Entry information : OgaMPO
Entry ID 7791
Creation 2010-11-30 (Myriam Duval)
Last sequence changes 2011-08-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-08-16 (Christophe Dunand)
Peroxidase information: OgaMPO
Name OgaMPO
Class Myeloperoxidase    [Orthogroup: MPO001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Galagidae Otolemur
Organism Otolemur garnettii    [TaxId: 30611 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OgaMPO
start..stop
S start..stop
EcabMPO 1303 0 1..717 49..765
GgoMPO 1295 0 17..718 43..744
CjaMPO 1293 0 16..718 42..744
PtroMPO 1291 0 18..718 44..744
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10972..11047 76 N° 2 10733..10826 94 N° 3 10216..10391 176 N° 4 9892..10015 124
N° 5 9650..9779 130 N° 6 9358..9564 207 N° 7 8186..8504 319 N° 8 5707..5867 161
N° 9 4321..4576 256 N° 10 3692..3862 171 N° 11 2623..2860 238 N° 12 1720..1924 205
complement(join(1720..1924,2623..2860,3692..3862,4321..4576,5707..5867,8186..850 4,9358..9564,9650..9779,9892..10015,10216..10391,10733..10826,10972..11047))


exon

Literature and cross-references OgaMPO
DNA ref. GenBank:   AAQR03121357.1 (11047..1720)
Protein sequence: OgaMPO
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   718 (696)
PWM (Da):   %s   80505.45 (78310.2)  
PI (pH):   %s   9.31 (9.31) Peptide Signal:   %s   cut: 23 range:23-718
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLLSALAGLLAILAMSQPSEGAAPAIPGEVETSVVLTCMKEAKRLVDKAYKERRESIKQRLRSGSASPMELLSYFKQPVAATRTAVRSADYLHVALGLLEVKLRSLWPGPFNVDVLTPAQLTLLSKSSGCAYQDVAVTCPEQDKYRTITGRCNNRRSQTLGASNRAFARWLPAEYEDGFSLPFGWTPGVKRAGFPVPARAVSNEIVRFPTEQLTPDQERSLLFMQWGQLIDHDLDFTPEPAARVSFLTGLNCETSCLQQPPCFPLKIPPNDPRIKNQQDCIPFFRSCPACTESNITIRNQINALTAFLDASMVYGSEDPLAMKLRNTTNQLGLLAVNTDYQDNGRALLPFDTLHDDPCLLTNRSVRIPCFLAGDTRSSEMPELTSMHTLFLREHNRLATQLKRLNPRWDGEKLYQEARKIVGAMVIITYRDYLPLVLGPEAMRKYLPKYRGYNDSVDPRIANVFTNAFRYGHTLIQPFMFRLDNRYQPMGPNPRVPLSKVFFASWRVVLEGGIDPILRGLMATPAKLNRQNQIVVDEIRERLFEQVMRIGLDLPALNMQRSRDHGLPGYNAWRRFCGLTQPSTVGELGTVLRNLDLARKLMAQYGTPNNIDIWMGGVAEPLKPGGRVGPLLACLIGTQFRKLRDGDRFWWENKGVFSTQQQQALANISLPRIICDNTGIATVSKNNIFMSNSFPRDFVNCSTLPVLDLAAWRDA

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTTCTCTCAGCCCTAGCAGGGCTCCTGGCCATTCTGGCCATGTCCCAGCCCTCTGAGGGTGCTGCTCCAGGTAACATTCAAAAGGGGGAGGGAAACGTGGTGTGTTGGGATGGT
TCTGAGTCCCAGGGACCCTTTTCTCAGTGCAGGCTCCCTGGCTCTGGGGCCTGATGAGGGCTTTGGGCCCTTTCTGACTTTGTGACCCCTGCTCTGGACAGCTATCCCAGGGGAGGTGGA
GACCTCGGTGGTGCTGACCTGCATGAAGGAGGCCAAGAGGCTGGTGGACAAGGCCTACAAGGAGCGGAGGGAAAG
GTGTGGTGCCGGCACTGTGCAGCTCTGGGCAAGGCTGTCCCTGGC
CTTTCAGAGAAGGAGCAGTGGGAGTTTATAGGTGGTGTGGCGGGGGGGGGGTCTATGGGGGCTCATGGAGAACCCTCTGTCTGTCCTGTGTCTCTGGATATAAGATCTTCAAAACCATTC
TTCCCATGGTTTTACCTCTGTCTAGACACCCAGGTCCACAGAAAAATATATAAAAAAAGAAATTTTCTTCCCATCGTGGCTTTGTCTATATCATTTTGGCGTCAGTCCCTGGGCTGGGGC
TCTGCTGAGTGTCTGTGCACCCTTCTGGGCCCCTCACACCTCCTTTCTCCAAGCAGCATCAAGCAGCGGCTTCGCAGTGGCTCAGCCAGCCCCATGGAACTCCTGTCCTACTTCAAGCAG
CCTGTGGCTGCCACCAGGACTGCCGTGAGGTCTGCTGACTACCTGCATGTGGCTCTAGGCCTGCTGGAGGTGAAGCTGCGGTCCCTGTGGCCAGGGCCCTTCAATGTTACCG
GTACTGTT
GTCCATCTCACCCCAGGTCCTCGCTCCGCTAGTGACCCCTCCTAGAGACTCCAGCCACCTCCTGGTGATCCCCTCAACTTCTCCCTTCATGGAGTCTCAGGGGGCATCCCAGAATCCCCT
CCGGTGTCCAGCCCCTCTCAGGGTCTTTTCAATCTCAGGTTGCTGAAGCTCCCACATCCTCTCTTCTCACAGATGTGCTGACGCCGGCGCAGCTGACTCTGCTGTCGAAGTCAAGCGGCT
GCGCCTACCAGGATGTGGCCGTGACGTGCCCAGAGCAGGACAAGTACCGCACCATCACTGGGCGGTGCAATAACAG
GTGCAGCGGGCGGGTGTGGTCCTGAGCCGGGCTCAGGGAGGCGT
CCGGGTCCCCGGGGCCCACGTCGGGCCTGTGGCGCCACCTCGCGTCAGCGCCCTGTCCTCCCCTGCAGGCGCAGCCAGACGCTGGGGGCCTCCAACCGCGCCTTTGCGCGCTGGCTGCCG
GCGGAGTATGAGGACGGCTTCTCTCTGCCCTTTGGCTGGACCCCGGGGGTCAAGCGCGCCGGCTTCCCGGTGCCCCTG
GTGAGCGCCGGCAGGCAGAGGGGGCGAGGCCAGGCCCCACGC
TGCGTTCGGGTCCCAGAAGCCCCTGACGTCCCCTGTCCTGTAGGCTCGTGCGGTCTCCAATGAGATCGTGCGCTTCCCCACGGAGCAGCTGACCCCGGACCAGGAGCGCTCGCTCTTGTT
CATGCAGTGGGGCCAGCTGATCGACCACGACCTCGACTTCACCCCGGAGCCAGCCGCCCGGGTCTCCTTCCTCACTGGCCTCAACTGTGAGACCAGCTGCCTGCAGCAGCCGCCTTGCTT
CCCGCTCAAG
GTGCTCCCTTCTTCCTGCCCACCCGCCTGCGGTGGGGAGTGAGGATCTTGTTCCTGAAAGTGCCCAACTCCCTCTTGTGCCCAGGTCTCCTTCCACAGCCCTGGTGTGAC
CAGAGGCAATGCCTGCCCCGCTCTGTGCTGTCTGGTTCCTGGTGCCAGGATCCCAGCGGCAGTCAGGCTGGGCATCCCACTCATCTGTTGCCTCTCCCAGGCTGGGAAGAGAGCGATGCT
AATTTCTCCCCACCCCCCACCAAAGGATCCTGTTGGCGGGATTACTAGCTCTTTGTTAGGCTGATAGAGAATTCTGGGGGGGAGCATCTTCCCAGTGTCCCTCAAACTTTCTTGAATAGG
TGGCTGGTACTCCTTTGAGGGGCCTTTCCCCACACCCACATTGCATAGCAGAGAGCTGGGGTCTAGGCGGGAGCTGGGAGTAGGGCTGAGAGTGGGCTGGGGGAGGGCGAGGGTTGAGGC
AGGTACTGAGTAGGGAGAAGGAGAGAAAGGAGACAGTCTGAGAGAGAGGGCAGGAACGACAGGACAATGTCAAGGCCAGAGCGAGGGACAGGAAAGGGACAGAGACGGGGGGGGGGGGAA
GGAAGAAGGAGATAGAGTGAGAGTCTAGAGACCACTCTAGAGAGGAGGGGAGGGAGGAAGGAACAGACCTAGAAGAGAGACAGGAGCCGGTTCAGCAAGGAGGAGGGCAGTGGCGTCGGG
GGCTCCCCACATTCCCTGTTCCTGGTCATCAACCCTGAACCTCAGAGGTTGATGGGACCAGAGGTCCTGAGGGAGAGGGAGAGCCACCTATGCCCACTGCCTCTGTCCTCAGTGAGCTGA
CCTGGCCTCTCTCCATGCCTCAGATCCCACCCAATGACCCTCGCATCAAGAACCAACAAGACTGCATCCCCTTCTTCCGCTCCTGCCCGGCCTGCACTGAGAGCAACATTACCATCCGCA
ACCAGATCAACGCGCTCACCGCCTTCCTGGACGCCAGCATGGTGTACGGCAGCGAGGACCCCTTGGCCATGAAGCTGCGTAACACCACCAACCAGCTAGGGCTGCTGGCCGTCAACACCG
ACTACCAAGACAACGGCCGGGCCCTGCTGCCCTTCGACACTCTGCACGATGACCCCTGTCTCCTCACCAACCGCTCTGTGCGCATCCCCTGCTTCCTGGCAG
GTCAGCTCTGGGCTGGGG
ACCTGGCCTGGCACAGGCGGTATTCCCTGCTGGAGCCAGTAAGGCCTGTTTGTGAGCAGCTTGTGGGTTTGTTTTTAGAGAGACTGTCCTCACCAACTTCATGATAGTAATCTGGTTGCC
TTGGTAACAAGTTGGATGGAGCCAGAAAAGCAAAAAAACCCAAACAACCCTCCCCAACCCCAAACTGAAGATGGAGACACAGGATGGCTGAGGAGCCTCTGTCCGTAGGTCCATCACTTT
CTCTGTCCCTCTTTCTCCCTGTGAACTCTGGAGGAGAGGAAAGTTGAGTCCTTGGGGACACAGCGCTAAAGGGACAGAGAGTACTGTTGTGCCCTCACCCTCTAGAGCTCACACTGTCCA
GTGGGGTAGCCACTAGCCACATGCAGCTATTTTAATTTTATTATAAATCAAATAAGCCCGGTTTCTCAGCTGCACCAGCCATACTTCACATGGCTAGTGGCTCGCCTGTCGGGCAGCACA
GATGTTGAACATTTCCATCACCTCAGAAGGTTCTATTGGACAGTACTGCTCCAGGATATCACTTCCTTCCCATCTTGATTGCTCCTCATAAATACTGACAATTTTGGAGATGGCTGGGGC
AGTGATGGTAGCTGTGGCCAGAAATTTTCTAGGTTTTCTTTTCCTTTTGTTTTTTAGACTGAGTTTTGCCCTGTCACCCAAGCTAGAGTGTGATGGTATCATCAGAGCTCACCGCAACCT
CAAACTCCTGGGCTTAAGCGTTTCTTCTGCTTCAGCCTCCAGAATATCTGGGACTTACAGATGCACACCACCACACCCAATTAATTTTTCTATTTTTTGTAAAGACGGGGTCTTGCTCTT
GATCAGGCTGGTCTTGAACTCCTGGCCTCAAGCAATCCTCCCACCTCGGCCTCCCAGAGTGCTAGGCTCACAGGCATGAGCCACCACCATATCTAGTCTCCTGTGTGTTTTAGCATAAAC
CCATTAGTGGGCCTGAGGCCATTTCTTCTGGCCTCCTCTGCCCCCACCTCTGCCCCTGTAGCTCCTGTGGGTCTCTCCCTGGCTCGGCCCCTGGGAGGCTCTGTCTTGTTTTCAGCTGGT
CTCTGTCCTACCTTAGTAATCAGTTACTCTGCGTTGAAGCCTCAGCTGTGGAGAAATACCAGCAATTAAGTCACCTAGCCCCACAACGGGCAACAACTGGAAAAGGAAAATCAAACCTTC
CCACAACCACACACCCAGGGTACTACTTTGGGTAGTCCTCAGGTGATTGACCCAGTTCAAGAGGTCCAAATCAATTGTCCCAGTCAGCACCGATCTCAGGTGGAAGAGTTCAATAGGTCT
CCCCCTGGGAGGAGAATCAAGGTCAGTGCCATTGTGGACTTCCTGGGGAAGGAGCCTGGCCTCTTCTGGGCTAGTTGGGTAAGGACAACATCCCCCAGCCAGGCACAGCCACCTCCAGCC
TGGCTTTAATGAACCCCATGTTCCAGGCTCATGGATGGAGAAGCTGCTCTCAGAGAATTTCTACCAGCTTCTAGACTTGGCAGGGACTGAACCTAGTGTCCTGCTGAAATGGCCCTGACC
CTACCTCTCTGGTCCCTCCAGAGAAGGGTTGGGGGAGGGTTAGAGGAATCAGGGATCTTGCTTAGCTTTCTTGAACAGAGTCTCAGGTGTAGACTATGCACATCCTGGGCCTGAGACCCC
TTCTGTGGAATAAGCCCCACCACTGGCATGTAGTAAGGATGGGCTGATAACTCTATTCAAACGGTGGCAGTTTTCTGGAGTCCTGTGTTGAGAAGGATTCTGAGGTTGCATCGAGTTTTA
GCAGGAAAGAGTGTTGTGATCATGAAGTGCTTCTGACACAGGCATGGAGATAGGCGGTGCCAACACACATGCTACTTTTTGGCCTTCCCTGAATCAAAAGAATCAGTTAGCCAGGCAGTG
TTCATAAATCTCACACTTTGTACCAGGCATCCCTCTGTTAAGCCCCATGTGTCTATATGTATCTTGGGAGAGAGTGTCAAATACAAAAAGGCCATGGGCTCAGTTTCAGGTATGGGAAGG
TAGCAAGTCGTGTGTCAGCTCTGATACCTATTGAATGACCAGCAGTGCCCCCTAAGCAGAGGAAGAAGCTGTTCTGGCAGACTGGAGCATCAGGGCAGGCCTCCTACAGGAGCATAAATT
GAGCATGGTGTGAAAAGATGGATGGAGAGGAGGGGCAAGTGGGAGACATTTTGGCCCTCGGCTGGTGAGGGTGTGTCAGTGGAATAAATGTTTTCTGGGATGGAGCTCTTAGGAACGACG
GTGGCTTTTGTCTTCCTAAGGGGACACCCGCTCCAGTGAGATGCCCGAGCTCACCTCCATGCATACCCTCTTTCTGCGGGAGCACAATCGACTGGCCACACAGCTCAAGCGCCTGAACCC
CCGCTGGGATGGAGAGAAGCTCTACCAGGAAGCCCGGAAGATCGTGGGGGCCATGGTCCAG
GTAGGATGTCCTGAGCATTGGGCTGACTTGGGATCTTGCATGCATCTGCAATATCCTAG
CTGTGTGACCTTGAGCAAGTTATTAACCCCTCTGAACCTTGGTTTCTTCACTCCCAATCCTGTAAGGATGAAAGGACACACAGGAAAACACCTAGCAGACATTAGGGGCTTGACAAAGGC
TCCTTCCCTTCCCTCCCCTTCTTTCGAGCCTTGCTCCTCTGTGTCTTTTTCCCGTGGGTCCAGGAATGGTGGCAGAGGGTTGAACAGGTGTTCTAGTGCCTGACACATAGTAGCTGGGGG
AAGTGTGTCTCCTTCCCCTCCTCATTGTCATTCTTGGGTCCTTTACCCACTCACTTCTTCCTTGTGATGTTGGAACACACCCAAACCCCTCAGCCTCATTTATCCCTGGGACAGTGTTCT
TGGTTCTTTCTCCCAATTTCAGATGCCTCAGGGCCCACATCTTCTCCCCGAGATTTGAATACAGACGCCTACACATAAACACGCACCCTTGGATTCTGGAGGGGTAGGAAGTTGCAGGTG
CTGAGGATGAGTTTTTGATTTGCACTAAGCACTCAAGTGAGATTCACTTAAGCTTCAGAGGAGATTCTGGAGTCTAGAATCTAGAGTGAGACTGTTCCACATCTTTCCTTTTCATGGTGG
CAATTACGCTGGAGTGGTTCTTCATTCCTTCCTTCCTGCTTCGCCAAGCCTCCTTCCACAAACCTATTCTGAGCCCTACCATGGGCCAGGCTGTGGGTGGGCACTGTGAATAATTTCAAT
TTCTTTTGCTCTCAAGGAGACATCAATAACTCCAGGGCGAGGGAGGTATCATAATGACTAATGAAGTGCTTTGTTATTTAATTCTCTAAGAAAGAGGGCAATATAATTATCCTTAATTTA
CATTTGAAGAACTTGGGCTTGGTGAGGTTATTAATGGTCTGAGATCCCCTAGCCAGCAAGCAGAGAGCTGTGTTCATGCCCCTCAGTACCACAGTTAGGCCCAGATCCAAAGTTGTGGGA
AGTGATTTCTTGATCACAGATGGAGGACAGGAGGGATCCCTCAAGCCAGAAGCAGGTGGAGACTGCAGGGAGGAATGAGTGGAGAGGCCATTCCAGGTGACTTTTCTTTAGATCATCACT
TACCGGGACTACCTGCCCCTGGTGTTGGGGCCAGAGGCCATGAGGAAGTACCTGCCCAAGTATCGTGGCTACAATGACTCAGTAGACCCACGCATTGCCAATGTCTTCACCAACGCCTTC
CGCTATGGCCACACTCTCATCCAACCCTTCATGTTCCGCCTGGATAATCGGTACCAGCCCATGGGGCCCAACCCCCGCGTCCCACTCAGCAAGGTCTTTTTTGCCAGCTGGAGAGTAGTG
CTGGAAG
GTGAGTGGGACCTGGGCCAGGAGAGAGTGGGCTGGCAGCTGAGAATGGGCTGGGGGTGGCGTTGGCTGCAGTGAGAGGAGCTAGGGTGGTATGAAAGCTGCTTTCCTTCCATC
TTTGAGGAGATGGTCTGACTCTGTTCCTGGGTCTGATAATAAAGTGGGGTAGAGATCGCTCTTAGAGGGAGCTGGCTCCTTCTTATGTGTTGTGACTCTCTGTGACCCAAGAGGTCAGGG
ACTAGGAGCCTCCTAACCTGGCATAATCCCCTGAGACCTATGTGCCCCTGGGGTCATATAGTGACTGGTAGAGGCCAGCTCACTGAGGCCACCTTGGCACCAGGTGTGGCTTGTGCCCAG
CCCTCTTCTCCAATCCCTTGACCCCATCTGGACTCCTTCCTGATTCTAGTCTGAGCTTTCATACTGAGCCAGATCCTGCTCCCATTCTGCTCCTCTCGTTCCCAGGTGGCATTGACCCCA
TCCTCCGGGGCCTCATGGCCACTCCTGCCAAATTGAATCGGCAGAACCAAATTGTGGTCGATGAGATCCGAGAGCGATTGTTTGAGCAGGTCATGAGGATCGGGCTGGACCTGCCAGCTC
TGAACATGCAGCGAAGCCGGGACCACGGCCTCCCAG
GTGAGGGGCTACAGGAATTTCGCCTGCCACCCCCATGCTATCCCTTGCCCCTTACCCTCCCAGGTAGCCGGTAGCTCCTCTCCC
CACTCTAGGGCCCCTGCCCTCTCCAGTGCTCCAAGCTGCCCCCAGCTCTCCCCCACCCCATGCTTTGCTCTCTGGAAGTAGTCTAAGGTCAGGCCTCTATCTTTCTTTGCACTTGTGAGG
CAAATTTTCAGCTCCTCTCAGCCTCATCTTCATGCTGTAGCCCTCATATGCAGGTTACCATAATAATAACAATGACCCACAGTCTGAAGATTGGTCTTCATAGCCATTTCACTGTGCTTC
ATTGTACATGAACTCTGAGGTTTATTATTGTGTCCATTTTACTGAGGAGGAAACTCAGGCTTGGAAAGACTCAGAAACTGGCCAGGTCCTCTAGCCAGAGACAAAGCTAGAATTTGACCC
TAGATCAGCCCAACCCTAACACCTGTGCCTGTATCACAGAGTGCTGGGTGTGGCTGAGGCTTCTAGACACATTTCACCCCTCTTGGATCAGAGAGACACATTGGGTTGCTCCAGAGGGGG
ACAATGAAATGTTCCTGTTCTTGGACCTGGCGGGAGTTCTGGCAATTTAGGGTTTGTCTTACGGTGGGACTGTAAGGGAAAGACAGAGCGGGTTCGAAAGTTCAGGGTTCCCTAGGGAGA
CATCCTCCCTTCTATGACGTTGGCATGTTGGAGAGGTGGGTATTCTGGGCTGACGGCACAGATGTGAACATCCCTTGCTGTCTCAGTGACCTCTCCACCTTGCAGCACAGGGTCCCACCC
ACAACCACCCACCCCCTCCCCCTGCAGGGTACAACGCCTGGAGGCGCTTCTGTGGACTAACGCAGCCTAGCACGGTGGGTGAGCTGGGCACGGTGCTGAGGAACTTAGACTTGGCAAGGA
AGCTGATGGCACAGTACGGCACACCCAACAATATTGACATCTGGATGGGCGGTGTGGCTGAGCCCTTGAAACCTGGTGGCCGTGTGGGCCCCCTCCTCGCCTGCCTCATTGGCACCCAAT
TCAGAAAGCTCCGGGATGGCGATAG
GTGAGGGGGGTGGTTCAGGCCTTCTGGGGGGCGGGAGCCTATCGTGAACCCTTTCAAGGCCCCAATTTCCTCCTGTCAAATGAAGAGCTGGAAGG
AGTCAGTGATTTTTCAGTGGGCTCCAGGGACCCTCCAGGTCATCCCTAATGTGCCCTGAACTTATTGGGGGTATACCAAGGAGTGACCTGGACCCCTGGCTGTGAAGGAAGGAAGATAGA
AAAAAAAAAATGGCACTCTTAACTACTTGTTCCTTTGGGTTTTACTGTGTAGTCACAGTCACCACTGAACAGTCCCATCTTAGCTTTCCCATGACTTTCCTTAGTGCCATTTCATCATAA
TCCTGACATCTTTCCTAGCCTGTGTGCACCTTTGGGAAAATTAGCAATAGGTGCCCCTCTCTGGATGGACAAATTATAAGCCACCCCTGTGGATACAGCCCTGGGCCAGGGCCCAGGGTT
TCATGAGTTGGGGGGGACTCCCCCCCACAGCACTGGCAGGGCTCTGCAGGCACAGGGCTGGAGCGAGGGAGAGGCAACTGGGCAACCATGCTCTACTCTGCTCTGGGAGAGGGGGACCAT
CAGCTTGAAAGCCCTGGGCTGCCCGAGGACCTGGGGTTCTCCTGTCCTGCTGGGCGGTGGCTGCCATGGTCCTCGCGCATCCAGGGAGCTGCAGGCACAGTGTCCATGGTGTTCCCCGTG
CAGGTTTTGGTGGGAGAACAAGGGCGTGTTCAGCACGCAGCAGCAGCAAGCCCTGGCCAACATCTCCTTGCCCCGCATCATCTGCGACAACACAGGCATCGCCACTGTGTCCAAGAACAA
CATCTTCATGTCCAACTCGTTTCCCCGGGACTTTGTCAACTGTAGCACACTTCCTGTGCTTGACCTGGCTGCCTGGAGGGATGCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTTCTCTCAGCCCTAGCAGGGCTCCTGGCCATTCTGGCCATGTCCCAGCCCTCTGAGGGTGCTGCTCCAGCTATCCCAGGGGAGGTGGAGACCTCGGTGGTGCTGACCTGCATG
AAGGAGGCCAAGAGGCTGGTGGACAAGGCCTACAAGGAGCGGAGGGAAAG
CATCAAGCAGCGGCTTCGCAGTGGCTCAGCCAGCCCCATGGAACTCCTGTCCTACTTCAAGCAGCCTGTG
GCTGCCACCAGGACTGCCGTGAGGTCTGCTGACTACCTGCATGTGGCTCTAGGCCTGCTGGAGGTGAAGCTGCGGTCCCTGTGGCCAGGGCCCTTCAATGTTACCG
ATGTGCTGACGCCG
GCGCAGCTGACTCTGCTGTCGAAGTCAAGCGGCTGCGCCTACCAGGATGTGGCCGTGACGTGCCCAGAGCAGGACAAGTACCGCACCATCACTGGGCGGTGCAATAACAG
GCGCAGCCAG
ACGCTGGGGGCCTCCAACCGCGCCTTTGCGCGCTGGCTGCCGGCGGAGTATGAGGACGGCTTCTCTCTGCCCTTTGGCTGGACCCCGGGGGTCAAGCGCGCCGGCTTCCCGGTGCCCCTG
GCTCGTGCGGTCTCCAATGAGATCGTGCGCTTCCCCACGGAGCAGCTGACCCCGGACCAGGAGCGCTCGCTCTTGTTCATGCAGTGGGGCCAGCTGATCGACCACGACCTCGACTTCACC
CCGGAGCCAGCCGCCCGGGTCTCCTTCCTCACTGGCCTCAACTGTGAGACCAGCTGCCTGCAGCAGCCGCCTTGCTTCCCGCTCAAG
ATCCCACCCAATGACCCTCGCATCAAGAACCAA
CAAGACTGCATCCCCTTCTTCCGCTCCTGCCCGGCCTGCACTGAGAGCAACATTACCATCCGCAACCAGATCAACGCGCTCACCGCCTTCCTGGACGCCAGCATGGTGTACGGCAGCGAG
GACCCCTTGGCCATGAAGCTGCGTAACACCACCAACCAGCTAGGGCTGCTGGCCGTCAACACCGACTACCAAGACAACGGCCGGGCCCTGCTGCCCTTCGACACTCTGCACGATGACCCC
TGTCTCCTCACCAACCGCTCTGTGCGCATCCCCTGCTTCCTGGCAG
GGGACACCCGCTCCAGTGAGATGCCCGAGCTCACCTCCATGCATACCCTCTTTCTGCGGGAGCACAATCGACTG
GCCACACAGCTCAAGCGCCTGAACCCCCGCTGGGATGGAGAGAAGCTCTACCAGGAAGCCCGGAAGATCGTGGGGGCCATGGTCCAG
ATCATCACTTACCGGGACTACCTGCCCCTGGTG
TTGGGGCCAGAGGCCATGAGGAAGTACCTGCCCAAGTATCGTGGCTACAATGACTCAGTAGACCCACGCATTGCCAATGTCTTCACCAACGCCTTCCGCTATGGCCACACTCTCATCCAA
CCCTTCATGTTCCGCCTGGATAATCGGTACCAGCCCATGGGGCCCAACCCCCGCGTCCCACTCAGCAAGGTCTTTTTTGCCAGCTGGAGAGTAGTGCTGGAAG
GTGGCATTGACCCCATC
CTCCGGGGCCTCATGGCCACTCCTGCCAAATTGAATCGGCAGAACCAAATTGTGGTCGATGAGATCCGAGAGCGATTGTTTGAGCAGGTCATGAGGATCGGGCTGGACCTGCCAGCTCTG
AACATGCAGCGAAGCCGGGACCACGGCCTCCCAG
GGTACAACGCCTGGAGGCGCTTCTGTGGACTAACGCAGCCTAGCACGGTGGGTGAGCTGGGCACGGTGCTGAGGAACTTAGACTTG
GCAAGGAAGCTGATGGCACAGTACGGCACACCCAACAATATTGACATCTGGATGGGCGGTGTGGCTGAGCCCTTGAAACCTGGTGGCCGTGTGGGCCCCCTCCTCGCCTGCCTCATTGGC
ACCCAATTCAGAAAGCTCCGGGATGGCGATAG
GTTTTGGTGGGAGAACAAGGGCGTGTTCAGCACGCAGCAGCAGCAAGCCCTGGCCAACATCTCCTTGCCCCGCATCATCTGCGACAAC
ACAGGCATCGCCACTGTGTCCAAGAACAACATCTTCATGTCCAACTCGTTTCCCCGGGACTTTGTCAACTGTAGCACACTTCCTGTGCTTGACCTGGCTGCCTGGAGGGATGCCTAG

Retrieve as FASTA