Entry information : GgoMPO
Entry ID 7683
Creation 2010-11-03 (Myriam Duval)
Last sequence changes 2010-12-03 (Myriam Duval)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-19 (Christophe Dunand)
Peroxidase information: GgoMPO
Name GgoMPO
Class Myeloperoxidase    [Orthogroup: MPO001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Hominidae Gorilla
Organism Gorilla gorilla    [TaxId: 9593 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GgoMPO
start..stop
S start..stop
HsMPO 1527 0 1..745 1..745
PtroMPO 1523 0 1..745 1..745
PpyMPO 1454 0 1..745 1..745
PabeMPO 1451 0 1..745 1..745
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25701217..25701370 154 N° 2 25701516..25701609 94 N° 3 25701961..25702136 176 N° 4 25702329..25702452 124
N° 5 25702550..25702679 130 N° 6 25702762..25702968 207 N° 7 25703830..25704148 319 N° 8 25706282..25706442 161
N° 9 25708824..25709079 256 N° 10 25709575..25709745 171 N° 11 25710602..25710839 238 N° 12 25711631..25711835 205
join(25701217..25701370,25701516..25701609,25701961..25702136,25702329..25702452 ,25702550..25702679,25702762..25702968,25703830..25704148,25706282..25706442,257 08824..25709079,25709575..25709745,25710602..25710839,25711631..25711835)


exon

Literature and cross-references GgoMPO
DNA ref. GenBank:   CABD02154592.1 (1..5644) [5' end]   CABD02154591.1 (1..4215) [3' end]
Protein sequence: GgoMPO
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   745 (697)
PWM (Da):   %s   83695.72 (78779.2)  
PI (pH):   %s   8.99 (9.22) Peptide Signal:   %s   cut: 49 range:49-745
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVPFFSSLRCMVDLGPCWAGGLTAEMKLLLALAGLLAILATSQPSEGAAPAVLGEVDTSLVLSCMEEAKHLVDKAYKERRESIKQRLRSGSASPMELLSYFKQPVAATRTAVRAADYLHVALDLLERKLRSLWRRPFNVDVLTPAQLNVLSKSSGCAYQDVGVTCPEQDKYRTITGMCNNRRSPTLGASNRAFVRWLPAEYEDGFSLPYGWTPGVKRNGFPVAARAVSNEIVRFPTDQLTPDQERSLMFMQWGQLLDHDLDFTPEPAARASFVTGVNCETSCVQQPPCFPLKIPPNDPRIKNQADCIPFFRSCPACPGSNITIRNQINALTSFVDASMVYGSEEPLARNLRNMSNQLGLLAVNQRFQDNGRALLPFDNLHDDPCLLTNRSARIPCFLAGDTRSSEMPELTSMHTLLLREHNRLATELKSLNPRWDGERLYQEARKIVGAMVIITYRDYLPLVLGPTAMRKYLPTYRSYNDSVDPRIANVFTNAFRYGHTLIQPFMFRLDNRYQPMEPNPRVPLSRVFFASWRVVLEGGIDPILRGLMATPAKLNRQNQIAVDEIRERLFEQVMRIGLDLPALNMQRSRDHGLPGYNAWRRFCGLPQPETVGQLGTVLKNLKLARKLMEQYGTPNNIDIWMGGVSEPLKHKGRVGPLLACIIGTQFRKLRDGDRFWWENEGVFSMQQRQALAQISLPRIICDNTGITTVSKNNIFMSNSYPRDFVNCSTLPALNLASWREA

Retrieve as FASTA  
Remarks Partial sequence from genomic (chromo 17, 11 introns) First methionine was missing in Scipio result, the codon just before was ACG. To be confirmed in ENSEMBL database (www.ensembl.org). No gorilla-EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGTTCCCTTCTTCTCTTCTCTCAGATGCATGGTGGACTTAGGACCTTGCTGGGCTGGGGGTCTCACTGCAGAGATGAAGCTGCTTCTGGCCCTAGCAGGGCTCCTGGCCATTCTG
GCCACGTCCCAGCCCTCTGAAGGTGCTGCTCCAG
GTAACAGTTCCCAAGGTGGGAGAAGATGGTGTGTTGGGGTGGTTGTGTTCCAGAGACCCCTTTTCTCAGAGCAGGCCTTCCTAGCT
CTGGGGCCTGATAGGGGGTTGGGGCCCATTCCTGACTTTGTGATCCCTGCTCTGGGCAGCTGTCCTGGGGGAGGTGGACACCTCGTTGGTGCTGAGCTGCATGGAGGAGGCCAAGCACCT
GGTGGACAAGGCCTACAAGGAGCGGCGGGAAAG
GTGGGGCACGAAGCACTGCCCAGCTCTGGGCAAGGATGTCCCAGGCCTTTCAGAGAAGCGGCAGGCAGCAGGGAGCTTGAAGGTGGG
AGAGGGGGACTATGGGGACCCATGTGGACTCCCTTTCTGTCTGTCTGTCCCTGTGTCTCTGGATGGGAGAACAGCTTAAAAGCCATCCTTCCCAAAGCCTTGCCTCTGTCTGGACACCCA
GGTCCATATCCTTTTTGTAAAAGGAAGCCTTCCTCCCACCCGTGGGCCTGCCTGCGTGGTCCTGCATGTCTGCCCCTGGGCTGGGGCTCTGCTGGGTGGGTCTGCATCCCTTCTCTGGCC
CTCACTCCTCCTTTCTCCAAGCAGCATCAAGCAGCGGCTTCGCAGTGGCTCAGCAAGCCCCATGGAACTCCTATCCTACTTCAAGCAGCCGGTGGCAGCCACCAGGACGGCGGTGAGGGC
TGCTGACTACCTGCACGTGGCTCTAGACCTGCTGGAGAGGAAGCTGCGGTCCCTGTGGCGAAGGCCATTCAATGTCACTG
GTACTGTTGCCCATCACACCCCAGGTCCCTGCTCCACTAG
TGACTCCTCCTAGGGACCCCAGCCGTCTCTCAGTGATCCCCTCAACTTCTTCCTCCAGGGAGTCTCAGGAGTCTCCAGGGCTCCTCAGCCTCAGGTTGCCTGGGATAGGAAGTGAGGCGG
CTCAGCTCCCCCATTGTTCTTTCCCCCGGCAGATGTGCTGACGCCCGCCCAGCTGAATGTGTTGTCCAAGTCAAGCGGCTGCGCCTACCAGGATGTGGGGGTGACTTGCCCGGAGCAGGA
CAAATACCGCACCATCACCGGGATGTGCAACAACAG
GTGCGGCTGGCTGGGGGTGGCTGCAGGAACCGGGCTCAGAGAGGCGTCCCGGACGCCACAAGCCTCCCGGTGTCAGCGCCCTGT
CCTCCCCTTGCAGACGCAGCCCCACCCTGGGGGCCTCCAACCGTGCCTTTGTGCGCTGGCTGCCGGCGGAGTATGAGGACGGCTTCTCTCTTCCCTACGGCTGGACGCCCGGGGTCAAGC
GCAACGGCTTCCCGGTGGCTCTG
GTGAGCGCCGGCGGGCAGAGGGGGCGAGGCCCGGCCACGCGGTGCGCGGACCCAGGCGCCGGCTGACCTCCGTGTCCCGCAGGCTCGCGCGGTCTCC
AACGAGATCGTGCGCTTCCCCACTGATCAGCTGACTCCGGACCAGGAGCGCTCACTCATGTTCATGCAGTGGGGCCAGCTGTTGGACCACGACCTCGACTTCACCCCTGAGCCGGCCGCC
CGGGCCTCCTTCGTCACTGGCGTCAACTGCGAGACCAGCTGCGTTCAGCAGCCGCCCTGCTTCCCGCTCAAG
GTGGCCCTGCTTCCCGCCCACTGCCTGGGTTGGGAGAGGGGAGATTGT
TTCTGGAAGGGGCCATCTCCCTTCTGTGCCCAGGTTTCCTTTCCCAGACGCTGAGGAAGGCTGGCCCTGCCTCCCTTGTGTCCACAGCACTGGCTGCTCAGCTATGACCTGTCTCCTTCC
TGCGCCTGGGCTCAGCCAGCTGGCAGCCAGGGCCGTCCATTTGCTCACTGCCTCTGGCAGGCCAAGGGAGAGAGGGTTGTTCCTCCTTGGCTGACAGGAGTCCTGTTGGTGGAATCACTG
GCTCTTTGTTAGGTTGGGAGAGGGTTCTGGGAGGAGACCTTCCCAGTGCCCCCCAAGCCTCCATGCTCAGTCCTGTTTCCGACCCACTGAGAGGGCAGCCCCAACCCCCATCACACAGAA
AGAGAGAGCCTGGGGGTCTGGTGGGTGCCGTGGGACAGGGCTGGGAGTGGGCAGGGTGGTCGAGGCACTGCTGAGTAGGGAAGGAGGAGGAGAGAAAGGAGAGAGCGCATGAGAGAGGGA
GAGACAGACAGGAGAATGTCAGGGCCAGAGGGAGAGCAGGCACAGCAGAGAGAAGGGAGAGAGACGGGCGACGCTTTAGTGAGGAGGGGTCCGAGGCCTGGCGGTGCCCAGACCCAGGGG
TTGCCCAGGTTCCCAGTTCAGTGTTCTGCTCATTAACCCTGCACCTCAGAGGCTGTTGCTGATGGCGCCCTAGGCAGCGATCCCTTTCGGGCCTCCAGAGGCCTCTCTGCAGGTTGAGGG
TACCAGAGGTCCTGAGGGCAGGGGGAGATCCAGTTCTGCCTGGGCACCTTCCCTGCCCTCGGTGAGCCAGTCTAGCCTCTCTCTGTGCCTCAGATCCCGCCCAATGACCCCCGCATCAAG
AACCAAGCCGACTGCATCCCGTTCTTCCGCTCCTGCCCGGCTTGCCCCGGGAGCAACATCACCATCCGCAACCAGATCAACGCGCTCACCTCCTTCGTGGACGCCAGCATGGTGTACGGC
AGCGAGGAGCCCCTGGCCAGGAACCTGCGCAACATGTCCAACCAGCTGGGGCTGCTGGCCGTCAACCAGCGCTTCCAAGACAACGGCCGGGCCCTGCTGCCCTTTGACAACCTGCACGAT
GACCCCTGTCTCCTCACCAACCGCTCAGCGCGCATCCCCTGCTTCCTGGCAG
GTCAGCTTTGGGGTGGGGACCAGAGGTGGCATAGGAGGTGTTCCCTGTTGGAGCCACAGTGAGTCTGT
TTGTGAGCAGCTTGTGGGTTTGTACTTAGAGAGACTGTCCTCACCAGCCATTACTATCAACTTCATGATATTAATCCAGTTGCCTTGGTAACAAGTCAGATGGAGCCAGAAAAGCAGAAA
AGCAAACAACCTCTCCAACCCTAAGATGGAGACCCAGGCATGGCTGAGGAGCCTCTGTCCATCAGTCCATTGCTTTCTCTGTCCCTCTTTTCCCTTCTGGACTCTGGAAGACAAGAGAGT
CAAATCCCTCAGGGGCAGGGAACTAAAGGACAGAGAACGCTGTGGTGCCCTCACCCTCTAGAGCGACACTATCCAATGTGATAGCCACTAGCTGCATGTGGCTATTTTAATTTTAGTTAT
TTTAAATTAAATAAACCCAGTTTCTCAGCGGTGCTAACCACATTTCAAGTGCTCAATTGCCTTACAGTCTAGTGGCTCCCCCTATTGGGTGGCACAGATGTAAAATATTTTCATCATCTC
GGAAGGTTGAGTTGGACCACACTGCTCCAAAATATCCCCTCCTGCACATCTTAATTACCCATAATAAGAGATGATGGCATTTTAAATGTAAATAATTGGCAGTTTTGGAGAAACAATTGG
GGCAGTGATGGCAGCCATGACCAGACATTTTCCAGTGTTTTTTTTTTTTTTTCTAAGATGGAATCTCACTCTGTCACCCAGGCTGGAGTACAGTGGCACAGTCTCGGCTCACTGCAACCT
CTGCCAACTGGGTTTAAGCGATTCTTCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGGCGCCTGCCACCACGCTTGGCTAATTTTTTGTATTTTTAGTAGAGATGGTGTTTTACCATG
TTGGCCAGGCTGGTCTCAAACTCCTGACCTCATGATCTGCCCACCTTAACCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCGCACCCAGCCATTTTCCAGTGTTTTTAAATGTAAA
CCCAATAGTGGACCTCAGGCCCTTTCCTCTGGCCTCTCTCTGCCTCCTCCTGATGGTTCCTGCTGGTCTCTCCCTGGCTGGGACCCTGGGAGGAGGATCCAGGTCGGACTTTCTGCAAGA
GATGCCCGACCTCTTCTGGGCTAGTTAGGCAAGGGCAGCCCTCCTTAGCCAGACTCAGCTGCCCCCAGCCTGGCTTTGATGAGCCCCATGTCCCAAGCCTGGGTCATTATGACCTCTAGC
TGTTCATGGATGGAGATGCTGCTCTCAGAGAATTTCCTTTCCACCAGCTTCTAGAGCTGGCAAGGACTGACCCTAGTGTCCTGACCCTAGCCCTCTGGCCCCTGCAGAGAAGGGTTCTGG
GAGGACTAGGGGAACCAGGGGGGATCTGCTTAGTTTTCTTGAACAGTCTCAGGTGTGGACTCCACATATCTCATGTCCTAGCCCCCTCCCCTGGGGCAGGCTGCACCATTGGCATGTAGT
AAAGGGCAGGGCTGACAACTCTGTTCAAACGGTAGTGGCTTTCTGGAGTCCTGTGTTGAGAAGGATTCTGAGGTTGCATCCAATTTTAGCAGGAAAGAGTGCTGTGATCGTTAGCTGCAT
CAGACATGGGCATGGATGTAGGCTGTGCCAACATGCATGCTTCTTCCCAGACACTCCTTGGAATCAAGAGAATCAATGAACCAAGCAGTGTTCATAAGTCTCATACTTTGTACCAGGCAC
TCTGTTAAGCCCCATGTATCCACATGTGTGCTAGGAGGGAGGGTAAAATATAAAAAGGCACAAGCCTTGGTCCTGTGCTCAAGGAGCTCCCAGTTTCAGGTACAGGAAAGTGGCATGTCG
TGTGTTGGAAGTGATACCTATTGAATGAGCATCCCCAACCAGCAGCGGCCCTGAGCTGAGGCAGAGGCAGAAGCTATCATTGTGGACTGGGGCATCAGGGCAGGCCTCCTAGAGGAGTAT
AAATTGGGGATGGTTTGAAAAGATGGATGAGGAGGAGGGGTGAGTAGGAGGCATTTCAGGCCTTGGCTGGGGAGGGGGTTTCAGTGGAGCAAATCTTTTCTGGGATGGAGGCCTTAAGAA
TGACAGTGGCTTTTGCCTCCCCAAGGGGACACCCGTTCCAGTGAGATGCCCGAGCTCACCTCCATGCACACCCTCTTACTTCGGGAGCACAACCGGCTGGCCACAGAGCTCAAGAGCCTG
AACCCTAGGTGGGATGGGGAGAGGCTCTACCAGGAAGCCCGGAAGATCGTGGGGGCCATGGTCCAG
GTAGGCCGCCTTGAACACCGGGCACACGGGATCCAGATGTGTCCCTGCAACATC
CTAGCTGTGTGACCTTGGGCAAGTTCCTAACGCTCCTGTGCCTTGCCTTCTTCATCCATGAGGCTGTAAGGATTATAATACATATATGAAAACACCTTTCAGATAGTAAGTGCTTGACAA
AGCCTCCTTCCCTTCCCTCTCCTTCTTCGCAGGTTTGCTCCCTGCAGTCTTCTTTCCTGTGGGTCTGTTATTGGTGTTGGGAGGGTTGAATGTTTGGTTTAGTGCCCGAGTAGCTGTTCA
GTAAATTCTTCTTCCCTCCATCTCACTGTCGCTCTTAGCTCCTTTATCCACTCACCTCTTCTTTTTAAAATTAAAAAAATTATAGGGCTGGGCGCGGTGGCTCATACCTGTAATCCCAGC
ACTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGGGTGACAGAGCGAGACTCCATCTCAAAATAAATAAATAAATAAAATAAAATTTAAAAATTATTATTATTATT
TTATTTTTATTTTTTGATACAGGGTCTTACCCTGTTGCCCAGGCTGGAGTGCAGTGGTGCGATCTTGGCTCACCGCAACCTCCACCTTTCAGGCTCAAGCCATTCTCCCATCTCAGCCTT
CTGAGTAGCTGGGATTTCAAGCACGGGCCACCACGCCCGGCTAATTTTTGTATTTTTTGTAGAGACGGGGTTTCGCCACGTTACCCAGTGTGGTCTCAAACTCCTGGGCTCAAGTAGTCT
GCCCTCCTCGACCTCCCAAATCCCTGGGATTACAGGCACGAGTCACTGTGTTCAGCCCACTCACCTCTTCTTTTTGGCTCTGTCATAATCCACCCAATGTCCTTAGCCTCATTTACCCCT
GGGGCAATGTTCCTGGTTCTGTCTCTCAACATCTGGTGCTTCATTGCCCCCACCCTCTCCCTCAGAGGCAGATGCAGACACACACACACTCCTAGATTCTGGAGGAGAGAGTTTTCGGTG
CTAAGGGTGAGTTTTTGATTTGCACTAAGAACTCAAGTGAAATTCATTTACACTCCAAAATAACTTCTAGACTCTAGAATGTAGAGTGAGACTATTCCATGTCTTCACTTTTCACAGGGA
AAATCATGCCAGAATGGCCCTTCATTCCTTCCTGCCTCCCTGCTTTCCACAAACCTAAACTGAGCCCTACTGTGGGCAGGCACTTGGTGGGCACTGTGAAGAATTTCAACAACTTCAATT
TCCCTTGCTCTCAAGGACTTTAGAAGATAGTTGCAGAAATGAGACATTAATAACTTGAGGACAAGGAAGTTATCACAATGACTAAAAAAGTGATTTGCTATTTAGTCCTCTAAGGCAGAG
GGCAATATAATTATCCTTAATGTACATTTGAGGAACTCAGGCTCAGAGAGGTTAATAACTGGTCCAAGGTCACCCAGCCAGCAAGCAGTAGAACTCTATTTATGCCTCTCAGTGCCACTC
TGTTAGGCCCAGGTCCGGTATTGTGGGAGGCTATTCCCTGACCATAGAGGGATGGGAGGGGTCCCCGAAGCCAAGAGCAGGCAGAGACTCTGGCCCTCCTGTGCTGCCAGGCGGCATTTG
CTGTGGAGGAGTGGGTGGAGAGGCCATTCCAAATGACTTGTCTTTAGATCATCACTTACCGGGACTACCTGCCCCTGGTGCTGGGGCCAACGGCCATGAGGAAGTACCTGCCCACGTACC
GTTCCTACAATGACTCAGTGGACCCACGCATCGCCAACGTCTTCACCAATGCCTTCCGCTATGGCCACACCCTCATCCAACCCTTCATGTTCCGCCTGGACAATCGGTACCAGCCCATGG
AACCCAACCCCCGTGTCCCCCTCAGCAGGGTCTTTTTTGCCTCCTGGAGGGTCGTGCTGGAAG
GTAAGCAGGACCTAGGCCAGGAGCGAGTGGGCTGACAGCTAAAGGTGGGGTAGGGAT
CACCTTGGCTCTAGGGAGCTAGGGTGGGGGGCAATCTGCTTTCCTCCCATCTTGGAGATCTGGTCTGACTCTCTAGCCTCAGTTCCTCTGACTCTGCTTCCATATCTGATAATAAACAGT
GGGGTGGGGATGGCCCTCGGAGGGAACTGGCTACTTCCTATGTGTTGTGGCTCGCTGCGACCCAGGAAGCCAGGGCCTGGGAGCATCCCAATCTTGCAAGTCTGAATGGCATAATCTCCT
GAGACCTATATGTCCCTGGGGTCATGTAGTGACTGGTGAGGACCTGCTCACTGGGGCCACCACCTTGGCACTAGGCACTGCATGTGCCCAGCCCTCTTCTCTAATCCTCCTGACCCTACC
TGGACTTGTCCCTGACTCCAATCTGAGCTCTGATACTGAGCCAGATACTTCCCCTGACCTGGCTCCTCTGGTCCCCAGGTGGCATTGACCCCATCCTCCGGGGCCTCATGGCCACCCCTG
CCAAGCTGAATCGTCAGAACCAAATTGCAGTGGATGAGATCCGGGAGCGATTGTTTGAGCAGGTCATGAGGATTGGGCTGGACCTGCCTGCTCTGAACATGCAGCGCAGCAGGGACCACG
GCCTCCCAG
GTGAGGGGCTGCAGGAGTCTCCCCTGAGGCTCACCTCCCCTGAGCTGCCTCCTAGGTAGCCCATCACTCCCCTTCCCACTCTAGGGTCCCTGCCCTCTCCAAAGCATATTA
GAGGCACTTTGCTCTCAGGAAGTAGCCTGAGGTCAGGGCCCTGCCTTCTCCCGGACCCACCTGATAAATTTCCAGCTCCTCTCAACCTCCTTTGCATGCTGTAATTCTCATATTAGGGGC
ATCGTCATCATAATGATAACCCACAGTCCGAAAATCTGTCTCTGTCATCATTCCATTTTGCTTCATTGTACGTTAACTCTGGGGGAAGAGATTATTGTTGCCTTCATTTTACTGATGAGG
AAACTGAGGCTTGATGAGATTCAGAACCTGGCCACGTTCTCTAGCCAAGTCAGTGGCAAAGCTGAAATTTGAAGCCAGATTAGCCTAACCCCAAAGCCTGTGCCTATGTTATGGGGTAGC
CCATGTGGCTGAGGCTTCTAGACACATTTCACCTCTCATGGGTCAGAGACAGACACATTGGGCTGCTCTGGAGGGGGACAAGGAGATGTCCCTATTCTTGGACCCAGCAGGAACTGTGGC
AGTTTAGGATTTGCCTTATGGTAGGAGGGCAAGAGAAAGACAGAGAGGGTCCCAGAGAGGCCCAGTTGTGCCCCTTGGTCTAAGCCAAAGGTACAGGGTTCCTTGAGGTGAGGTCCTTCC
CTCTCTCTATGACCTTGGTTGTGTTGGGAAGGTGGGTTTTCTGGGCTGCTGGCAGATATGTGAATCTTCCCTGCTGTCTCCAGTGACCTCCCCACCTTGAAGCAGAGGGACCTGCCCATA
GCCACCTGTCCCCTCCCCCATGCAGGATACAATGCCTGGAGGCGCTTCTGTGGGCTCCCGCAGCCTGAAACTGTGGGCCAGCTGGGCACGGTGCTGAAGAACCTGAAATTGGCGAGGAAA
CTGATGGAGCAGTATGGCACTCCCAACAACATCGACATCTGGATGGGCGGCGTGTCCGAGCCTCTGAAGCACAAAGGCCGCGTGGGCCCACTCCTCGCCTGCATCATCGGTACCCAGTTC
AGGAAGCTCCGGGATGGTGATCG
GTGAGGAGGGGCAGGCGTCGTGGGCCGCTGGGTGGCTGTGGGCCCATCCTTGACTCTCTTGGAGCCCAAATTTCCTCCCGTCAGTTGAAGGACTGGA
GGGAGTCAGTAATTTTCCAGTGTGTTCCAGGAATCCTCCAGATGCCCTGGAGTGCCCCTAATGTGCCCTGAACCTGTTGGGGGTGCAGCAAGGAGAGACCTGGACCCCTGGTTGTAAAGG
GAGGAAGATAGAAAAATGCCACCCTTAGCTACTTCTTCCTGTGGGTTTCACTGTGCCACCATGTGGGTGTCAGTCACCAGTGGGCAGTCCCCTCCCAGCTTTCCCACAGCTCCCCTTAGT
GTCATTTCCTCGTGGTCCTGACGTCTTCATGTCTAGTTCTTGCTTAGCCTGTATTGCACCTTTGGGAAAATTAGAAAAAGGTGCCTCTCTCCGGGTGGGCGAATTATAAACCACCCCCAA
GATTCTCTTCCACTCCTGTGGATGCAGCTCCTGGCCAGGGCACAGGGCTTCAGGAGTGTGTGTGGGCCCGGGTCCCCCTCCAGCATGGTGCCCTGGAGGCCGCCGGGCTAGGGGTAAGGG
AAAGGCCACTGGGCAGCTGTGCTTTACTCTGCACGATGAGTGGAGCATCACTTGTGTGAAAGCCCCTGGGCTGCCCAAGGGCCTGGGGCCCTCCTGTGCTGCCAGGTGGCATTTGTTGTG
GCTTTGTTATATCCTGGGAGCAGCACAAGCCCATCGATGCCCTGCCAGCCCAGAATATCCTTGGGCACAGTGTCCATGGGTGTTCCCCATGCAGGTTTTGGTGGGAGAACGAGGGTGTGT
TCAGCATGCAGCAGCGACAGGCCCTGGCCCAGATCTCATTGCCCCGGATCATCTGCGACAACACAGGCATCACCACCGTGTCTAAGAACAACATCTTCATGTCCAACTCATATCCCCGGG
ACTTTGTCAACTGCAGTACACTTCCTGCATTGAACCTGGCTTCCTGGAGGGAAGCCTCC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGTTCCCTTCTTCTCTTCTCTCAGATGCATGGTGGACTTAGGACCTTGCTGGGCTGGGGGTCTCACTGCAGAGATGAAGCTGCTTCTGGCCCTAGCAGGGCTCCTGGCCATTCTG
GCCACGTCCCAGCCCTCTGAAGGTGCTGCTCCAG
CTGTCCTGGGGGAGGTGGACACCTCGTTGGTGCTGAGCTGCATGGAGGAGGCCAAGCACCTGGTGGACAAGGCCTACAAGGAGCGG
CGGGAAAG
CATCAAGCAGCGGCTTCGCAGTGGCTCAGCAAGCCCCATGGAACTCCTATCCTACTTCAAGCAGCCGGTGGCAGCCACCAGGACGGCGGTGAGGGCTGCTGACTACCTGCAC
GTGGCTCTAGACCTGCTGGAGAGGAAGCTGCGGTCCCTGTGGCGAAGGCCATTCAATGTCACTG
ATGTGCTGACGCCCGCCCAGCTGAATGTGTTGTCCAAGTCAAGCGGCTGCGCCTAC
CAGGATGTGGGGGTGACTTGCCCGGAGCAGGACAAATACCGCACCATCACCGGGATGTGCAACAACAG
ACGCAGCCCCACCCTGGGGGCCTCCAACCGTGCCTTTGTGCGCTGGCTGCCG
GCGGAGTATGAGGACGGCTTCTCTCTTCCCTACGGCTGGACGCCCGGGGTCAAGCGCAACGGCTTCCCGGTGGCTCTG
GCTCGCGCGGTCTCCAACGAGATCGTGCGCTTCCCCACTGAT
CAGCTGACTCCGGACCAGGAGCGCTCACTCATGTTCATGCAGTGGGGCCAGCTGTTGGACCACGACCTCGACTTCACCCCTGAGCCGGCCGCCCGGGCCTCCTTCGTCACTGGCGTCAAC
TGCGAGACCAGCTGCGTTCAGCAGCCGCCCTGCTTCCCGCTCAAG
ATCCCGCCCAATGACCCCCGCATCAAGAACCAAGCCGACTGCATCCCGTTCTTCCGCTCCTGCCCGGCTTGCCCC
GGGAGCAACATCACCATCCGCAACCAGATCAACGCGCTCACCTCCTTCGTGGACGCCAGCATGGTGTACGGCAGCGAGGAGCCCCTGGCCAGGAACCTGCGCAACATGTCCAACCAGCTG
GGGCTGCTGGCCGTCAACCAGCGCTTCCAAGACAACGGCCGGGCCCTGCTGCCCTTTGACAACCTGCACGATGACCCCTGTCTCCTCACCAACCGCTCAGCGCGCATCCCCTGCTTCCTG
GCAG
GGGACACCCGTTCCAGTGAGATGCCCGAGCTCACCTCCATGCACACCCTCTTACTTCGGGAGCACAACCGGCTGGCCACAGAGCTCAAGAGCCTGAACCCTAGGTGGGATGGGGAG
AGGCTCTACCAGGAAGCCCGGAAGATCGTGGGGGCCATGGTCCAG
ATCATCACTTACCGGGACTACCTGCCCCTGGTGCTGGGGCCAACGGCCATGAGGAAGTACCTGCCCACGTACCGT
TCCTACAATGACTCAGTGGACCCACGCATCGCCAACGTCTTCACCAATGCCTTCCGCTATGGCCACACCCTCATCCAACCCTTCATGTTCCGCCTGGACAATCGGTACCAGCCCATGGAA
CCCAACCCCCGTGTCCCCCTCAGCAGGGTCTTTTTTGCCTCCTGGAGGGTCGTGCTGGAAG
GTGGCATTGACCCCATCCTCCGGGGCCTCATGGCCACCCCTGCCAAGCTGAATCGTCAG
AACCAAATTGCAGTGGATGAGATCCGGGAGCGATTGTTTGAGCAGGTCATGAGGATTGGGCTGGACCTGCCTGCTCTGAACATGCAGCGCAGCAGGGACCACGGCCTCCCAG
GATACAAT
GCCTGGAGGCGCTTCTGTGGGCTCCCGCAGCCTGAAACTGTGGGCCAGCTGGGCACGGTGCTGAAGAACCTGAAATTGGCGAGGAAACTGATGGAGCAGTATGGCACTCCCAACAACATC
GACATCTGGATGGGCGGCGTGTCCGAGCCTCTGAAGCACAAAGGCCGCGTGGGCCCACTCCTCGCCTGCATCATCGGTACCCAGTTCAGGAAGCTCCGGGATGGTGATCG
GTTTTGGTGG
GAGAACGAGGGTGTGTTCAGCATGCAGCAGCGACAGGCCCTGGCCCAGATCTCATTGCCCCGGATCATCTGCGACAACACAGGCATCACCACCGTGTCTAAGAACAACATCTTCATGTCC
AACTCATATCCCCGGGACTTTGTCAACTGCAGTACACTTCCTGCATTGAACCTGGCTTCCTGGAGGGAAGCCTCC

Retrieve as FASTA