTTCTCTTGACTACAGCTTTCAGGAGG
ACAAGCCCCTGAAGAAAATGAAAATGTCCAAATCAGTAAG
GTAAGACTTTCTTTTTCTTAAAGAATTATAAAAAAACATTTGTTTTCAAAATGAAATGAAACGGAATGATTTCTTTCGGA
GCACAGGCCATTTTTCTTCTAGTTCCTGATTTCTCAAGTTTATGATTAATGTATTTTATTCTGACATTTCTGCATATCTACTAACAATAAGCCACTTTTTTTCAAGCTCAAATTTGTGTA
AAACTCTCTGTGACTAGTATAAGTATAGTACTTTTGTTCTTCCTTCAGTTTTCATGAAAAAAAAACACGAATGAAGTGTGATTTGAGGATTTGAAATGCCACATTCCTACAGTGACTGCA
GTAACGAAATTAAATTATTTTATTTCCTATTTGCAGCTTCTAGATTCTCCTGTAGAAATAGGAGGATACCAAGTGTTGATTTCAGTTTCATATAAATTTGTGATAATGGTAAGGATTGCT
TCTGGTACCAAAATACTTCAAGCGGGAATGCAGAACAGCAGTGCTAATAATATTGTTTATAACTCCCTAATCCTCAAAATATAGCAAGGAAGTAAATCACAGTTTCAGTCACAAGTTATC
AGCTGCACAGTGTCCCTGCCCTTTCATGGGATTGAAAACTTAATTATGAATCAGTGACATGAAACAAGTTCTGCTCAGACCATTTCTTGTGAAGATCCATCGTGATGAACAAACATGAGA
TACCTGAATTGTAGTTCTTTCTATTCAGCATGCATTCTTTTAACAAATAAAACTTTCTGTTTGAGTGATGACAATGATCAAGCAGAGTCTACCCACTGTGGCAAGAAAAGCATCTAGACA
GATGCATAAAGAGGTAAATGAATTCCAGCAATTTCAAATACTCTGGAGGTGTTTTAGTACTTGAAGGAACACAATGATTATATTCCATTTAATTGAGAGGAATCTGTCCCAAAATAAAAG
ATCATTTACGTGTTTAGAATTTTAGACAAGAGAAGACAGCAGCTATGGATAAGCTGGCTTACAGATAATATGAAAAGATAGGTTCCTTTGAAGTAATCCTTGAAGAAGGATTTTTGTCCA
TCTTTGCAAGTGAACTGCTAAAAAAATTTACAAAACAGCAACTCTCTTTTTAAGGATGCCTAGTCCCATAATTCTAAAATTGTAATAGGGGTTAAATGAAATCAAAATGAAAGCAAGAAA
AAAGTAAACGCTTACATCTAAGTACCAGCTTGTTTGTCTGTGTTTCAGTCCAATTACTAATTAGGAATACAAAATAGTAGATTCACAGTGCTTCATTTGTAGCATAAATAAAGCTAAAGC
AACCTCAGTCATTGAACATTCCCATGAATTCTCATGCTCAGTGTTGTATTTAAGTTGCATTTGTGGTGAGAAGGGTTTTTTCCTCCTTTTTTTTTTTAGCTTCTCATTTTCAATAACTTG
AACAGGTGGGGAAGATTAAATATTTTGTTATACGATAGCAGCTGGTTTACTTGAACTTTGGCATGTTATGTTGTTTAGAGTTCCTTTTCTCTAATTTAGATTAAAAACTATGGGAAACTG
AGTAGCTTGAACGCCTGCCAGGAAGTGCTGTTTTAATTTATGCAGCAAGATTATAAATCCTGAGCCCTAATATATGAGAATTTCTTTGCCAGTTCATTCTTTGGATATTCCTTAGCACTG
GAGATAATATGTTATGCCTGTAATTATTAATGGTTCAAGAATTTTCAAAAAAGTAAGTGGATTCAAGGATCTTAATATAATAAGTGACTTAAAAATTAGTGTTATCCATGCTTTTGAATG
CCTGTTTTTTCAAGTGGTACCAGATAATATATTTTTAGTTACAGACAGTTCCTTTTGTTACTCTTTCTCATCAACAGATTGAATTGATTAACAAAATTTTGTGTTATATATCTGCTACAA
GATATCAGCTGGAAAATACTACAGACAAAAGACTTTAGATTTTGTGTACTATAAACACTATTAATGTAAAATGTTAGTTAAAAGTATGTTCATATCTAAAAGTACTTCTCATTTACTTAG
GAAACACAGCTTTCTCATTTTTAAAGTCATATTTCTTAAAATACATGTTTTTCCAACAAGCCTGTAGAGGAAGAATCTATGAATCAGAATGTGAAATGTGAATTTCATATTAGAGGGAAC
ACTTCTTAAGACTCTTTCACTTCAGTCTGCATTTGTATTGGAGGCTCAGGGATGTATTTAAGGTGATGCTGTATAGTGTCACTGGTGACAACTTTGTGTCTATCCCTGCACAAAATACAT
GTTTTTTCTAAGTATAAGAAATTCCCTGTTGCTAGTGATATTGGCAGTAATCTGGAGCTCACCTGTCCTGAGTCTGTCGTCAGCACCAGCTGGGCTTGTGTGCTGTTGTGGTTCATATTC
CTACATTTGTTGGTTGCTCTTTTACATTTTTTGTTAATTGTCTTAAATATCTAGCCAAATAAAAATGAGTTAGATGAATATCCTGACTTGGCACTCATTTGTTGCAGTTCTGTGAAACAG
AGTAAATATTTTCGTAACGCAACATCCACATCTAATGAAAAGAGAAATGTACCTGCAGTGAATGACTTCAAAGAGTTTGTTTTGGAAATGCAAAAAACTATTTCAAGTCTCAGAAATCAG
GTAAGATGCTATAATGAACTTATTGTAGTCTATCATGTCTAATTGTAGGTTTAATTAATAATATTTTCCTTACATCTGTCTTGCGTTTTTTGATATTTAGACATCCTCTGCAGATAATAC
CCACCACATAGTATCTCAAACAAAAACCAACACAGAAGATGGTGTGTTATTCTTTATTTCTGTGTTCTCTTGAAATCATACTGAAATATTCTACAGCTGGACCCTCTTGACTTTTGAACC
TGAAGCCTCGTGTAACAATTGTATGCTAAACACAGACTTATCTTCTAAAAATTTGTTTGTAGTGTTAATACAATCTTTTTTACTATTTGAAATGTATACAATTTGTGTAAGGCAATAATT
AAAATGCAGACTTCATAAGAAGTAATGAGTCAGACAGCTGTAAACAGATTTAAGATCTAGATCACTTAGAGAAGACTTTACAATGTTTGCAGGTAAACTCTATTCAGCCATAGTAGAATC
TCATTTTTAAACTGTACACCATACAGTAGTTACTTAAAAATTCAAGTAAACCTTTTTAATTAAGGTGTTTTTTAAAAAAATTTAAAATTCACTTCCTTTCCAAAACATTTTTGACAATTT
AAATTTGTCTTTCTGTATATGAAACATGGAGGTTTTTTTTCTCTTTCTATGCTCTAGCCGAGTATTTCAATGGTAGGAAAGATGTATTTTCTGTTAGCTTTCTTTTGAAAGACAATCTCC
ATATTACCTGTTTCTAGTCTTTTAGCATTATAAAAACTAAGTGGTGAAAAGAAGAACCCAGACAAGTATAACAAGGTTTATATAGCCTGTATTATAAGAAGAAAACCAGAATACTTTACA
CAAACAAAAACTGTTTTTGATTCAGTTGCTAACTTTTTTTAATGTTTTCAGATAAAAAAACTTGAATCACGCCTCAGTAATTCTGATTGCACTGATGAAGAGGGTAAATCATATTCCAGC
AATGAAACCTGGAAAAGGGACCCTTGTACTGTGTGTGAATGCAAA
GTAAGTATGTGGAAATTAATTTTGTGATAGAAATTATCATTTTGCTTCTAAAACAGCAATTCCAGTTTTGTGCCT
GCTAATTTCTGGGTAATACCTGCAACATTTTTTTATGGTTCTCAGTTTTCTTTGCAGAAAATTATATTATTCAGATATCCCTGCCCTGGACATTATTTTTCAGTCCAGATGTTATCTATT
ATACTTCTGTTTTCTTGTATGTAGAGTTATATGGGTAAATTTAATTGCAAAGTGAGAGATTTTTGAAAAAATACAACCGAATGCATAAAAATCAATAAAAGCTCATCGGCCGTATTGCTG
GATTGTCATTTTCTTCTTCAGAGAAATTTTTAAAAAGGTAGTAAAAAAATAAGTTAGTGCTTGGTACCCTGGTCGCACCTGAACATGGACAAAAGCATATATGCTGCTTTATCAAAAAAT
ATGGTAATCCAGAGGGTGCCTTAACCTTCTCAATGTCAGTTTATACTAAAAGAGACTCTGGGGAGTTACCATATTATATGTGGATACATATGTCAGATTCTTACAGAGAATGAATGAGAA
TATTTTCCGTAATAACATGAAAAATGCATTTCTTGTTCAGAACATGTAGCTAAGTATGTTTTCGTTCTGGCATTTTTCTCCTGGTACAGGCTGGTCAGATTACCTGTTTTGTAGAATCGT
GCCCGCCAGCTGACTGTGAAGCACCTGTGAAGGGTAAAGGAGATTGCTGTCCAGTCTGCTTACAACAAAATACTAATAAAAAGAAGCCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTGATGCTGGAGAGCGTCCCCGCCGTGTCGCCCCAGACCACCATCCTAGATCTAAGATTTAATAGGATTAAAGAAATCCAGCCTGGAGAGTTTAGACGGCTTAAAAACCTGAAC
ACACT
GCTTCTAAACAACAATCAAATCAAACGAATTCCTAGTGGGGCATTTGAAGATCTTGAAAATCTGAAATATCTCTATTTGTACAAGAATGAAATCCAGTCAATTGACAGGCAAGCA
TTTAAAGGACTTGCCTCTCTAGAACAACT
GTATCTGCACTTTAATCAAATAGAAACATTGGAACCTGAATCCTTTACTCATCTTCCAAAACTTGAAAGGCTGTTTTTGCATAACAACAGA
ATAGCTCATTTGATTCCTGGAACATTTAGTCACTTAGAATCTATGAAGAGACT
GCGTTTGGACTCGAACGCTCTCCACTGCGACTGTGAGATCCTGTGGCTGGCGGAGCTGCTGAAGACG
TACGCGGAGTCGGGTAACGCTCAGGCAGCAGCCACCTGTGAGTATCCGCGGAGGATCCAGGGAAGATCGGTGGCCACAATAACACCAGAAGAATTGAACTGTG
AGAGGCCAAGAATTACA
TCAGAGCCTCAGGATGTGGATGTTACCTCAGGGAATACAGTGTACTTCACTTGCAGGGCTGAAGGCAATCCTAAACCAGAAATTATCTGGCTTCGAAACAA
TAATGAGCTCAGCATGAAA
GAAGATTCCCGTCTAAACTTGCTAGATGATGGCACACTGATGATCCAGAATACTCAAGAAACAGACCAAGGCATTTACCAATGCATGGCAAAAAATGTGGCTGGAGAAGTGAAAACTCAG
GAAGTTACTCTTAGATACTTTGAGTCACCAG
CCAGGCCAAGTTTTGTGATTCACCCACAAAATACCGAAGTGCTGGTTGGAGAGAGTGTTACCTTGGAGTGCAGCGCAACCGGGCACCCT
CAGCCACGAATTACCTGGACCAAAGGCGACAGAACCCCTCTACCAAATGACCCTCGTGTCACAATAACTCCATCAGGAGGACTTTACATACAAAATGTGAAGCAGGAGGACAGTGGCGAG
TACACCTGTTTTGCATCTAACACCATAGATAACATCCATGCGACTGCATACATCATAGTCCAAG
CTCTACCTCAGTTTACTGTCACTCCACAAGACAAAACAGTGATTGAGGGACAAACT
GTTGACTTCCCTTGTGAAGCACAAGGTTATCCCCAGCCTGTTATTGCCTGGACTAAAGGAG
GAGGCCAGCTGTCTGTTGACAGAAGACACTTAGTTCTGTCCTCCGGAACGCTGAGGATT
TCCAGGGTTGCTCTGCATGACCAGGGACAGTATGAATGCCAAGCTGTCAACATCATTGGATCCCAGCGGATCGTTGTGTACCTGACTGTGCAGCCTAGAG
TGACTCCTGTATTTGCCAGT
GTTCCCAGTGATATGACAGTGGAGGTTGGCACAAACGTGCAGATCCCATGCAATGCTCAAGGAGAGCCGGAGCCAGTCATTACATGGAATAAG
GATGGAGTACAGGTAACTGAGAGTGGA
AAATTTCACGTTAGTCCCGAGGGATTTCTCACCATCCGCGATGTTGGCACAGCCGATGAAGGTCGCTATGAGTGTGTTGCCCGCAACACCATAGGCTACTCCTCTGTTAGTATGGTGCTT
AGTGTAAATG
TTCCTAATGTCAGCCGAAATGGAGATCCTTTTGTACAAACGTCAATTGTAGAAGCAATTGCAACTGTTGACAGAGCAATAAATTCAACACGTACACATCTGTTTGACAGT
CGTCCTCGTTCTCCAAATGATTTGCTAGCCTTATTTCGATACCCAAGGGACCCATACACTGTTGAGCAAGCAAGAGCTGGGGAAATATTTGAAAGGACCTTACAGCTTATTCAAGAGCAT
GTACAAGACGGTCTAATGGTTGACCTGAATGGAACAA
GTTATCACTATAATGACCTTGTATCCCCACAGTACTTGAATCTGATAGCCAATCTCTCAGGCTGTACAGCTCATCGACGAGTG
AACAACTGCTCCGATATGTGCTTCCACCAGAAGTACAGGACACATGATGGAACCTGCAACAACCTTCAGCATCCCATGTGGGGCGCATCTCTGACAGCTTTTGAACGTCTGTTAAAGTCA
GTCTATGAAAATGGATTTAATTTGCCTCGGGGAATTGAACCCAGAAGACTCTCTAATGGCTACCCACTCCCAATGCCTCGCTTGGTTTCAACTACTCTGATCGGCACGGAAACCGTAACT
CCTGACGAGCAGTACACTCACATGCTCATGCAGTGGGGTCAGTTTCTTGACCATGACCTTGACCTCACCGTGGCTGCACTAAGCGAGGCCAGGTTTTCAGATGGTCAGCATTGCAGTTCT
GTTTGTACAAATGATCCTCCATGCTTTTCAATCATGATACCTCCAAATGATCCCAGAGTTAGAAATGGTGCACGCTGCATGTTTTTCGTACGCTCCAGCCCGGTTTGTGGAAGTGGCATG
ACATCTCTCCTGATGAATTCTGTGTACCCACGAGAACAGATCAACCAGCTGACTTCATACATTGATGCGTCCAATGTGTATGGCAGTTCGGACCATGAAGCACTAGAAATCAGAGACTTG
GCAAGTCAAAGGGGTCTTCTGAGGCAGGGCATTGTACAGAGATCTGGCAAGCCCCTTCTTCCATTTGCCACTGGCCCACCAACAGAATGTATGAGAGATGAAAATGAAAGCCCAATACCC
TGCTTCTTGGCTGGTGATCAGCGCTCTAATGAACAGTTGGGTCTTACCAGCATCCACACATTGTGGTTTAGAGAACACAACAGAATTGCCACAGAGCTACTGAAACTCAATCCTCACTGG
GACGGTGACACAATATATCACGAAACACGCAAAATTGTTGGGGCAGAAATGCAACACATAACATTTAGCCACTGGCTCCCTAAGATCTTTGGAGAGGTAGGCATGAAGATGCTTGGCGAA
TATAAGGGTTATGATCCCAGTGTTAATTCTGGCATAACTAATGAGTTTGCAACTGCCGCTTTTAGGTTTGGTCACACACTCATTAATCCTTTTCTGTATCGACTGGATGAAAACTTTGAA
CCTATTCCACAAGGCCACCTACCTCTTCACAAGGCATTCTTCTCTCCATTTCGGATTGTAAATGAAGGAGGCATTGATCCACTTCTAAGGGGATTTTTTGGTGTTGCTGGTAAGATGCGT
GTCCCCTCACAATTACTCAATACAGAATTAACAGAAAGACTCTTCTCCATGGCACGTACTGTGGCTTTAGATCTGGCAGCTATGAATATTCAGAGAGGCAGAGATCATGGAATTCCTCCC
TACCATGATTTTAGAGTTTACTGTAATCTTTCTTCAGCTCAGACTTTTGAAGATCTGAAAAATGAAATTAAGAATCCTGAAATCAGGGAGAAACTTAGCAG
GTTGTATGGCTCCCCACTG
AACATAGACCTATTTCCTGCTCTGATGGTGGAAGACTTAGTTCCAGGGAGTCGACTGGGGCCGACTCTGATGTGTCTGTTAAGCACGCAGTTCAGGCGTATTCGGGATGGAGACAG
GTTA
TGGTATGAAAACCCAGGTGTGTTCACACCTGCCCAGCTCACTCAGATCAAGCAGACATCTCTTGCCAGAGTTTTGTGTGACAATGGTGACAACATAACCAGGGTACAACATGATGTCTTT
AAGGTGGCTGAATTCCCACATGGATATAGTAGCTGTGAAGATATTCCTAAACTGGACCTCAGGATGTGGCAGGATTGCTGTGAAG
ACTGTAGAACCAGAGGGCAGTTTAATGCATTTTCA
TATCACTTTCGGGGAAGACGTTCTCTTGACTACAGCTTTCAGGAGGACAAGCCCCTGAAGAAAATGAAAATGTCCAAATCAGTAAG
TTCTGTGAAACAGAGTAAATATTTTCGTAACGCA
ACATCCACATCTAATGAAAAGAGAAATGTACCTGCAGTGAATGACTTCAAAGAGTTTGTTTTGGAAATGCAAAAAACTATTTCAAGTCTCAGAAATCAG
ATAAAAAAACTTGAATCACGC
CTCAGTAATTCTGATTGCACTGATGAAGAGGGTAAATCATATTCCAGCAATGAAACCTGGAAAAGGGACCCTTGTACTGTGTGTGAATGCAAA
GCTGGTCAGATTACCTGTTTTGTAGAA
TCGTGCCCGCCAGCTGACTGTGAAGCACCTGTGAAGGGTAAAGGAGATTGCTGTCCAGTCTGCTTACAACAAAATACTAATAAAAAGAAGCCATAA

Retrieve as FASTA