Entry information : KflPrx01 ( kfl00004_0140)
Entry ID 7730
Creation 2010-11-04 (Qiang Li)
Last sequence changes 2014-08-20 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-07 (Christophe Dunand)
Peroxidase information: KflPrx01 ( kfl00004_0140)
Name (synonym) KflPrx01 ( kfl00004_0140)
Class Class III peroxidase    [Orthogroup: Prx225]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflPrx01
start..stop
S start..stop
KflPrx02 262 2e-86 23..263 27..269
GhPrx01 144 6e-41 63..314 39..308
GmPrx173 143 1e-40 63..324 34..316
GrPrx01 142 2e-40 63..314 39..308
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..69 69 N° 2 551..653 103 N° 3 1174..1269 96 N° 4 1752..1822 71
N° 5 2177..2239 63 N° 6 2720..2839 120 N° 7 5956..6010 55 N° 8 6357..6435 79
N° 9 6849..6972 124 N° 10 7395..7474 80 N° 11 8081..8216 136  
join(1..69,551..653,1174..1269,1752..1822,2177..2239,2720..2839,5956..6010,6357. .6435,6849..6972,7395..7474,8081..8216)


exon

Literature and cross-references KflPrx01 ( kfl00004_0140)
Literature Timme,R.E., Bachvaroff,T.R. and Delwiche,C.F. Broad phylogenomic sampling and the sister lineage of land plants. PLoS ONE 7 (1), e29696 (2012).
EST ref. GenBank:   HO437950.1 [Fragment]
Cluster/Prediction ref. klebsormidium DB:   kfl00004_0140
Protein sequence: KflPrx01 ( kfl00004_0140)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (305)
PWM (Da):   %s   35549.93 (32707.4)  
PI (pH):   %s   4.89 (4.64) Peptide Signal:   %s   cut: 27 range:27-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPWTGARFLWLASLLAALTFPQTKAFDLTTGQLFNFAPLPTGSLPNEPLFTPDLRACVFANIQRSLSNLTLSDSQTNARFLRLIFHDCASGGCNGSIMKLQEQKAFVNTFLGYDKVQIVKAAADAACGSNLSYADTIVAGAFIGVYLSGGPNVTQYVRLGRADTDGLDDPERLPSAFTLNDDLIKTFAVLGLNVEELVALSGAHTLGKATCANVTPRIGGDPYADPQFLYGLTNQCRTLLQQLSMDLSPTQFDTSYYVMQTGKGILQTDEGLYAENTTRAYTQLFASNQTEFFSSFAVGLLKMSLIGLRPPSVSNVSAGLDRTSEFGA

Retrieve as FASTA  
Remarks Complete sequence from 1 EST and genomic (10 introns). Incorrect prediction from Klebsormidium DB (extra last short exon)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCTTGGACCGGAGCTAGATTTTTATGGCTGGCCTCCTTATTGGCAGCACTGACATTCCCACAGGTAAGGGGAGTTGCTTATCAACAGGACGAGTTTTCGATTTTTTGCGCCGAG
TACAAGTTGTTTCCGCTGCTTCACATGGATATTCGTTGAAACTGTGCAAGATGGGCATAGTGGGGGACTTTACTTACGGGTGTGAAATGATAGGCAATCGCCATGCACTTTTCTGGTGCA
TGCGGTCCTGTTTGCCTGGCAACTGATCAATCGAGAATCTGGGGAGTCCCCTCCTGAAGACTTAGCTGAGGTGGTCATTGCGATTGTTCGTGAAGCTGCAGTGTTTGGAAACTTGAACGG
CTTGTGCATCTTATCTAGGTCGTGCAAGAGCATCACGTTATCATATTACAGTGAGTGGGGAAAGGATAGAAGGTACATTTGATAAATGAGGAATCCCCTTCCGACTTCTTGGAAACGGAA
TATGGCTATCCAAAGCACCACGCGTGGATCCAACAGAGCCCCAAAAGTTTGCCTTTACTTCCTTGTGCAGACCAAAGCGTTTGACCTGACAACCGGACAATTGTTTAATTTTGCCCCTCT
CCCAACGGGGAGCCTTCCAAACGAGCCCCTCTTCACCCCAGATCTACGAGCAT
GTGAGTCGGCTTGTTTCCCATCATTCGGCTTTAAAGTTTGGATAGTTCTGCCCTGGAGGCGCACGAG
TACGATTCATATCTGCTCAAAAGCTTGCCAAGAGACAGAAAGTGAAGCACTGGTAGTCCCCCATGCCACTTCCCTTGCTTTCATGGGTTGGAACTCGATGAATCTGTGGGTTTTGACGCC
GAGGTTATCTGTGAGGCAAGAGATTTTCTTACTACCGCAGGAGATTGTCGTCTTTGCCGAGGTCAGTTGTACATCCAGAAAGTTTGCCAACATCTTTTCAGTCGCACCATGTACGTTCCA
TTTGATCTTAAGCATTGCTGCGCCTTCTCAGGAAACGAATATCCCAAGGTCTCTCTCCAGCGGCGCACATCCTTTGTGATGTGACTGATTTTTCTGCAAAATTGGTGATCACGTGCTTTT
CAGAGCGACCGCTAGAGCGAAGCTTCGGCGAAAGGCAGGTTCACTCAGTAGGTCTTCCGTGCCATCTTAACCTCTTTTCACCCGTTTTTGCAGGTGTTTTTGCAAACATCCAAAGGAGCC
TATCCAACCTGACACTGTCAGACTCCCAAACCAACGCAAGGTTCTTGAGATTGATCTTCCATGACTGCG
GTAGGTTCCGAGCTCTGGTTCCAAAATCACCCCATTGCACTAAACTCCCTG
TACAGCCTTCCGTTTGCTGACCAGTAATACTCTCGGGGCTGCTTCTGGTCGGGTCCTGTGAGCGAGTGCAGGGGCATGCACGGCCTCCAAAATCACACATCTTGGTCGCTTCAATTGCTT
ATCGCAATTCATCTAGCAAAGGATCTACAACTCGTGTGAGTCGAAGTGCATACGTGGCCTCAGGTTGATTTGGTAGATATGCTGCTTGATCTTCTGCCTGGTCCTTGCTTCTCAGTAAAG
TCCCAGCGACTCGAGAGCACTTGTTGGCTTGAACAATCGTAGCAATCGTGAATCGTCACTCAGTGGCACCTGCTTGAGCCCTATGTTGCGAAGAGCCAGGATCTGGGAAGGCTTTGTAGA
GTGTAAATATTGCTGACACCCCCTGACAATGATGCGACTTCGAAATGGCACGTGTCATCATCTCTTTGCAGCATCGGGCGGGTGCAACGGGTCGATCATGAAGCTACAAGAACAGAAGGC
CTTTGTCAACACTTTCCTGTCG
GTAAGTGTGCCCACTGACCGGAATACATGGTTGATTTGGTCTTCAGCTGCACGATTCAAGCGCAGGCCTGTGTCTTATGCCAGCGGTCGGGTTCCGTT
TAATTTCCCGCTAGTAAGTTTGGGATAGGCATATGGATTCGTCACTGGTGTGGAAGTCCTTCTCTGGAAATCTCTGCTCTTGTAAGTTGACAGGCGATCTTGTCAGCCGTTCAATGCGTG
ACCTAGTATGCGCAGTGACTTCTGCTTTGTACGCTCGCCGCTTGTCTCTCCCAAGGCTTTCGTTGTGACTGCTCTATTCCAAACGCCGCGAAAATCAGGCCTCAGGCTGACCACATTTCA
AGTGGCTCTTTTTCAGGGTTACGACAAGGTCCAGATCGTCAAAGCTGCAGCGGACGCCGCCTGTGGCTCCAACCTGTCTGTAAGTCTCTTCTCCAACGTCCGATATTAAAACTGTCCGTG
GAACGAATCTGAAGAAGCCGGTTGAGCGATATTGCGAGGTGATGGTATTGTGAGATGATAGTAGAAGGAGTCAGGTATTTTGTTGCTGATTCCTGGCAGGGTTGGAGTGCGTTTTGCGTG
CCTGCGGTTCAGCGTGATTCATCTTGGCGAGTTTCCGCTACGTTGTTGGTCGGGCACAAGTTCGCTCAGGCAAGGAGGTTGATCCTGCGCAATTGCCGTATGACAGACACCAACGAATCC
TTCATTTCAGGTCTCTCACCATTTCATGGGGACACCTTCTCAAAAGTCGGTCATCTGGTTCTTGACCAGGACTTTTTCCGGATGTCTCTAAACGAGGAGCAAATGAGATTCATACGCACC
GGAGACTCCTGTCTTGAGTGTTTTTGAAATCGTTTTCAGAGTACACACTCACTCTTGTGTCTCCTTTTCTTTCGGACAGTATGCGGACACAATCGTTGCTGGGGCGTTCATTGGGGTGTA
CTTGTCCGGTGGTCCGAACGTCACGCAGTACGTCAGGCTGGGGAGAGCTGACACCGACGGGTTGGACGACCCGGAGAGG
GTGAGCGCTCCGATGAAAACGTCTGATTGTTCAGTCCTGTT
TCTCGCTAGCGGCCTTTGATCATTTGATGTGGATTGTTATCCACGTACTTGTATCCAACGCTGATTGGAGAGCTAAGCCCCATGCCTTTGATGGACACGGGCTGTGGATGAGGATTTCCC
AGCTAGGCTTCGTGTAGATTCCGTCCTTTGATGCGGCCGCTGTGCAATGGCGTCGCAAGGCATTTGACTTGTCGCCTCATTCTCTTTAAGCTTAGCTGGAGCCGTGGTCGCTCTTTGCTT
GCTAGCTCAGGGTTCCCCTTTATTTCTGTATCTCCTTCTGCTTCCGATTATCTTTCCTTCTTTGTCGTCTTCTGCTTCGCGAGCCGTTACACTTCATTGCCTCTTTTCAAGTTTTCTGTT
GGGCAACGTCCCTTTCTTGCATAAAACAGCAAGGATCCGGCTTTTATGTCTACCTGAGGGTATGCCCGCTTGAGCGTGACGAAAGCATTTTCTGCTCCCCCGTGTTGGAACTCTAAAAAA
TTGCGATCTATCAATCGACGGGAAGCACTGTAACGCGAGTTCGTCAATTTTTGCATTTGCCAGCCAGCTGTCAAAGTTTTTATCAACGGGTGCTGTCGGATTATGAAGTCCGTTCAACTC
AGTCGTCTGGTTGCGGCAGAGACAATGCTATCATCGATATAGAGACTTTCTCATTATTTGCGGTGCTTGTACGTCATGCTGGACCGCCAAGATGGTCGGGTGCTTATTTTGGCTAATGGT
TTAGAGTACGTCCCACGCTCCGTGCCTTGTTTTGTTGCTGAACCGCCTGCGTCTAGGTCGACTCTCAGCGGTTATGAGCACTACTGGTTATGACGACTTCCTGCACAATCTTGGCGCCTG
AGCTTGGCCTCTTTCCCCCGAAGGCTATTTGGATTTGGCACCACCTTTTGAGCTTCTGCTTCCTTATACTACTAGTTGAACGAGGAAGGGTGGAGGTACGTTGCTTTACAAACAGGCCAC
GAGATTTATAATGGATTGTAATCGAGGAGTGGAAGTTCAAGCTAGAGCAGCGGTTGGCGTCTGCAATGTTGAGTTGTGCGTTTGTTTTCAACAACATCAACTATGGGAGCTTACATCTAA
TGTCGAGATACTATGCAGATGTGGCACGGGCACTGAGGATCTAAAGCGCCGAGCTCTCCTGCGAAGGGAGTTTACGGCTTGTTTTTCTGAGCCGCTTTTTTGTAACGCTTAATTCCTTGA
CGTCCTTAAAAGGCGAAGGTGTCGAACAAGCGAGTCCCAGCGTAATGGTTCGGGGACCTTTTGTTCTCATCCAAAGCCCGAGTCACGCTGGTCGTCGATCTGAAATGTTCCACTGAAAAT
CTTGAGGCCTTCGAACGATTTCCCATTCGATTCTTTGCCCAGGAAAAGCTGCCAATAGTAAGTGGTAATGAACGTCGGTTCTTATCGGACATCAACGGCGTGTTATTCCAGATGGCACTG
TAGCAGCAGCGACGTAGGCTAAGGCTAGGAGGATTGAGTGTGTGGGCTGATTCAGTTCCATACATCCTTCTAATGATCCTGAGCCAGCGTGCATACAGAATGTTGCAGTCTCCTTATCTC
TCGTATCTTTGCAACCCACTTCGCAACCTGAGCGTCGAATACTGCCGACTCAACGGTATTGGACCGATGGTGCACGGGCTATGAGCATCTAGCAAGTTGTCTCGCTTGTTGAGACACAGT
TTTTGATCTACGCAAGCCTGATACTAAGATACTGACTCAGTTGGATTGGGGCTCACAATCACCCACTGTTGGCTTTATTCAGAGCGTGATATACGGAAACAAGGAGGTGCATAGGAAAAG
ACACGTTGCAGCGTTAGGCTGGCTTGAAGTGTCGCTTCAAGGGAGCTTCTTGGCGGACCTTTTTTCGCTTCTGATAGCGTGCTCGACGCGTTTCTCTTCTGAGCAACTCTTCCTTCCATA
GGTCGTTTTGTGCGGTTGATTGGTATTTCAAGGCACTCATTCCCTCATCAGGGTGTCGCTTTTGATATGGTGAATGTTCCTGGCTGCACAAGTCCATTTTGACAGTACTGGGGGTTGGTA
CGTTCAAGCACTTGGGTCAGGGGGCTCGTACGCTCTGGTTTGCATTCTGGAACAGCCTTGTGTTGAACTTTGTCTCGATGCAAGTCTTTTCTCAGCGATGTTTTGATTTCAACGGCAGTT
TGTCTCGAGCCATGCCTGTCTTGAGGTCTCGTGTGCTCCCTTCAGACTTCAATCATGCAATTCGTTGTTGTGAGTTGAGCATCTGAAAATCGCTTTGTTTGAAGATTTTCAGTATGTGGT
CATGGAATTTGCCTCGGTCTACTTCCTCATCTGTGCCCTCATTTGCTGGGCCAGTGACGCAGGGATTGGATTTTCGGAACGTTCAAACGGCTCAGGGTGGCACTTCCGCTCCCTACAAGA
GCATTCTCCACCCTATTCCGTTCCTCAAATGGGAAGCTTGCTTATCGTCGCTATTGCAGTTTCTGCTGATCATCCGAGTCAACGAGGCGCTTTCTCACGATGCCAGCTTCTTTGTAAAGA
GGATTGCTCCTGTACTTTAAGCTACTGTAGGTGGATTCGGGTCCTTACTTTCAACAGTGGCAGAGACTTCCATGTGCATTCGATATTGGAATACTCAAAAGCTGTGAAGCAAATAGTCCC
GTTTGAACGCCACTCCTGGTCGTCACAGCCAGCAAGAAGGCAATGAAGCTGTCAACGTTGACATCTGTTGTTGGGGCACCATCGAGCCACGTACCGACGTAGTTTTTTTCGATTTTGAGA
AACCAGACTTCTTTTACTGTTTCCTGTGATGTGTCCTTGGTCCAGCTTGCGGATTTTTGACATTTTCTTTGCCGGTCTCCAAACATCGATGTCCTCCCAGGGATGTTTCAACGTTGGGGT
TCGATCCTTTATGATGTTATTCATGGCGTGTAAGGACCGGCGACTATTCTAAGATGATACGCAAGATGGTAAGCACATCAATGGAACGCACAGTGTCAATATTCTGTTCTGCAGAGGGTT
GTGCTGCGGCACACACAGTCCTCTTGCAATGCTTTGATGCAGAACATCTGGTTGACAAATTCTCCCTGCTTACAGCTGCCGTCGGCGTTTACCTTGAACGACGACCTGATCAAGACCTTT
GCCGTGCTCG
GTAAGCTGTGCGGATATCTTAGGATGTCTCTTGATGCCGGTTTGACTCGAGAATTCGCAGTCCTTCGAGACATTCGTACAACGCTTGACCTTCTGAAACCACGATCTTGG
GGGCCGCGATTGCTAGCTTGATTTTGAGCCTCCCTTGAACCCTCCAGAAAGTCACTCAAAAAACGCCGCAGGATTTGCACTTATGACAGGTAATCTTGAGCTTCTTCCTCAATTGAGGAC
TGACAGCATGCAAAAGGCTTGTTTGGTAAAAGTCGGCTATGCTTCGATGCTCTGAGCACGGCAGACTTGGCCCTTGTGGTGCCCTTTTTCAAACGCGTTTTTCGGCGTTTCTGCAGGTTT
GAATGTGGAGGAGTTGGTCGCCCTCTCCGGGGCCCACACGCTCGGGAAGGCGACGTGCGCCAATGTCACGCCAAG
GTGAGGCGGTTCATGACACGTTGCTGGACGATCTAGGGGGCCCAA
CGAATCGAGGTGTCACAAAAAGAACACGTTTTCTTTTGAATCGCAGTTGTTTTCCTTTTCGAATGACTGGCATAGCCTTTCAGGACCGAGGGCGGCCGTTTCTGCTTGCGAAATAGTTTT
GTTAAGCCGCCCCACTCATCGTTCGACGGGACGCTCATACTTTTTTCTCCCGCAGACTCGTAGCATCATTTCGCGCTTCACAAGTTGCTTATCAAGTCGCCTTTTTGGTAATCAAACCGA
AAGCACTTACATTCAACTTCAGATCGCCCCTTTCAGCGTTTTTCTTGATCACGCAGTGGTTATCCAGACGTCTCTTTGCGCGGAATCCCGTGAGAGCATTTGTTTAGCAGATTTTCTGGT
CTGTGCAGGATCGGCGGGGACCCATATGCGGACCCACAGTTTCTGTACGGCCTGACCAACCAGTGCCGGACGTTGCTGCAACAGCTGTCCATGGACCTGTCGCCGACCCAGTTCGACACC
AGCTACTACAAG
GTAAGCTATGTTTAAGAAAGTCTTTGTTGTTGTTTACCTGCTCTTGGAGCTAAGCGTGACAGAAGGGGCGCCGGATTTGAAGTTGTATTTGCCTTCCATTTGACATCG
TAATGAAGCCTGATGTTTGCAAAGCTTCTGCGTCGGCGAATAGTGTGTACTAAAAGCTGACCAAGTAGAGATGAGTCAGTGTACGGACGTGTACGTCGCCTTGAGCAGCGGTGGTGCAGG
GGTTCTGGATTTCAGCAAGCTACGTGCTGCTTGGAATGGGCGAACTTACGAGACCTTATCAGAGATTGAATCTTTAGACAGAGCCCATTCTTTCGTCCGGTCAAGCATCAAAAGCTCTCT
GAAGGCCGGTAGACTATTCTGACCGACCAATCGTCTCTTCGGTTGACGAGGCCTCTGCTCTTGCTCACTTTCAGGTGATGCAAACCGGGAAAGGCATCCTGCAGACCGACGAGGGCCTCT
ACGCCGAAAATACAACCAGGGCATACACCCAATT
GTAAGTATCCGGCGCGAGCTGTCGTTCAGAAGCTTCCTACATCTCCTTTCCATTGTCGATGTATTCTGATTTCGGCAGCGGGGATT
TGCGGAAGATTGTTTTGCGCCAGTCCAATCCTTTCACCCGCTCACTTGGATTGTGGAGCCGTTCCGTGGCATATTATCGCCGAGTTGTAATGGCCAGAGTACCGAAAGGGCCACAGAATC
GGTTCAATCAAGCAGATACAGCAAGCTTTTCTAATCCGCTAAATGGCAAGCCGCTCAAAGAGGTTCTTCAGCGAGTTCCACGTCCCAAGCGAGCAGTACTGCGTCCGCCTCCCTTGTCAC
TTCTGTTGTCAAACCGACGAAATGGGTGCCGCGTTTGAGTTTCCACCGAAGCCTGACTGTCGCGCTCGAACAGTGAATGAGTACCCTTTGCCCTCTCAATCTTTCGGAGACTAGCGCTTT
TCACTGCGCTGGAAAGAAAGGTCTTTTCTTGTGTTGATCTGTAACCTAGCACTAGCCACACCGAGTTTCAGATTTCTTTGTACGGTTCATGTTGATCTGACCGAAGCTGACACTCGAAAA
TTGCAGGCCTGACGCTGAGCAAGTGCTGGTTATGCTGCAGGTTTGCCAGCAACCAGACCGAGTTTTTTAGCTCCTTTGCGGTAGGGCTCCTCAAAATGAGCCTTATCGGTTTGCGGCCGC
CCAGCGTATCCAACGTCTCGGCGGGGCTGGATCGAACAAGTGAGTTCGGTGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCTTGGACCGGAGCTAGATTTTTATGGCTGGCCTCCTTATTGGCAGCACTGACATTCCCACAGACCAAAGCGTTTGACCTGACAACCGGACAATTGTTTAATTTTGCCCCTCTC
CCAACGGGGAGCCTTCCAAACGAGCCCCTCTTCACCCCAGATCTACGAGCAT
GTGTTTTTGCAAACATCCAAAGGAGCCTATCCAACCTGACACTGTCAGACTCCCAAACCAACGCAAGG
TTCTTGAGATTGATCTTCCATGACTGCG
CATCGGGCGGGTGCAACGGGTCGATCATGAAGCTACAAGAACAGAAGGCCTTTGTCAACACTTTCCTGTCGGGTTACGACAAGGTCCAGATC
GTCAAAGCTGCAGCGGACGCCGCCTGTGGCTCCAACCTGTCT
TATGCGGACACAATCGTTGCTGGGGCGTTCATTGGGGTGTACTTGTCCGGTGGTCCGAACGTCACGCAGTACGTCAGG
CTGGGGAGAGCTGACACCGACGGGTTGGACGACCCGGAGAGG
CTGCCGTCGGCGTTTACCTTGAACGACGACCTGATCAAGACCTTTGCCGTGCTCGGTTTGAATGTGGAGGAGTTGGTC
GCCCTCTCCGGGGCCCACACGCTCGGGAAGGCGACGTGCGCCAATGTCACGCCAAG
GATCGGCGGGGACCCATATGCGGACCCACAGTTTCTGTACGGCCTGACCAACCAGTGCCGGACG
TTGCTGCAACAGCTGTCCATGGACCTGTCGCCGACCCAGTTCGACACCAGCTACTACAAG
GTGATGCAAACCGGGAAAGGCATCCTGCAGACCGACGAGGGCCTCTACGCCGAAAATACA
ACCAGGGCATACACCCAATT
GTTTGCCAGCAACCAGACCGAGTTTTTTAGCTCCTTTGCGGTAGGGCTCCTCAAAATGAGCCTTATCGGTTTGCGGCCGCCCAGCGTATCCAACGTCTCG
GCGGGGCTGGATCGAACAAGTGAGTTCGGTGCTTAG

Retrieve as FASTA