Entry information : FcaMPO
Entry ID 7697
Creation 2010-11-12 (Marcel Zamocky)
Last sequence changes 2016-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-03-02 (Achraf Jemmat)
Peroxidase information: FcaMPO
Name FcaMPO
Class Myeloperoxidase    [Orthogroup: MPO001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Felidae Felis
Organism Felis catus (domestic cat)    [TaxId: 9685 ]
Cellular localisation N/D
Tissue type Bone marrow
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FcaMPO
start..stop
S start..stop
CfaMPO 1296 0 17..720 32..734
AImeMPO 1286 0 17..720 16..719
OgaMPO 1276 0 19..719 18..718
EcabMPO 1272 0 14..720 61..767
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 268..346 79 N° 2 476..569 94 N° 3 872..1047 176 N° 4 1260..1383 124
N° 5 1496..1625 130 N° 6 1711..1917 207 N° 7 2764..3082 319 N° 8 4921..5081 161
N° 9 6277..6532 256 N° 10 6978..7148 171 N° 11 7751..7988 238 N° 12 8752..8959 208
join(268..346,476..569,872..1047,1260..1383,1496..1625,1711..1917,2764..3082,492 1..5081,6277..6532,6978..7148,7751..7988,8752..8959)


exon

Literature and cross-references FcaMPO
Literature Pressler B.M., Anderson K.I. Sequence and partial characterization of feline myeloperoxidase. (Unpublished since 2008)

Protein ref. UniProtKB:   B1PSN8
DNA ref. GenBank:   NC_018736.2 (28233165..28242848)
mRNA ref. GenBank:   NM_001122746.2
Cluster/Prediction ref. Genebank:   100142673
Protein sequence: FcaMPO
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   721 (697)
PWM (Da):   %s   80611.65 (78184.2)  
PI (pH):   %s   9.12 (9.12) Peptide Signal:   %s   cut: 24 range:24-720
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLLLALAGLLLAILAVPQPSEGASPAVLEAVETSVVLTCMEEAKRLVDTAYKEQRESIKQRLRSGLASPMDLLSYFKQPVAATRTAVRAADYLHVALSLLEGKLRPLRPGTLNIDVLTPAQLNLLSKSSGCAYQDVGVTCPEKDKYRTITGQCNNRRSPTLGASNRAFARWLPAEYEDGFSLPFGWTPGVKRGGFPVPARAVSNAIVRFPTEQLTPDQERSLLFVQWGQLIDHDLDLSPDPGALASFITSVDCKTSCEQEPPCFPLKIPPDDPRIRNQRDCIPFFRSSPACTESNITIRNQINALTSFMDASMVYGSEDPLATKLRNLTNQLGLLAVNTRFSDNGRALLPFDNLHDDPCLLTNRSARIPCFLAGDPRSSEMPELASMHTLFLREHNRLATQLKRLNPGWDGERLYQEARKIVGAMVIITYRDYLPLVLGPQALRKYLPRYKSYNDSVDPRISNVFTNAFRYGHTLIQPFMIRLNNQYQPMGPNPRVPLSKVFFATWRVVLEGGIDPILRGLMATPAKLNRQNQIAVDEIRDRLFEQVMRIGLDLPALNMQRSRDHGLPGYNAWRRFCGLPQPRSVGELATVMKNLGLAQKLMQQYGTPDNIDIWMGGVAEPLEPNGRVGPLLACLIGTQFRKLRDGDRFWWENQGVFTRQQQRALAKISLPRIICDNTGITTVSKDNIFMSNTFPRDFVSCNTLPALDLTPWRQSD

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromosome E1). Breed="domestic shorthair". Note from GenBank mRNA file: nuclear gene encoding mitochondrial protein.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTGCTGCTGGCACTTGCAGGGCTCCTCTTGGCCATTCTGGCGGTGCCCCAGCCCTCTGAAGGTGCCAGTCCAGGTAACAGGGCAGAAAGAAGGGGAAAAGGTGGTGCGTTGGGG
GTGGTTGTGAGTCCCAAGGATCCCCTTCCTCAGCGCAGGCCACCCTGGGTGGCCCATTCCTGACTTATGTGACTCCTGTTCTGGACAGCTGTCCTGGAGGCAGTGGAGACCTCGGTGGTG
CTGACCTGCATGGAGGAGGCCAAGCGGCTAGTGGACACGGCCTACAAGGAACAGCGGGAGAG
GTGGGTTACTGGGCACTTCCCAGCTCTGGGCAAGGCTGCCCCAGGTCTTTCGGAGAAG
GAACTTGATGCGGGGACTTCGTGGGTATGGATGGGACCCTCCGTCTGCCTGTCAGTCTTTATGTCTTTGGGTTTGAGAACATCACTCCCCATGGCCTTGCCTCTGTCTGGACACCCAGGT
CCGTAGTCCGTTTATAAACAGAAACCTGCTTCCTGTCCGTGGGTCTGTCTCCACTGTCCTGCCGGCTCTGCTGAGTGTCTCTGCCCCCACCTTCTGTGGCCTCACTCCTCCCTTCTGCAA
ACAGCATCAAGCAGCGGCTTCGCAGTGGCTTGGCCAGCCCCATGGATCTCCTGTCCTACTTCAAGCAGCCGGTGGCAGCCACCAGGACAGCCGTGAGGGCTGCTGACTATCTGCATGTGG
CCCTAAGCCTGCTGGAGGGGAAGCTGCGGCCTCTGCGGCCAGGGACCCTCAACATCACCG
GTACCGTTGCCCCTACAACCTCAGTCTCCTGCTCTACTCGGGACCTCAGGCATCTCCCAG
TGCCCCCCCCGCCCCCCCCCCCCGTCTTCCCGGGGGGAGGCTCAGGCACATCTGAGTCTCCTCTCTGTGCCCCCAAATCAAGCCTCCCCAGCTTAGGATAGGAAATGGGGGGGAGGGACT
CAATTCCCACATCCCTCTTTCCCCGGCCTCAGACGTGCTGACACCCGCGCAGCTGAATCTTCTGTCCAAGTCCAGCGGCTGCGCCTACCAGGACGTGGGGGTGACGTGCCCCGAGAAAGA
CAAGTACCGCACCATCACCGGGCAGTGCAACAACAG
GTGCTGCTGGCTGGGGGCGGCCCCGGGGCGGGCGGCGGACGCGGGGTCGCGTCCGGGTCCCCCACCGGCCCGTGGCGCTACGTC
GTGTCAGCGCCCCGTCTGATCCCTGCAGACGCAGTCCCACGCTGGGGGCCTCCAACCGCGCCTTCGCGCGCTGGCTGCCGGCCGAGTACGAGGACGGCTTCTCTCTGCCCTTCGGCTGGA
CGCCCGGGGTCAAGCGCGGCGGCTTCCCGGTCCCCCTG
GTGAGCACCGGCCGACAGAGGGGGCGAGGCCGGGCCCAGAGGCGCGCGGGGCCCCAGGCGGCCCCTGACGCCCCGTGTCCCG
CAGGCGCGCGCCGTCTCCAACGCCATCGTGCGCTTCCCCACGGAGCAGCTGACCCCGGACCAGGAGCGCTCGCTGCTGTTCGTGCAGTGGGGCCAGCTGATCGACCACGACCTCGACTTG
AGCCCGGATCCCGGCGCCCTGGCGTCCTTCATCACTAGTGTCGACTGCAAGACCAGCTGCGAGCAGGAGCCTCCCTGCTTCCCGCTCAAG
GTGCTTCCTCCTTCCTGCCCCGCCGCTGCC
TGCCCGGTGGAGATAGGGGCCATCATTCCTGCAAGCGGCCACCTCCCTCTGTGCTGAACCCCTTCCCCAGCTCCTGAGTAAGGTTCACCCTGCTCACCCACTCCCCTCCGCCTCCCTGGC
GCAGGACCTTCCTGCCTCCCTCCAACCTCCGCGTGTAGGTGCGGCGTGTTCAGTCCCCCTTTCCTCTGACCAGAGAGGGGCACCTTCCCGCATCCGGGCACATTGCAAAGAGCCTGGGCT
GTCCATTGCTGGAGGGCTGGAGGGCTGGAGGGGAGTGGGAGAGGAGAGAAAGGAAGGAGAATGGCAGAGAGAGAGAGAGAGAGAGAAGAGGAGAGATAGGCAGGGGCCAGAGTGAAAGAC
GGGAAAAGGATGACGGGGAAGGGTGGGGGTGGGCAGGAAAAGAAAAGAAAAGAAAAAGCCAACTGCGAGTGTAGGGACTGCATCCAGAGAACAGGGGAGGGAGAGGCAGACTGGGGGAGA
GAAAGAGGGAGAGAAAGTTAAGGTGAGGACTGGCGGGCTCTTCTCCCGGGGGTGCACATCCCCCATTCCAGAGTCCTGGTCATCACCCCTTAGCTCAGAAGCACTCTGCAGGTGCAACCG
CAGACGGGGATCATCTGTGGGACTTGAGCGGCCTCCCTGCCGGCTGAGGGCGGCCAGAAGTCCTGAGGAACCCGCTGTGGTGTCTGGGTCTCCCTGTCTGGTCCTGGGTTCCAGGCTGCT
TTGGAGGTGGGATCAAGGCCTTGGGGTGGGGGGTGGACAGGGGGAGAGCCACTGTGTCCCTGCCCTTGGTGAGCGGGGCTTGTCTATGTGTCACAGATCCCACCAGATGACCCCCGCATC
AGGAACCAGCGTGACTGCATCCCCTTCTTCCGCTCCTCCCCAGCCTGCACAGAGAGCAACATCACCATCCGCAACCAGATCAATGCGCTCACCTCTTTCATGGACGCCAGCATGGTGTAT
GGCAGTGAGGACCCTTTGGCCACTAAGCTTCGAAACCTGACTAACCAGCTGGGGCTGCTGGCCGTCAACACCCGCTTCAGTGACAATGGTCGGGCCCTGCTGCCCTTTGACAACCTGCAT
GATGACCCCTGCCTCCTCACCAACCGCTCTGCGCGCATCCCCTGCTTCCTGGCAG
GTCAGCCTCGAGTAGGAACTTGGGCTGGTGCATGGGCACACCCTGCTGGGGGTGGGGGTGCTGTT
TGTGACTCTGTCCTCATCAACGTCATGATACTAATCCAGTTGCCTTGGTAACAAGTTGGGTGGAGCAAAAACCAAAACCAAAAAGCAGACCAACCCCTACCCCCAAACCAAAACCAACAA
AAAACAAAACCAAAAACAGAACAAACCTAAGAAGGAGACCCAGGGATAGCCAAGGAGCTTCTTTTCCATCTGTCCATCCCTTTCTACATCTCTCCCTTTCCCTCTGGACTCTGCCAGAGA
GTTGAGTCCCCAGGGACAGGGAACTAAGGCGACATGGCACCCTCACTCTCTAGAACTGCATCATCCACTATGGTAGCCACTGGCCACACATGGCTATTTGCATTTACATTTAAGTTAATT
AAAATGAACTTAAGTTAAATTAACTTAAAAGTAAAATTCAGTTCCTCTGCTGTACTAGCCACATTTCAAGCACTCAATAACTTCATAGGCTAGGGGCTCCCATATAGGGCAGCACAGATG
TAGAACATTTTCATCAATTCAGAAAGTTCTATGGGACAGTGCTGCTCCAGAATATCACCTCCTGCCATCTTGATTCCCTGTAATTAGAGAGGGTGAGATTTTAGATTTAAATACCTGGAA
GCCCTGGGGATATGGTTGGAGCAATAATGGTGCCCATGCCCAGAAACTTCCAATGTTTTTTAATGTAAATCCAATAGTGGATCCAAAAAGGTCCTGAGGCCCTTCCCTCTGGCCTCCCAA
CTTCTCCTGATGGCTGGCTCCCTGTGGCCTCTCCCCCACTGGTCCTGGGCAGGAGGATCCAGGTTGGCTCCTGTGAGACTTTTCTGGGCTAGTGAAGGAAGAGCAGCACTCCTCAGCGAC
CTATGGCTGCCTCCATCCTGGCGTTGAGCCACATGTCCTGGGTCTGGATCATCATGCGCTCTGGCAGCTCATGGGATGGTAAAGCTGCTCCCAGAGTTTCTTTCCCACCAGCCTCTAGAA
CTTATAAAGACTGAACCCAGTGTCCTGCTAAACGGGCCTGGTCCTAACTCTGGCCCTTCCAGAGAAGGCTTGGGGAGGACTGGAGGGATTAGGGGTCTCACTTGGTTTTCTCTTTTTTTT
TTTCTAACAGTCTCAGATGTGGACTGTAAAAATCTACCCCCCACCCCGTTCTCTGGAGCCCGAGCAGGCTGCAAATTAGCATGCAGTAAGGGCGAGGATGGCAACTCTGATCAGGTCGCT
AGTGGCTTTCTAGAGTCCTGTGTTAAGAAGGATTCTGAGGTTGCTTCCAATTTTAGCAGGAGAGAGTGCTGTGATCATTAGCTATGTCTGACATGGGCATGGAAGTAAGGAGTGCTAACA
TGCATGCTACGTTTTGGTCTGGCCTGAAGCAAGAGAATAAGTCAACCAAGCAATGTTTATGGATCTCCTACTTTGTAGAAGGCACTGTGTTAAACTCCATGTGTCTGTGTGTGAGTTGGG
TGGAGGGTCAGATACAAAAAGGGACAAGCCATGGTCTTCGTCTTCAAGGAGCTCCCAGTCTCAGGCATTAGAAGGTGGCAAGTCATGGGGCAGATCTGATGCCTATTGAATGAGCATCTC
CAAGCAGCAGTGCCCCTAAACAGAGGAAGAATTTATCATGGTGGACCAGGGCATCAAGGGGGAACCTCCTGGAGGAGATGTAAACTGAACATGGTGTGGAAAGATGAATGGAACAAAGTC
TGGGTTTCAGATCTTGGCTGGGGAGGGAGTCTTTGTGGAGCAAGTCCTTTCTGATGGGGTCTTAGGAATGACAGTAGCTTTTGCTTCCTCAAGGGGACCCCCGCTCAAGTGAGATGCCCG
AGCTCGCCTCCATGCACACACTCTTTTTGCGGGAGCACAACCGGCTGGCCACACAACTCAAGCGCCTGAACCCAGGCTGGGATGGAGAGAGGCTCTACCAAGAAGCTCGCAAGATCGTGG
GAGCCATGGTCCAG
GTATGCCGTCCTGAGTATTGATGATGCCAGGGATGTGGCAGGCTTGGGATGCAGATGTGCCTCTGCCACATCCTAGCTGTGTGACTTTGGGCCAGTGTTTTGAGTC
TCAACATATTCATCCACGACACTGTAAAGATTAAATGATATATATGAAACCACCTGGTGATACTGAGTGCCTGATGAAGGTTACTTGCCTTCCATCCTCTCTCTCCTAGGCTTGCTCCTA
TTTCTTCTTTCCTGTCCATTGGGATGGTTTTGGGAGAATTAAAGGGGTGGGTCTGAAGTGCCTGGCATGTAGCAGCTGGTCAATAAATGCCTCTCCTTTTCTCTCCGCGCCCCCCCCCCC
CGTCTCCTCTTCATTTGGCTCTATCATAGCTCACCCAATCTCCTCACCTTTATTTACCCCTGCAAAATGTTCCTGGTTCTCTCTCCCAACTTTTGATACTTCAACACCCCCATCCTCTCC
CCAAGATGTAAACACACACACACACACACACACACACACACACACACACCTGTGTGCATGCACGCACACACCTTTTCAATACTCTCAGACTCCAGAGAGGGAGAGAGTTGCAGGTGCTGA
GGGTAAGTTTTTGCTTTGCACCAAGAACTTAAGTGAGATTCATTTAAGCCTCACAGAAAATTCCAGACTCTAGAATCAAGAGTGAGACTGTTCCATATCTTCTCTTTTCACTGAGGAAAT
CATCTAGGGTGGCCCTTTTCTTTTTTGCCTCCCCCACCTCCACAAACATATGGAACCTTACTGTGAGCCAAGTGCTTGCTGGGCACTGAGTAATTTCCAGAGAAATGAGCTACAACCCTT
GTCCTCAGGAGCTTATAAATTAGGAGAAACAAAACATTAATAACTCAAGGGCAAAGGAGCTATTGACTAACAAAGCCCTTTGTTATTTAATCCTTTAAGTCACAGGGCAGCATAATTATC
CTTAATTTACATTTGAGCAACAGTGGCTCACAGAGGTTAATAACAGGCCCAAGGTCACACAGTAGGTAAGCAGTAGAGCTCTGTTTATAAGCCACCACTCAGGAGCCACTCTGTTGGACC
CAGGTCCAGTGCTGTGGGAGACAACCCTGGCCATAGTCAATGGAGGGGCTCCCCAAGCCAGGAGTGCAGGTGGAGACTCTGTAGAGAAGGTGGAGTGGAGAGGCCACTCTGAGCGTGACT
TTTCTTTAGATCATCACTTACCGGGACTACCTGCCCCTGGTGCTGGGACCACAGGCCCTGAGGAAGTACCTGCCGCGCTACAAATCCTACAATGACTCGGTGGACCCTCGAATCTCCAAT
GTCTTCACCAATGCCTTCCGCTATGGCCACACCCTCATCCAACCTTTCATGATCCGCCTGAATAACCAGTACCAGCCCATGGGGCCCAACCCCCGCGTTCCACTCAGCAAGGTCTTTTTT
GCTACCTGGAGAGTAGTGCTGGAAG
GTGAGCAGGACCTAGGCCAGGAGACAGTGGGCTGGCAGCTGAGGATGTGGTGGGGTGGGCTTGGCTGCAGGAAGCTAGGACAGGAGAAGTACTCT
GCCTTCCATCTTTGGGGATCCTATCTGACTTTCCAGCCTTGGTTCACCTGACTGCTTCTGTATATAATAACAAAGGGTGGGGTGGCTTGTAGGGAACTGGCTTCTTCTCGGTGACCCAGG
AGACCAGGGCCTGAGTGCATCCCAACTTGCAAGTCTGAATGGCATTATACCTTGAGACCTTGATTCCCTGGTGAAGACCTGCCCACTGGGGTGACCTTGGCACCAGGAGCTGCATGTGCC
CAGCCCTCTTCTGCGATCCCCCAACTGCACCTGGGACTTAACCCTGAGTCCAGTCTGAGCTCTGGATATGGAGCCAGATCCTTCCCCAAGTCTTGCTCCTCTTGTCCCAGGTGGTATTGA
TCCCATCCTTCGGGGCCTCATGGCCACCCCTGCCAAGCTGAATCGCCAGAACCAAATCGCGGTGGATGAGATCCGGGACCGGTTGTTTGAGCAGGTCATGAGGATCGGGCTGGACCTGCC
TGCCCTGAACATGCAGCGCAGCCGGGACCATGGCCTCCCAG
GTGAGGGGGCTGCAGGAGCTCCCCTGCCCCCCGACTCTCGAGCCCTGCCCTCTCCAGTGCCCCGCAGCTGCCCAAGCTT
GGCTGGAAAACTGTCTACATCACATTTCATTTTGCTTCATTTTACATGAACTTTGAGGGGAAGAGGTTATCATCACTTCCATTTTACTGATGAGCGAACTGAGGCTTGGAGAGCTTCAGA
ACCTTCCCAGGCTCTTCCCCAGCCAAATCAGGGATAGAGCTTGAATTTGAACCCAGGTCAGCCTAACCCCAAAGCCTGTGCCTACATTATGGGAAAGCTAGTGTGGCTGAACCTTCTAGA
CACACTTCAAACCTCAGATCTGAGATCTTCAGAGGGGGACAATGAGATGTCCCTATTCTTGGACCCTGTGGGAGTTCCGGGCAGTTTCGGGTTTCCCTCACAGTGGGAGGGCAAGGGAAA
GAGAAGAGTCTTGGCCCCTCAGTTCAGGGTTCTCTTGGGGCTTAGAGCCTGGGAGAAGCCCCTCCGTGGCCTCTCCCTCACGTCCCTCTGTATGTGGCCACGGCGTGTTGGGGAGGTGAG
TTTTGGGGAACCCACCCACAGCCCCCGCTTCCCGCCCCCGCAGGGTACAATGCCTGGCGGCGCTTCTGCGGGCTCCCGCAGCCCCGCTCGGTGGGCGAGCTGGCCACAGTGATGAAGAAC
CTAGGCCTGGCCCAGAAGCTGATGCAGCAGTACGGCACCCCCGACAACATTGACATCTGGATGGGCGGTGTGGCCGAGCCCCTGGAGCCCAACGGCCGCGTGGGCCCGCTCCTTGCCTGC
CTCATTGGGACCCAGTTCAGGAAGCTCCGAGACGGTGACCG
GTGAGGCATGGCGAGCAGTTCAGGCCCGCCGTGTGGTTGCAGGCCTATTCCCCAACCTCTCGGGGCCCTGACTTTCTCC
TGTGAAGTGAAGGGCAGGAAGGAATCCGTGACTTTCCAGTGTGTTCCGGGGCCTCCAGGTCATCCCTAAATGCGCCCTGAACTTGCTGGGGTACAGCAAGGAGGGGCCTGGAGCCGTGGG
TGTGAAGGGAGACATAGAAACTGCAAATCTTACCAATGCCTTCCCTGGTTTCAGGGTGCCACCATACAGCAGTCACTCACTGCTGAACGGTCTCCAAGCCTCTCCTACTAGTGTCGTTTC
ATCGTGGCCCTGACATGTGTCATACCCGGTTCTTACCTAGCCTGTATTGTGCCCTTGGGAAGATTAGAGAAAGGTGTCCCTCTCTGGGTGGACACATTATAAACCAACCCCAAGATTCTT
TCCACCCCCATGGTCACAGCCCTGGGCCAGGGCACAGGGGTCCGTGAGTGTGGGCCCAGCTCCCTGTGTAGCTGGGGGGCCTCCGAGGCCACGGGGTGGGGGGTGGAGGCAGAGGGGAGG
CAGCGGGGCAGCTGTGCTTTGTACTGTGAGGAGGGCACCACTCCTTTGAAAACCCCTGGGCTGCCTGAGGGCCTGGAGCCATCTCCTGCTGTGGAGCGGGTGTGTGTGCTGGTCCTCTTC
CATCCAGGGAGCAGCTCAAGCCCGATGATGCCTTCCCAGCCAAGGACAGCCTCAAGTGCAATGTCCCTGGGTGTCACCATGCAGGTTTTGGTGGGAGAACCAGGGCGTGTTCACCAGGCA
GCAGCAGCGGGCGCTGGCCAAGATCTCCTTGCCCCGCATCATCTGTGACAACACGGGCATCACCACCGTGTCCAAGGACAACATCTTCATGTCCAACACGTTCCCCCGGGACTTTGTCAG
CTGCAATACGCTCCCTGCATTGGACCTGACTCCCTGGAGGCAGAGTGACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTGCTGCTGGCACTTGCAGGGCTCCTCTTGGCCATTCTGGCGGTGCCCCAGCCCTCTGAAGGTGCCAGTCCAGCTGTCCTGGAGGCAGTGGAGACCTCGGTGGTGCTGACCTGC
ATGGAGGAGGCCAAGCGGCTAGTGGACACGGCCTACAAGGAACAGCGGGAGAG
CATCAAGCAGCGGCTTCGCAGTGGCTTGGCCAGCCCCATGGATCTCCTGTCCTACTTCAAGCAGCCG
GTGGCAGCCACCAGGACAGCCGTGAGGGCTGCTGACTATCTGCATGTGGCCCTAAGCCTGCTGGAGGGGAAGCTGCGGCCTCTGCGGCCAGGGACCCTCAACATCACCG
ACGTGCTGACA
CCCGCGCAGCTGAATCTTCTGTCCAAGTCCAGCGGCTGCGCCTACCAGGACGTGGGGGTGACGTGCCCCGAGAAAGACAAGTACCGCACCATCACCGGGCAGTGCAACAACAG
ACGCAGT
CCCACGCTGGGGGCCTCCAACCGCGCCTTCGCGCGCTGGCTGCCGGCCGAGTACGAGGACGGCTTCTCTCTGCCCTTCGGCTGGACGCCCGGGGTCAAGCGCGGCGGCTTCCCGGTCCCC
CTG
GCGCGCGCCGTCTCCAACGCCATCGTGCGCTTCCCCACGGAGCAGCTGACCCCGGACCAGGAGCGCTCGCTGCTGTTCGTGCAGTGGGGCCAGCTGATCGACCACGACCTCGACTTG
AGCCCGGATCCCGGCGCCCTGGCGTCCTTCATCACTAGTGTCGACTGCAAGACCAGCTGCGAGCAGGAGCCTCCCTGCTTCCCGCTCAAG
ATCCCACCAGATGACCCCCGCATCAGGAAC
CAGCGTGACTGCATCCCCTTCTTCCGCTCCTCCCCAGCCTGCACAGAGAGCAACATCACCATCCGCAACCAGATCAATGCGCTCACCTCTTTCATGGACGCCAGCATGGTGTATGGCAGT
GAGGACCCTTTGGCCACTAAGCTTCGAAACCTGACTAACCAGCTGGGGCTGCTGGCCGTCAACACCCGCTTCAGTGACAATGGTCGGGCCCTGCTGCCCTTTGACAACCTGCATGATGAC
CCCTGCCTCCTCACCAACCGCTCTGCGCGCATCCCCTGCTTCCTGGCAG
GGGACCCCCGCTCAAGTGAGATGCCCGAGCTCGCCTCCATGCACACACTCTTTTTGCGGGAGCACAACCGG
CTGGCCACACAACTCAAGCGCCTGAACCCAGGCTGGGATGGAGAGAGGCTCTACCAAGAAGCTCGCAAGATCGTGGGAGCCATGGTCCAG
ATCATCACTTACCGGGACTACCTGCCCCTG
GTGCTGGGACCACAGGCCCTGAGGAAGTACCTGCCGCGCTACAAATCCTACAATGACTCGGTGGACCCTCGAATCTCCAATGTCTTCACCAATGCCTTCCGCTATGGCCACACCCTCATC
CAACCTTTCATGATCCGCCTGAATAACCAGTACCAGCCCATGGGGCCCAACCCCCGCGTTCCACTCAGCAAGGTCTTTTTTGCTACCTGGAGAGTAGTGCTGGAAG
GTGGTATTGATCCC
ATCCTTCGGGGCCTCATGGCCACCCCTGCCAAGCTGAATCGCCAGAACCAAATCGCGGTGGATGAGATCCGGGACCGGTTGTTTGAGCAGGTCATGAGGATCGGGCTGGACCTGCCTGCC
CTGAACATGCAGCGCAGCCGGGACCATGGCCTCCCAG
GGTACAATGCCTGGCGGCGCTTCTGCGGGCTCCCGCAGCCCCGCTCGGTGGGCGAGCTGGCCACAGTGATGAAGAACCTAGGC
CTGGCCCAGAAGCTGATGCAGCAGTACGGCACCCCCGACAACATTGACATCTGGATGGGCGGTGTGGCCGAGCCCCTGGAGCCCAACGGCCGCGTGGGCCCGCTCCTTGCCTGCCTCATT
GGGACCCAGTTCAGGAAGCTCCGAGACGGTGACCG
GTTTTGGTGGGAGAACCAGGGCGTGTTCACCAGGCAGCAGCAGCGGGCGCTGGCCAAGATCTCCTTGCCCCGCATCATCTGTGAC
AACACGGGCATCACCACCGTGTCCAAGGACAACATCTTCATGTCCAACACGTTCCCCCGGGACTTTGTCAGCTGCAATACGCTCCCTGCATTGGACCTGACTCCCTGGAGGCAGAGTGAC
TAG

Retrieve as FASTA