Entry information : OgaEPO
Entry ID 7789
Creation 2010-11-30 (Myriam Duval)
Last sequence changes 2011-08-16 (Christophe Dunand)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2011-08-16 (Christophe Dunand)
Peroxidase information: OgaEPO
Name OgaEPO
Class Eosinophil peroxidase     [Orthogroup: EPO001]*
Taxonomy Eukaryota Metazoa Chordata Mammalia Galagidae Otolemur
Organism Otolemur garnettii    [TaxId: 30611 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OgaEPO
start..stop
S start..stop
HsEPO 1332 0 5..718 2..715
PtroEPO 1330 0 5..718 2..715
GgoEPO 1329 0 5..718 2..715
MmulEPO 1312 0 5..717 2..714
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9926..10010 85 N° 2 10226..10319 94 N° 3 10547..10722 176 N° 4 10889..11006 118
N° 5 11109..11238 130 N° 6 12081..12287 207 N° 7 13340..13658 319 N° 8 15079..15239 161
N° 9 15666..15921 256 N° 10 16343..16513 171 N° 11 18110..18347 238 N° 12 18913..19114 202
join(9926..10010,10226..10319,10547..10722,10889..11006,11109..11238,12081..1228 7,13340..13658,15079..15239,15666..15921,16343..16513,18110..18347,18913..19114)


exon

Literature and cross-references OgaEPO
DNA ref. GenBank:   AAQR03121350.1 (9926..19114)
Protein sequence: OgaEPO
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   718 (703)
PWM (Da):   %s   81379.42 (79896.6)  
PI (pH):   %s   10.84 (10.84) Peptide Signal:   %s   cut: 16 range:16-718
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGTQLLLTLTGVLATLNLALPCEGTAPASPSTVDTSVLRDCIAEAKLLVDNAYNQTQRSIQQRLRSGLASPMDLLSYFKQPVMTTRKVVRAADYMHVALGLLEEKLQRQHSRPFNVDVLTEPQLWLLSQASGCALQDQAEKCSDKYRTITGRCNNKKIPWLGASNQAFARWLPARYEDGLSLPFGWTPSKRRNGFILPVRAVSNQIVRFPSERLTSDRGRSLMFMQWGQFIDHDLDFSPESPARVAFTAGVDCEKTCAQVPPCFPIKIPPNDPRIKDQRDCIPFFRSAPSCPQSRNKVRNQINALTSFVDASMVYGSEVSLAQRLRNNTNYLGLLAVNQRFRDNGRALLPFDNLHDDPCLLTNRSARIPCFLAGDSRSTETPKLAAMHTLFMREHNRLATELRRLNPRWTGDKLYNEARKIVGAMVIITYRDFLPLVLGKARARRTLGTYKGYCSNVDPRVANVFTLAFRFGHTMLQPFMYRLNSQYRASAPNSLVPLSSAFFASWRIVYEGGIDPILRGLMATPAKLNRQDSMLVDELRERLFRQVRRIGLDLAALNMQRSRDHGLPGYNAWRRFCGLSQPRNLAQLSRVLKNRDLARKFLHLYGTPDNIDIWIGAIAEPLLRGARVGPLLACLFENQFRRARDGDRFWWQKWGVFTKRQRKALRKISLSRIVCDNTGITTVSKNIFRARKYPRGFVSCSSIPRLNLSAWRGT

Retrieve as FASTA  
Remarks Partial sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGGAACGCAGCTTCTCCTGACCCTGACAGGGGTCCTAGCCACACTCAACCTCGCCCTGCCCTGTGAGGGCACTGCCCCAGGTAACAGCCCATAGACCAGTGGTTCTCAACCTTCC
TAATGCTGTGGCCCTTTAATACAGTTCCTGTGGTTTGCAACCCACAGGTTGAGAACTGCTGCCTTAGACAGATGAGGAGGAGGGTGGGTCTAAGGAAAAGAGAATGGAGAACAAGCACTT
GGGTCTGGGAGGGGGTCTTGTGGCTCCCCTGCACCCTGAGTCCCCATCCTCTTTGAGCAGCCTCCCCCAGTACAGTGGACACTTCAGTCCTTCGGGACTGCATAGCAGAGGCCAAGTTGC
TGGTGGATAATGCCTATAATCAGACCCAGAGGAG
GTAGGCCTGGGTCTGGGGGCTGCGTGGGCCTGGGAGGGCCAATGAGGGAAGATGGGTTCCAGCCAAGGTAATCTCCCTCACACCCG
CCCTGGGCCCCTCAACTGTTGGTAGAGGGCCTTCCTTCCACCTATCCTTCTGTCTGGTCTCCCCATCCTGCCTGTCCACCAGCCGGGGCTCTGCTGGGAGGTCTGCGTCCTCTCTCTAGC
CCCCGTTCCTCTCCTGAGCAGCATCCAGCAGCGTCTTCGCAGTGGCTTGGCCAGCCCCATGGACCTCCTGTCCTACTTCAAGCAACCAGTAATGACCACCAGGAAAGTCGTTCGGGCTGC
AGATTATATGCACGTGGCCTTGGGGCTGCTGGAAGAGAAGCTACAACGCCAGCATTCCAGACCCTTCAATGTCACCG
GTACTCTGCTCCTACTGAGCCTCAGGGCCTGCCCTGGCCTGGG
AGTAGAAGGAAGCTGGGAAGGGGGAGGCAGGGGCACAGCCATGGGGCACTGGAAGGAGAGAGGTACAGGGATGGGAGGTATGGAACAGGCCAGCCCCAGCCTGCTCACCTGCTCTCCTCC
CAGATGTACTAACAGAACCCCAGCTGTGGCTGCTGTCTCAGGCCAGTGGCTGTGCCCTCCAGGACCAGGCTGAGAAGTGCAGTGACAAGTACCGCACCATCACTGGGAGATGCAACAACA
A
GTGGGTGCCAGGGACTGCACTGACTCGGGGACACCTCCCTTCCCCCACTTCCCTCTCCCTCCATGCTGAGCCCTGCTCTCCCCGACCCACTTGCATCTACAGGAAGATACCCTGGCTGG
GGGCCTCCAATCAGGCCTTTGCCCGCTGGCTGCCCGCCAGGTACGAGGATGGGCTATCGCTCCCCTTTGGCTGGACACCTTCCAAGAGGCGCAATGGCTTCATCCTCCCTCTT
GTGAGTG
GGGGCTGAGGGTTTGGGAGTGAAACATGGTCCAAGGTTGGCCAGACAGGGCTCAAACCCGGGCTCCCTCACTGACCAGCTAGGTGACTTTGGGCAAATAAAAGTTTCTGAGTCTGTTTCC
TCATCTATAAAGTAGTAGTAAAACCTACCTCAGGGAGCTAGTATGAATATTAAGTAAAATACTTGGTATATGCAGTTATACAGGATGTGATGTATTAATGCTAGTTTTATGGCATTGGGA
GTTATTTCTGTCTGAGAGAATTAGTGTCAAAGTGTCCCGCTAAATGTAAAGAGCTATCTATAATGGTTAACCTGGTTCTACCTATTTGTCAATATTACTTCACATTTATTGACTCATCAA
TTTTCTATACATATGTCAATATAGCAATCTATCACCCCCTCATCTGTCAACATCTATTCATTTTTCTTCTATTCATCCATCTAGTTCTCTCTGTATTTATTATCCATTACCTCACAACCA
CCCCATCTAAGAATTAGGTACTATCATCTGGTTACCTATTGGTCTATGAATTGATCTACCAGTTAGATCTGTTGACCCCTCTGCTGAGGCCTGAGCCAGCCAACATGGGCTCTTTCCTTC
TCTTTACTGCTGGAATCCTTGGGGGCTACCTCAGAGATCATCCTTCCAGAGTGACAGCAACAACAGAGGTGTCTTCATCTCCAGGGAAAAAGGGGGAAAGAGGATGGGAGTGCAGAAGAG
GATGAGAGACTGTCACCTCCAGCAGGGACAGCTCTGAGTCCTGTGTTGGCTCTAACACCTTGAGGGGCTAGAAGCTCATGCTTCCCTCACCCCAACATTTATTTTCCCCCACCAGGTCCG
GGCTGTGTCCAACCAGATCGTGCGTTTCCCCTCCGAAAGGCTGACCTCTGATCGGGGCCGGTCCCTCATGTTCATGCAGTGGGGCCAGTTCATCGACCACGATCTGGACTTCTCCCCAGA
GTCCCCGGCCAGAGTGGCCTTCACTGCAGGTGTTGACTGTGAGAAAACCTGTGCCCAGGTGCCCCCCTGCTTTCCCATCAAG
GTACAGTCGGCCAGTCTTCCAGTCTCCCTTTCCCAGGC
AGAGGGCTGGTGGGGAGGGGGGTCAGGAATACTGAAACTATGTCCTTAAGGAGCTGTCTGTGGAGCTGAGGCATAAGACAGAAACATAAAAATAGCCTGGCACAGGCTCAGGGGCTGTGC
GATCTGAGGGCTGAGGGGGAGGGCAGCACTGGAGACCAGCCTTGGCTCACAGGTCTGATTCCAACAGGGGGAGCCTCTGGGCCTCTACTTGGGGAAACCTTCAAGGGCCCTGCAGCTCTC
CCAACTCTGGGCCTTGGGATGTCAGCAGGGTCCTAGCCTGTGGGCTGGAAGGCAAGGGTGGTGTGGGCCACTGGGGAAGAAGAAATGATGAAATTCAGCAAGCAAAGTCTCTGCTGGGGC
CATCGGGGAACATACACACGCACATTCTCATAACGGGTGGGCAACATTCAGGAGGGATGACTTGTCCCTGGCTGGCCCCTGAATGTAGTCACCCTATTCACTCTTGAAGCCCTGGCTCAG
GGACACCTCCTCTGGGGAGCCTTCCCAGATCTTCCTATTACACCGTTAGCATTTGGCTTTTACATCAAGCATAGCAAATGCCACTTCAATTTAGAGTTACTTAATTCTGTGTGTGTGTGC
ATGTGCATGTATGTTCACTGAACTACCACCCTCCTGCAGACCTTGACTGGGTTTCTGACCTTCATAGTCTCAAACTGAACAGAATTAAAGGAGCTCAGTCCCAAATGTCAGTTATGTTAC
CTCTTTCCCGCACTAGTTGTCACTTCCCCTCTCTGAGACTGTCTCCCCACCTGTAAAATGAGGATCTGGATTGTTTCAAAAGCCTTATTCATTTCTAATCTTTGATGACCCAATGATACA
AAGTGCCAACACGCTCAGACTGAGGTAGTGAGCTGCACCAGTCTGGACGAGTTGAGGAGGGCTCCCTGGAGGAGAGAAGTTCTAAGCGAGGTTTTCAGGGAGGCAGGGGTGACCAAGTGG
AGTGGGGACTGCATTGGAGGGGTCCCAGCGTCACTGACCCCTCTCCCATTTCAGATCCCACCCAATGATCCCCGCATCAAAGACCAACGTGACTGCATCCCCTTCTTCCGCTCGGCACCC
TCGTGCCCCCAAAGCAGGAACAAAGTCCGAAACCAGATCAATGCGCTCACCTCCTTCGTGGACGCCAGCATGGTGTACGGCAGCGAGGTCTCTCTGGCCCAGCGGCTCCGCAACAATACC
AACTACCTAGGGCTGCTGGCTGTCAACCAGCGTTTCCGTGACAACGGCCGGGCCCTGCTGCCCTTCGACAACTTGCACGATGACCCCTGTCTCCTCACCAACCGCTCTGCACGCATCCCC
TGCTTCCTGGCAG
GTCAGACTAGGGGAAAGGTGGTGTCTTCTCAGCAAACAGCCATCCCTGCATTCCAGATTGGGAAGGCGCAGTGGATGCAGGGAGGGCACCTGGCTGGGACCTCAGTA
TCAGGCACACCACAGGCACAGGTCTGTGCATAGTTGTCACAGAACCAGTATAGGGAAGGATTTTGCAAACGCCCTGGGTGTGGCCGACATCACTGACCATCTCCAGCAAGAAGGGACTTA
CCACCTATATGGCTCCAGATTTTTGGAAAGTCTCCCTCATTTTGATCCAATATCCACCTATTGTCCTTAGTCCTGTTTCATGACCCTCAGAGAAGAGGGTCTCTCTCTTACGTAGCAATT
GCCCCTTTACTTATCTGTATTTTTTCCTTCTCTGGGCTAAATTTCCTTAGTCCTCTCCCCCTACCTCCACAGGCACTCACTGTTGCCAGACACTGTTGCCAGTATCTTCTTTTGGATGTA
TAATTTGAGTTCTCCTCGGGGTCTTTCCCTGCACGTACATAGTTATAATAATAATGGCAATCATTTCTGGTTAAGATATTTAAACGTGTCCCCTCTAAACCTTACAGCAACCCTAAAAGG
AGGCAAATATCATCCTCATTTTACAGATAGAACTGAGACTCCGGGTAGATGAATAATGTGCTCACAGTGCAAAGTTTCAAATGGCAGAGTCCCTGTAGGAACTCAAGTCAGCGCAGTTCC
CAGGTCTCTGCTCTGTCCCTTCTCTTCCACTGCTTTCCTCACAGAGAATCAGCTCCAGTCCATCTTTCTAAGGATGGCAGTGGGAACAGCAGCATATACCTTCATGACAGGTCTGCTGAA
GAGTAGCCCAAATAAGACCATGTGCAAAAGGGCTTGGTTAAAAGCAAGCAAAGGACTGAACTTAACTTTCCTTCCCTGCCTGTAGGAGGTCTGGTGCAGGAGCAGGGCTCTGCCTGGCCC
TCCCTCTCTTTCCCTTTCCCTCTGGCTCCCTGGGTAGAGATGCTTGATAGCTCATCCAGTGATAAGAGAAGGTGGAGCCTTTGGTTGAGAACATGCAGATGGATATGGTGCATGGAACAG
GCAGGCTAACAGTCCCAAGAGTCACCAGGTCCCTCGACCATAGCTGGTCCAGGCTGTGGATCTGTCGTCTTAGGCAGAGATTTCCCTTCCTGAGACTAGCAGCTGCCCTGTTTTCCCACC
TAGCCCAAACCTGCTCCAGCCACTAAGACCCCATTGCCCTTCCTCTCTTGGCTTATCATGTTGGGGGAGGAGGGTGGCAGTTAAATAAGGAGCTCGCAGCACAGCTGAAGGGACGGGAGG
GCAGCTAGGGCTGGAAACCACCGCATTTCTCCAGTCCCTAGACTCTGTCCACCCTAGCAGAAAGACGTTTCTCTGGGAAAAGCTGTGGCAACTCTGAACTTGGGGTTTTCAAGGTGACTC
CCGATCTACGGAAACTCCCAAACTGGCAGCGATGCACACCCTCTTTATGCGAGAACACAACCGGCTGGCCACTGAGCTGAGACGCCTGAACCCCCGGTGGACTGGGGACAAGCTGTACAA
TGAGGCTCGGAAGATTGTGGGGGCCATGGTTCAG
GTAGAGAGGCCCAGGTCCCAGCATCCCCCACAAGACAGCCCGCCATGAACAGGGTGTCCATAAAGTTCATGTGCAATTTAAGATAG
TGCGCAATTTCAAATCGCACACAAACTTCATGGTCACCCTGAAGAAGCCATCTGAGGAAGTGGCTCTCACTTTCCTTAACACATCCTTGGGGAAGCTGGGTCTGGGTGACTGAGGAGCGA
GCCTGACACATGACGCCTACTTCCAATTCTGCTACTAACTCACTGGGTGACCCTATTCATGTCACTCAGCCTCTCTGGGCTTCAGTATCTCCCCCTACCAAAGCAAAATTAACATTGTCA
CATTTGGCATGATGACTACAGATCTGAGTAGTCCTTCAGAAAGGCAGGCGTGTGGGATGTGCAGCCACTGGGGTAATGCTCCTCCTGTCTTCTCTTTCAGATTATCACCTACCGGGACTT
TCTGCCTCTAGTTCTGGGCAAGGCCCGGGCCAGGAGAACCCTGGGGACCTACAAGGGGTACTGTTCCAATGTGGACCCGCGTGTGGCCAATGTCTTCACTCTGGCCTTCCGCTTTGGCCA
CACCATGCTCCAGCCTTTCATGTACCGCTTGAATAGCCAATACCGGGCCTCGGCACCCAACTCACTTGTCCCACTTAGCTCTGCCTTCTTTGCCAGCTGGCGAATTGTGTATGAAG
GTGA
CCAGGTTTTTCAGAGGCAAATGAGGGTGAGGGCGGGGAGCATGCCCTCTCCCAGGAGGGCTGGGCTCACTGCTAGGTGGCCAGGCTGCTTCTGAGGCCACCAGGAGTATCTCTCTGGGAC
AGAGGGAACAAGGCAGGATGCTCAGTCACAGGCTGCACATCCCCTAGGATTCTCAAAGGGGCAGAGTCAGGTGTCAGACCAGCAAGGAGCTCACCTTTACCTTTCACTCTTTAAGAAGTG
GAATGACCCCTTTCCCTCCCAGCTTCAGCTCTTTCATGTCCCATGGGCCTTGCTGCCTGACAAACATTATAGATTTTAAGTGACTGGCTGGTCCAGCACTGAGCTAGCTTGGCACCATGT
GATGACTCATTCCCTGAGGCTGGTCCAATCTGTGCAGCTCACATTCCCTACCACCAGGTGGCATTGACCCCATCCTCAGAGGCCTCATGGCCACGCCTGCCAAGCTGAACCGTCAAGACT
CCATGTTAGTGGATGAGCTCCGGGAACGGCTGTTTCGGCAAGTGAGGAGGATCGGGCTGGACCTGGCGGCTCTCAACATGCAACGCAGCCGGGATCATGGCCTTCCAG
GTGAGAGGGCTG
CCTGACTCTCCTCCTAGCTTCAGGCCAGGGCTGCTCAAGGGGTTCAGGGAAGACCCCTGGTGCCTCCTTTCTGACTGGGACTGTCTACAGCAGTGGTCCCCAAAACTTTTTGGCACCACA
GACCTGTTTCATGAAAGACAAGTTCTCCATGGACCAGAGTGGGGTGGGAAATGGTTTTGAAACAAGTCTGCAAGCAATGGATTTGCTATGGTCTCTGTGCATCAAACCTTTGCTATAATG
GCAATCTGTACATGCTGCCACTACTCCCCAGCACCAGCATCATGGTCTCCACTCCACCTCAGATCATCAGGCATTAGATTCTCATAAGGTGTGCTCAACCCAGATCCCTCGCATGCATGT
TGTACAAAATGGTGTGAGCCCCTATGAGAACTGAATGCTGCCACTGATGTGATAGAAGGCAGAGCTCACCTCTTGCCCACGGCTCGCCTCCTGCCAGGCAGCCCAGTTCCTAACAGGCCA
TGGACCACTACTGGGGTTGGGGACCACAGGTCTCCAGGATGCGCAGTGGTACAGAAACATGCAAAGCACTTTGAGCACACCTGTCTGCCATCCTGCCAAGTTTTCCCCATCTGCTGTAGG
GTCTCTAGCTTTAGGTTCACCACAGGACCAGGACTTGGGCACAGGACCTGAAAATGGAGATCAGTTCTTTCCAAGTAGAGAAAAGCAGATTTAAAAGGCAGGGAAGAACTGCTCTATTCC
CCAAAGCCCTGGCAAGTTCTAAGGAGGAAAGCTAAAATTCTGGGGCTACAGTAACACTCCTTGCTCTAAGTGGAGGAAGGCCCAGAGACCCAGAGGCAGGGAACAGGTAGTATATAGTTA
AGTTTGTATTAGCTGTTTGGTAAGGGTACAAAAGACTTTATCCTAGGAAAGCCAAAAATGTAGGCACGTTCAGGTATACAACATATTTTGTCCTCCCCGTGACCTTGAAAAGGAGCTATT
ACAGCCATTTTATAAATAAGAAAATAAGATCAGAAACAGCTAGTAATTTGCCCAAGGTCACATAAGTAGGAAATAGCAAATTTCACATTTCTCATCCATTCATTCATTTATTCTAGAGAC
AGGGTCTGGGTATGTTGCCCAGGCTGGTTCTGAAGTTGTGGCCTGAAGCAATCTGCCTGCCTCAGCCTCCCAAAGTGCTGGGTCTATAGGCATGGGCCCCTATGCCTATCCCAATTTCTT
TCTTTTTCCCATTCAAACTACTAAAGGCAGGCTGAGGCCACTGCCTTGCTCTTCCTTCCTACCTTCCACCACCTTCTCGACAGAACTTGATGCCTCATCTGCCCCAGGTGACCTTGGCCA
TGTGGGGAGTAGGACTTCCTCCTGTTGTCCTTCTTACATTAGGACACACTCAGTCCGACGTACACAGTCTGATGTACACAAAGCATGGTTGTCTACTCACATTTTGGAGGACAGCAATCT
GGTCTTTGGAAGGTTCAGGGCTTCTTTTGCTAGTAGGGACCTTTTTGTTCTGCCCAATATTGACTGGCCACAGGTTTTTCTCAGAGGACTTGTGGAGAGAACAGGTCAGCTACACTAAAG
GTGCTTCTCCCCTTTTCCCCTCAGGGTACAATGCTTGGAGGCGCTTCTGTGGGCTTTCCCAGCCCCGGAATTTGGCACAGCTTAGCCGGGTGCTGAAAAACCGGGATCTGGCAAGGAAGT
TCCTACATCTGTACGGAACGCCTGACAATATTGATATCTGGATTGGGGCCATCGCGGAACCTCTTCTGCGAGGGGCCCGAGTGGGGCCTCTTCTGGCTTGTCTTTTTGAGAACCAGTTCA
GAAGAGCCCGAGATGGAGACAG
GTGAGTGACCCTACCCTAGCAGACATCTGCACCAGAGGCAGAGCAGAAAGACACCAGCATTTCCAGATAGTAAAACAATGGGACAAGTGCTCTTTGGG
CTTAATTTCTTCCAAATTCACAGGACTAGGAAGCTCCTCCCTGGACAGCTAGGTCAAAGGGAAAGACACACTGACCCAGGCAAGGCTGGCATTACCTGCGCTGGAGTCACCTTAAATCCA
GGAGATAGACTGTTCCAGGCTAGTGGACCTCAGAAAACATGGCGGAAAGGGCTAACTCTGGTTTCCCCCAAAAAGTCTGATTCAAGACCTGACTCCTTATTTGGATTTGGTATTTGCCTA
AGTCCAAATCCAGCCTGGGCCACTTAAATTACTGTGCACTTAATAGTGAGCAATTTATTTTACCACTGAGCCTGTTTCTTCATTTATAAAATGGGAATAATACCTATCTTGCAGGGACTG
TGAGAACTGAATGAAATAATGTATGTAAAGTACCTGGCACAAAACAGATGGTAATTATAAGATAATTTCTCCTCAACGTTCACCTCCTTCTCTTGACCACCCGGTAGGTTCTGGTGGCAG
AAATGGGGTGTTTTCACCAAAAGACAGCGTAAGGCCCTGAGGAAGATTTCCTTGTCTCGAATTGTGTGTGACAATACCGGTATCACCACCGTTTCAAAGAACATCTTCAGGGCCAGGAAG
TATCCCCGGGGCTTTGTGAGCTGCAGCTCTATCCCCAGGTTGAACCTGTCAGCCTGGAGAGGCACATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGGAACGCAGCTTCTCCTGACCCTGACAGGGGTCCTAGCCACACTCAACCTCGCCCTGCCCTGTGAGGGCACTGCCCCAGCCTCCCCCAGTACAGTGGACACTTCAGTCCTTCGG
GACTGCATAGCAGAGGCCAAGTTGCTGGTGGATAATGCCTATAATCAGACCCAGAGGAG
CATCCAGCAGCGTCTTCGCAGTGGCTTGGCCAGCCCCATGGACCTCCTGTCCTACTTCAAG
CAACCAGTAATGACCACCAGGAAAGTCGTTCGGGCTGCAGATTATATGCACGTGGCCTTGGGGCTGCTGGAAGAGAAGCTACAACGCCAGCATTCCAGACCCTTCAATGTCACCG
ATGTA
CTAACAGAACCCCAGCTGTGGCTGCTGTCTCAGGCCAGTGGCTGTGCCCTCCAGGACCAGGCTGAGAAGTGCAGTGACAAGTACCGCACCATCACTGGGAGATGCAACAACAA
GAAGATA
CCCTGGCTGGGGGCCTCCAATCAGGCCTTTGCCCGCTGGCTGCCCGCCAGGTACGAGGATGGGCTATCGCTCCCCTTTGGCTGGACACCTTCCAAGAGGCGCAATGGCTTCATCCTCCCT
CTT
GTCCGGGCTGTGTCCAACCAGATCGTGCGTTTCCCCTCCGAAAGGCTGACCTCTGATCGGGGCCGGTCCCTCATGTTCATGCAGTGGGGCCAGTTCATCGACCACGATCTGGACTTC
TCCCCAGAGTCCCCGGCCAGAGTGGCCTTCACTGCAGGTGTTGACTGTGAGAAAACCTGTGCCCAGGTGCCCCCCTGCTTTCCCATCAAG
ATCCCACCCAATGATCCCCGCATCAAAGAC
CAACGTGACTGCATCCCCTTCTTCCGCTCGGCACCCTCGTGCCCCCAAAGCAGGAACAAAGTCCGAAACCAGATCAATGCGCTCACCTCCTTCGTGGACGCCAGCATGGTGTACGGCAGC
GAGGTCTCTCTGGCCCAGCGGCTCCGCAACAATACCAACTACCTAGGGCTGCTGGCTGTCAACCAGCGTTTCCGTGACAACGGCCGGGCCCTGCTGCCCTTCGACAACTTGCACGATGAC
CCCTGTCTCCTCACCAACCGCTCTGCACGCATCCCCTGCTTCCTGGCAG
GTGACTCCCGATCTACGGAAACTCCCAAACTGGCAGCGATGCACACCCTCTTTATGCGAGAACACAACCGG
CTGGCCACTGAGCTGAGACGCCTGAACCCCCGGTGGACTGGGGACAAGCTGTACAATGAGGCTCGGAAGATTGTGGGGGCCATGGTTCAG
ATTATCACCTACCGGGACTTTCTGCCTCTA
GTTCTGGGCAAGGCCCGGGCCAGGAGAACCCTGGGGACCTACAAGGGGTACTGTTCCAATGTGGACCCGCGTGTGGCCAATGTCTTCACTCTGGCCTTCCGCTTTGGCCACACCATGCTC
CAGCCTTTCATGTACCGCTTGAATAGCCAATACCGGGCCTCGGCACCCAACTCACTTGTCCCACTTAGCTCTGCCTTCTTTGCCAGCTGGCGAATTGTGTATGAAG
GTGGCATTGACCCC
ATCCTCAGAGGCCTCATGGCCACGCCTGCCAAGCTGAACCGTCAAGACTCCATGTTAGTGGATGAGCTCCGGGAACGGCTGTTTCGGCAAGTGAGGAGGATCGGGCTGGACCTGGCGGCT
CTCAACATGCAACGCAGCCGGGATCATGGCCTTCCAG
GGTACAATGCTTGGAGGCGCTTCTGTGGGCTTTCCCAGCCCCGGAATTTGGCACAGCTTAGCCGGGTGCTGAAAAACCGGGAT
CTGGCAAGGAAGTTCCTACATCTGTACGGAACGCCTGACAATATTGATATCTGGATTGGGGCCATCGCGGAACCTCTTCTGCGAGGGGCCCGAGTGGGGCCTCTTCTGGCTTGTCTTTTT
GAGAACCAGTTCAGAAGAGCCCGAGATGGAGACAG
GTTCTGGTGGCAGAAATGGGGTGTTTTCACCAAAAGACAGCGTAAGGCCCTGAGGAAGATTTCCTTGTCTCGAATTGTGTGTGAC
AATACCGGTATCACCACCGTTTCAAAGAACATCTTCAGGGCCAGGAAGTATCCCCGGGGCTTTGTGAGCTGCAGCTCTATCCCCAGGTTGAACCTGTCAGCCTGGAGAGGCACATAA

Retrieve as FASTA