Entry information : PpyMPO
Entry ID 7801
Creation 2010-11-30 (Myriam Duval)
Last sequence changes 2010-11-30 (Myriam Duval)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-08-16 (Christophe Dunand)
Peroxidase information: PpyMPO
Name PpyMPO
Class Myeloperoxidase    [Orthogroup: MPO001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Hominidae Pongo
Organism Pongo pygmaeus (Orangutan)    [TaxId: 9600 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpyMPO
start..stop
S start..stop
PabeMPO 1533 0 1..745 1..745
HsMPO 1507 0 1..745 1..745
PtroMPO 1454 0 1..745 1..745
GgoMPO 1454 0 1..745 1..745
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33869318..33869471 154 N° 2 33869617..33869710 94 N° 3 33870058..33870233 176 N° 4 33870426..33870549 124
N° 5 33870647..33870776 130 N° 6 33870859..33871065 207 N° 7 33871929..33872247 319 N° 8 33874367..33874527 161
N° 9 33876378..33876633 256 N° 10 33877129..33877299 171 N° 11 33878156..33878393 238 N° 12 33879185..33879392 208
join(33869318..33869471,33869617..33869710,33870058..33870233,33870426..33870549 ,33870647..33870776,33870859..33871065,33871929..33872247,33874367..33874527,338 76378..33876633,33877129..33877299,33878156..33878393,33879185..33879392)


exon

Literature and cross-references PpyMPO
Protein sequence: PpyMPO
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   745 (697)
PWM (Da):   %s   83562.7 (78668.1)  
PI (pH):   %s   8.99 (9.22) Peptide Signal:   %s   cut: 49 range:49-745
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVLVFSSLRCMVDLGPCWAGGLTAEMKLLLALAGLLAILATPQPSEGAAPAVLGEVDTSLVLSCMEEAKQLVDKAYKERRESIKQRLRSGSASPMELLSYFKQPVAATRTAVRAADYLHVALDLLERKLRSLWRRPFNVDVLTPAQLNVLSKSSGCAYQDVAVTCPEQDKYRTITGMCNNRRSPTLGASNRAFVRWLPAEYEDGFSLPYGWTPGVKRNGFPVPARAVSNAIVRFPTDQLTPDQERSLMFMQWGQLLDHDLDFTPEPAARASFVTGVNCETSCVQQPPCFPLKIPPNDPRIKNQADCIPFFRSCPACPGSNITIRNQINALTSFVDASMVYGSEEPLARNLRNMSNQLGLLAVNQRFQDNGRALLPFDNLHDNPCLLTNRSAGIPCFLAGDTRSSEMPELTSMHTLLLREHNRLATELKSLNPRWDGERLYQEARKIVGAMVIITYRDYLPLVLGPTAMRKYLPTYRSYNDSVDPRIANVFTNAFRYGHTLIQPFMFRLDNRYQPMEPNPRVPLSRVFFASWRVVLEGGIDPILRGLMATPAKLNRQNQIAVDEIRERLFEQVMRIGLDLPALNMQRSRDHGLPGYNAWRRFCGLPQPENVGQLGTVLRNLKLARQLMEQYGTPNNIDIWMGGVSEPLKRNGRVGPLLACIIGTQFRKLRDGDRFWWENEGVFSTQQRQALAQISLPRIICDNTGITTVSKNNIFMSNSYPRDFVNCSTLPALNLASWREAS

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 17). Available from Ensembl.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGTTCTCGTCTTCTCTTCTCTCAGATGCATGGTAGACTTAGGACCTTGCTGGGCTGGAGGTCTCACTGCAGAGATGAAGCTGCTTCTGGCCCTAGCAGGGCTCCTGGCCATTCTG
GCCACGCCCCAGCCCTCTGAAGGTGCTGCTCCAG
GTAACAGTTCCCAAGGTGGGAGAAGATGGTGTGTTGGGGTGGTTGTGTTCCAGAGACCCCTTTTCTCAGAGCAGGACTTCCTAGCT
CTGGGGCCTGATAGGGGGTTGGGGCCCATTCCTGACTTTGTGATCCCTGCTCTGGGCAGCTGTCCTGGGGGAGGTGGACACCTCGTTGGTGCTGAGCTGCATGGAGGAGGCCAAGCAGCT
GGTGGACAAGGCCTACAAGGAGCGGCGGGAAAG
GTGGGGCACGAGGCACTGCCCAGCTCTGGGCAAGGATGTCCCAGGCCTTTCAGAGAAGCAGCAGGCAGCAGGGAGCTTGAAGGTGGG
AGAGGGGGACTATGGGGACCCATGTGGACTCCCTTTCTGTCTGTCCCTGTGTCTCTGGATGGGAGAACAGCTTAAAAGCCATCCTTCCCAAAGCCTTGCCTCTGTCTGGACACCCAGGTC
CATATCCTTTTTATAAAAGGAAGCCTTCCTCCCACCCATGGGCCTGCCTGCATGGTCCTGCATGTCTGCCCCTGGGCTGGGGCTCTGCTGGGTGGGTCTGCATCCCTTCTCTGGCCCTCA
CTCCTCCTTTCTCCAAGCAGCATCAAGCAGCGGCTTCGCAGTGGCTCAGCCAGCCCCATGGAACTCCTGTCCTACTTCAAGCAGCCGGTGGCAGCCACCAGGACGGCAGTGAGGGCTGCT
GACTACCTGCACGTGGCTCTAGACCTGCTGGAGAGGAAGCTGCGGTCCCTGTGGCGAAGGCCATTCAATGTCACTG
GTACTGTTGCCCATCCCACCCCAGGTCCCTGCTCCACTAGTGAC
TCCTCCTAGGGACCCCAGCCGTCTCTCAGTGATCCCCTCAACTTCTTCCTCCAGGGATTCTCAGGGGTCTCCAGGGCTCCTCAGCCTCAGGTTGCCTGGGATAGGAAGTGAGGCGGCTCA
GCTCCCCCGTTGTTCTTTGCCCCCGCAGATGTGCTGACGCCCGCCCAGCTGAATGTGTTGTCCAAGTCAAGCGGCTGCGCCTACCAGGACGTGGCGGTGACTTGCCCGGAGCAGGACAAA
TACCGCACCATCACCGGGATGTGCAACAACAG
GTGCGGCTGGCTGGGGGTGGCTGCAGGAACCGGGCTCAGAGAGGCGTCCGGGACGCCACAAGCCTCCCGGTGTCAGCGCCCTGTGCTC
CCTTTGCAGACGCAGCCCCACGCTGGGGGCCTCCAACCGTGCCTTTGTGCGCTGGCTGCCCGCGGAGTATGAGGACGGCTTCTCGCTTCCCTACGGCTGGACGCCCGGGGTCAAGCGCAA
CGGCTTCCCGGTGCCTCTG
GTGAGCGCCGGCGGGCAGAGAGGGCGAGGCCCGGCCACGTGGTGCGCGGACCCAGGCGCCAGCTGACCTCCGTGTCCCGCAGGCTCGCGCGGTCTCCAACG
CGATCGTGCGCTTCCCCACCGATCAGCTGACTCCGGACCAGGAGCGCTCACTCATGTTCATGCAATGGGGCCAGCTGTTGGACCACGACCTCGACTTCACCCCTGAGCCGGCCGCCCGGG
CCTCCTTCGTCACTGGCGTCAACTGCGAGACCAGCTGCGTTCAGCAGCCGCCCTGCTTCCCTCTCAAG
GTGGCCCTGCTTCCCGCCCACTGCCTGGGTGGGGAGAGGGGAGATTGTTTCT
GGAAGGGGCCGTCTCCCTTCTGTGCCCAGGTTTCCTTTCCCAGCCGCTGAGAAAGGCTGGCCCTGCCTCCCTTGTGTCCACAGGCACTGGCTGCTCAGCTATGACCTGTCTCCTTCCTGC
GCCTGGGCTCAGCCAGCTGGCAGCCAGGGCCGTCCATTTGCTCACTGCCTCTCGCAGGCCAAGGGAGAGAGGGTTGTTCCTCCTTGGCTGACAGGAGTCGTGTTGGTGGAATCACTGGCT
CTTTGTTAGGTTGGGAGAGGGTTCTGGGAGGAGACCTTCCCAGTGCCCCCCAAGCCTCCATGCTCAGTCCTGTTTCCTCCCCACTGAGGGGGCAGCCCCAACCCCCATCACACAGAAAGA
GAGAGCCTGGGGGTCTGGTGGGTGCTGTGGGACAGGGCTGGGAGTGGGCAGGGTGGTCGAGGCACTGCTGAGTAGGGAAGGAGGAGGAGAGAAAGGAGAGAGCGCCTGAGAGAGGGAGAG
ACAGACAGGAGAATGTCAGGGCCAGAGAGAGAGCAGGCACAGCAGAGAGAAGGGGAGAGAGACAGGCGACGCTTTAGTGAGGAGGGGTCCGAGGCCTGGCGGTGCCCAGACCCAGGGATT
GCCCAGGTTCCCAGTTCAGTGTTCTGCTCATTAACCCTGCACCTCAGAGACTGCTGCTGATGGCGCCCTAGGCAGCGATCCCTTTCCGGCCTCCAGAGGCCTCTCTGCAGGTTGAGGGTA
CCAGAGGTCCTGAGGGCAGGGGGAGAGCCAGTTCTGCCTGGGCACCTTCCCTGCCCTCGGTGAGCCAGTCTAGCCTCTCTCTGTGCCTCAGATCCCGCCCAACGACCCCCGCATCAAGAA
CCAAGCCGACTGCATCCCGTTCTTCCGCTCCTGCCCGGCTTGCCCCGGGAGCAACATCACCATCCGCAACCAGATCAACGCGCTCACCTCCTTCGTGGACGCCAGCATGGTGTACGGCAG
CGAGGAGCCCCTGGCCAGGAACCTGCGCAACATGTCCAACCAGCTGGGGCTGCTGGCCGTCAACCAGCGCTTCCAAGACAACGGCCGGGCCCTGCTGCCCTTCGACAATCTGCACGATAA
CCCCTGTCTCCTCACCAACCGCTCAGCAGGCATCCCCTGCTTCCTGGCAG
GTCAGCTTTGGGGTGGGGACCAGGGGTGGCATAGGAGGTGTTCCCTGTTGGAGCCACAGTGAGTCTGTTT
GTGAGCAGCTTGTGGGTTTGTACTTAGAGAGACTGTCCTCACCAGCCATTACTATCAAGTTCATGATATTAATCCAGTTGCCTTGGTAACAAGTCAGATGGAGCCAGAAAAGCAGAAAAG
CAAACAACCTCTCCAACCTTAAGATGAAGACCGAGGCATGGCCCAGGAGCCTCTGTCCATCAGTCCATTGCTTTCTCTGTCCCTCTTTTCCCTTCTGGACTCTGGAAGAAAGGACAGTCA
AATCCCTCAGGGGTGGGGAACTAAAGCACAGAGAGCGCTGTGGTGTCCTCACCTTCTAAAGCGACACTATCCAATGTGGTAGCCACTAGCTGCATGTGGCTATTTTAATTTTAGTTATTT
TAAATTAAATAACTTTCTCAGCGATGCTAACCACATTTCAAATGCTCAATTGCCTTACAGTCTAGTGGCTCCCCCTATTGGGTGGCACAGATGTAAAATATTTTCATCATCTGGGAAGGG
TGAGTTGGACCACACTGCTCCAAAATATCCCCTCCTGTGCATCTTAATTGCCCATAATAAGGGATGATGGGATTTTAAATGTAAACAATTGGCAGTTTTGGAGACACAATTGGGGCAGTG
ATGGCAGCCATGACCAGACATTTTCCAGTGTTTTTTTTTTTTTTTTCTAAGACGCAATCTCACTCTGTCACCCAGGCTGGAGTACAGTGGCACAGTCTCGGCTCACTGCAACCTCTGCCT
CCTGGGTTTAAGCGATTCTTCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGGTGCCTGCCACCATGCTTGGCTAATTTTTTGTATTTTTAGTAGAGATGGTGTTTTACCATGTTGGCC
AGGCTGGGATCAAACTCCTGACCTCATGATCTGCCCACCTTAGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCGCACCCACCCATTTTCCAGTGTTTTTAAATGTAAACCCAAT
AGTGGACCTCAGGCCCTTTCCTCTGGCCTCCCTCTGCCTCCTCCTGATGGTTCCTGCTGGTCTCTCCCTGGCTGGGACCCTGGGAGGCGGAGCCAGGTTGGACTTTCTGCAAGAGATGCC
CGACCTCTTCTGGGCTAGTTAGGCAAGGGCAGCCCTCCTTAGCCAGACTCAGCTGCCCCCAGCCTGGCTTTGATGAGCCCCATGTCCCAAGCCTGGGTCATTATGACCTCTAGCTGCTCA
TGGATGGAGATGCTGCTTTTAGAGAATTTCCTTTCCACCAGCTTCTAGAGCTGGCAAGGACTGACCCTAGTGTCCTGACCCTAGCCCTCTGGCCCCTGCAGAGAAGCATTGTGGGAGGAC
TAGGGGAACCAGGGGGGATCTGCTTAGTTTTCTTGAACAGTCTCCCGTGTGGACTCCACACATATCGTGTCCTAGCCCCTCCCCTGGGGCAGGCTGCACCATTGGAATGTAGTAAAGGGC
AGGGCTAACAACTCTGTTCAAACGGTAGTGGCTTTCTGGAGTCCTGTGTTGAGAAGGATTCTGAGGTTGCATCCAATTTTAGCAGGAAAGAGTGCTGTGATCATTAGCTGCATCAGACAT
GGGCATGGATGTAGGCTGTGCCGACATGCATGCTTCTTCCCAGACACTGCTTGGAATCAAGAGAATCAATGAACCAAGCAGTGTCATAAGTCTCATACTTTGTATCAGGCACTCTGTGAA
GCCCCATGTATCCACGTGTCCTAGGAGGGAGGGTAAAATATAAAAAGGCACAAGCCTTGGTCCTGTGCTCAAGGAGCTCCCAGTTTCAGGTACAGGAAAGTGGCATGTCATGTGTTGGAA
GTGATACCTATTAAATGAGCATCCCCAACCAGCAGTGGCCCTGAGCTGAGGCAGAAGCTATTATTGTGGACTGGGGCATCAGGGCAGGCCTCCTAGAGGAGTGTAAATTGGGGATGGTTT
GAAAAGATGGATGGGGAGGAGGGGTGAGTAGGAGGCATTTCAGGCCTTGGCTGGGGAGGGGGTTTCAGTGGAGCAAATCTTTTCTGGGATGGAGACCTTAAGAATGACAGTGGCTTTTGC
CTCCCCAAGGGGACACCCGTTCCAGTGAGATGCCCGAGCTCACCTCCATGCACACCCTCTTACTTCGGGAGCACAACCGGCTGGCCACAGAGCTCAAGAGCCTGAACCCTAGGTGGGATG
GGGAGAGGCTGTACCAGGAAGCCCGGAAGATCGTGGGGGCCATGGTCCAG
GTAGGCCATCTTGAACACCGGGCACACGGGATCCAGATGTGCCCCTGCAACATCCTAGCTGTGTGACCTT
GGGCAAGTTCCTAACCCTCCTGAGCCTTGCCTTCTTCATCCATGAGGCTGTAAGGATTATAATACATATATGAAAACACCTTTCAGATAGTAAGTGCTTGACAAAGCCTCCTTCCCTTTC
CTCTCCTTCTTCGCGGGTTTGCTCCCTGCAGTCTTCTTTCCTGTGGGTCTGTTATTGGTGTTGGGAGGGTTGAATGTTTGGTTTAGTGCCTGAGTAGCTGTTCAGTAAATTCTTCTTTCC
TCCATCTCACTGTCGCTCTTAGCTCCTTTACCCATTCACCTCTTCTTTTTAAAATTAAAAAAATTATAGGGCTGGGCGCAGTGGCTCATGCCTATTATCCCAGCACTTTGGGAGGCCGAG
GCGGGTGAATCACGAGGTCAGGAGATCGAGACCATGCTGGCTAACACAGTGAAACCCTATCTCTACTAAAAATACAAAAATTAGCCGGGCGTGGTGGCGGGCACCTGTAGTCCCAGCTAC
TTAGGAGGCTGAGGCAGGAGAATGGCGTGAACCCGGGAGGCAGAGCTTGCAGTGAGCTGAGATGGCGCCACTGCACTCCAGCCTGGGTAACAGAGCGAGATTCCATCTCAAAATAAATAA
ATAAATAAAATAAAATTTAAAAATTATTATTATTATTTTATTTTTATTTTTTGATACAGGGTCTTACCCTCTTGCCCAGGCTGGAGTGCAGTGGTGCGATCTTGGCTCACTGCAACCTCC
ACCTTTCAGGCTCAAGCCATTCTCCCATCTCAGCCTTCTGAGTAGCTGGGATTTCAAGCACGGGCCACCACGCCCGGCTAATTTTTGTATTTTTTGTAGAGACAGGGTTTCGCCATGTTA
CCCAGTGTGGTCTCAAACTCCTGGGCTCAAGTGATCTGCCCTCCTCGACCTCCCGAATCCCTGGGATTACAGGGGCGAGTCACTGTGTTCGGCTCACTCACCTCTTCTTTTTGGCTCTGT
CATAATCCACCCAATGTCCTTAGCCTCATTTACTCCTGGGGCAATGTTCCTGGTTCTGTCTCTCAACATCTGGTGCTTCATTGCCCCCACCCTCTCCCTCAGAGGCAGATGCAGACACAC
ACACACACACTCACACACACACACTCCTAGATTCTGGAGGAGAGAGTTTTCCGTGCTAAGGGTGAGTTTTTGATTTGCACTAAGAACTCAAGTGAAATTCATTTACACTCCAAAATAACT
TCTAGACTCTAGAATGTAGAGTGAGACTATTCCATGTCTTCACTTTTCACAGGGAAAATCATGCCAGAATGGCCCTTCATTCCTTCCTACCTCCCTGCTTTCCACAAACCTAAACTGAGC
CCTACTGTGGGCAGGCACTTGGTGGGCACTGTGAAGAATTTCAACAACTTCAATTTCCCTTGCTCTCAAGGACTTTATAAGATAGTTGCAGAAATGAGACATTAATAACTTGAGGACAAG
GAAGTCATCACAATGACTAAAAGTGATTTGCTATTTAGTCCTCTAAGGCAGAGGGCAATATAATTATCCCTAATGTACATTTGAGGAACTCAGGCTCAGAGAGGTTAATAACCGGTCCAA
GGTCACCCAGCCAGCAAGCAGTAGAACTCTATTTATGCCTCTCAGTGCCACTCTGTTAGGCCCAGGTCCGGTATTGTGGGAGGCTATTCCCTGACCATAGAGGGATGGGAGGGGTCCCCG
AAGCCAAGAGCAGGCAGAGACTCTGGCCCTCCTGTGCTGCCAGGCGGCATTTGCTGTGGAGGAGTGGGTGGAGAGGTCATTCCAAATGACTTGTCTTTAGATCATCACTTACCGGGACTA
CCTGCCCCTGGTGCTGGGGCCAACGGCCATGAGGAAGTACCTGCCCACGTACCGTTCCTACAATGACTCAGTGGACCCACGCATCGCCAACGTCTTCACCAATGCCTTCCGCTACGGCCA
CACCCTCATCCAACCCTTCATGTTCCGCCTGGACAATCGGTACCAGCCCATGGAACCCAACCCCCGTGTCCCCCTCAGCAGGGTCTTTTTTGCCTCCTGGAGGGTCGTTCTGGAAG
GTAA
GCAGGACCTAGGCCAGGAGCGAGTGGGCTGACAGCTAAAGGTGGGGTAGGGGTCACCTTGGCTCTAGGGAGCTAGGATGGGGAGCAATCTGCTTTCCTTCCATCTTGGAGATCTGGTCTG
ACTCTCCAGCCTCAGTTCCTCTGACTCTGCTTCCATATCTGATAATAAACAGTGGGGTGGGGATGGCCCTCAGAGAGAACTGGCTACTTCTCATGTGTTGTGGCTCGCTGTGACCCAGCA
AGCCAGGGCCTGGGAGCATCCCAATCTTGCAAGTCTGAATGGCATAATCTCCTGAGACCTATATGCCCCTGGGGTCATGTAGTGACCGGTGAGGACCTGCTCACTGGGGCCACCACCTTG
GCACCAGGCACTGCATGTGCCCAGCCCTCTTCTCGAATCCTCCTGACCCTACCTGGACTTGTCCCTGACTCCAATCTGAGCTCTGATACTGAGCCAGATACTTCCCCTGACCTGGCTTCT
CTGGTCCCCAGGTGGCATTGACCCCATCCTCCGGGGCCTCATGGCCACCCCTGCCAAGCTGAATCGTCAGAACCAAATTGCAGTGGATGAGATCCGGGAGCGATTGTTTGAGCAGGTCAT
GAGGATTGGGCTGGACCTGCCTGCTCTGAACATGCAGCGCAGCAGGGACCACGGCCTCCCAG
GTGAGGGGCTGCAGGAGCCTCCCCTGATGCTCCCCTCCCCTGAGCTGCCTCCCAGGTA
GCCCATCACCCCCCTTCCCACTCTAGGGCCCCTGCCCTCTCCAAAGCATATTAGAGGCACTTTGCTCTCAGGAAGTAGTGTGATGCCAGGCCCCTGCCTTTTCCTGGACCCACCTGATAA
ATTTCCAGCTCCTCTCAACATCCTTTCCATGCTGTAATTCTCATATTAGGGGCATCATCATTATAATGATAACCCACAGTCTGAAAATCTGTCTCTGTCATCATTCCATTTTGCTTCATT
GTACGTTAACTCTGGGGGAAGAGATTATTGTTGCCTTCATTTTGCTGATGAGGAAACTGAGGCTTGATGAGATTCAGAACCTGGCCAGGCTCTCTAGCCAAGTCAGTGGCAAAGCTGAAA
TTTGAAGCCAGGTTAGCCTAACCCCAAAGCCTGTGCCTATGTTATGGGGTAGCCCATGTGGCTGAGGCTTCTGGACACATTTCACCTCTCATGGGTCAGAGACAGACACATTGGGCTGCT
CTGGAGGGGGACAAGGAGATGTCCCTATTCTTGGACCCAGCAGGAACTGTGGCAGTTTAGGGTTTGCCTTATGGTAGGAGGGCAAGAGAAAGACAGACAGGGTCCCAGAGAGGCCCAGTT
GTGCCCCTTGGTCTAAGCCAAAGGTTCAGGGTTCCCTGAGGTGAGGTCCTTCCCTCCCTCTATGCCCTTGGTTATGTTGGGAAGGTGGGTTTTCTGGGCTGCTGGCAGATATGTGAATCT
TCCCTGCTGTCTCCAGTGACCTCCCCACCTTGAAGCAGAGGGACCTGCCCATAGCCACCTGTCCCCTCCCCCATGCAGGATACAATGCCTGGAGGCGCTTCTGTGGGCTCCCGCAGCCCG
AAAATGTGGGCCAGCTGGGCACGGTGCTGAGGAACCTGAAATTGGCGAGGCAACTGATGGAGCAGTATGGCACGCCCAACAACATCGACATCTGGATGGGCGGTGTGTCCGAGCCTCTGA
AGCGCAACGGCCGCGTGGGCCCACTCCTCGCCTGCATCATCGGTACCCAGTTCAGGAAGCTCCGGGATGGTGATCG
GTGAGGAGGGGCAGGCGTCATGGGCCGCTGGGTGGCTGTGGGCC
CATCCCTGACTCTCTTGGAGCCCAAATTTCCTCCCGTCAGTTGAAGGACTGGAGGGAGTCAGTGATTTTCCAGTGTGTTCCAGGAATCCTTCAGATGCCCTGGAGTGCCCCTAATGTGCC
CTGAACCTGTTGGGGGTGCAGCAAGGGGAGACCTGGACCCCTGCTTGTAAAGGGAGGAAGATAGAAAAATGCCACCCTTAGCTACTTCTTCCCGTGGGTTTCACTGTGCAACCATGTGGG
TGTCAGTCACCAGTGGGCAGTCCCCTCCCAGCTTTCCCACAGCTCCCCTTAGTGTCATTTCCTCGTGGTCCTGACGTCTTCATGTCTAGTTCTTGCTTAGCCTGTATTGCACCTTTGGGA
AAATTAGAAAAAGGTACCCCTCTCTGGGTGGACGAATTATAAACCACCCCCAAGATTCTCTTCTACTCCTGTGGATGAAGCTCCTGGCCAGGGCACAGGGCTTCAGGAGTGTGTATGGGC
CCGGGTCCCCCTCCACCATGGTGCCTTGGAGGCCGCCGGGCTAGGGGTAAGGGAAAGGCCACTGGGCAGCTGTGCTTTACTCTGCACGATGAGTGGAGCATCACTTGTGTGAAAGCCCCT
GGGCTGCCCAAGGGCCTGGGGCCCTCCTGTGCTGCCAGGTGGCATTTGTTGTGGCTTTGTTATATCCTGGGAGCAGCACAAGCCCATCGATGCCCTGCCAGCGCAGAATATCCTTGGGCA
CAGTGTCCATGGGTGTTCCCCATGCAGGTTTTGGTGGGAGAACGAGGGTGTGTTCAGCACGCAGCAGCGACAGGCCCTGGCCCAGATCTCATTGCCCCGGATCATCTGCGACAACACAGG
CATCACCACCGTGTCTAAGAACAACATCTTCATGTCCAACTCATATCCCCGGGACTTTGTCAACTGCAGTACACTTCCTGCATTGAACCTGGCTTCCTGGAGGGAAGCCTCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGTTCTCGTCTTCTCTTCTCTCAGATGCATGGTAGACTTAGGACCTTGCTGGGCTGGAGGTCTCACTGCAGAGATGAAGCTGCTTCTGGCCCTAGCAGGGCTCCTGGCCATTCTG
GCCACGCCCCAGCCCTCTGAAGGTGCTGCTCCAG
CTGTCCTGGGGGAGGTGGACACCTCGTTGGTGCTGAGCTGCATGGAGGAGGCCAAGCAGCTGGTGGACAAGGCCTACAAGGAGCGG
CGGGAAAG
CATCAAGCAGCGGCTTCGCAGTGGCTCAGCCAGCCCCATGGAACTCCTGTCCTACTTCAAGCAGCCGGTGGCAGCCACCAGGACGGCAGTGAGGGCTGCTGACTACCTGCAC
GTGGCTCTAGACCTGCTGGAGAGGAAGCTGCGGTCCCTGTGGCGAAGGCCATTCAATGTCACTG
ATGTGCTGACGCCCGCCCAGCTGAATGTGTTGTCCAAGTCAAGCGGCTGCGCCTAC
CAGGACGTGGCGGTGACTTGCCCGGAGCAGGACAAATACCGCACCATCACCGGGATGTGCAACAACAG
ACGCAGCCCCACGCTGGGGGCCTCCAACCGTGCCTTTGTGCGCTGGCTGCCC
GCGGAGTATGAGGACGGCTTCTCGCTTCCCTACGGCTGGACGCCCGGGGTCAAGCGCAACGGCTTCCCGGTGCCTCTG
GCTCGCGCGGTCTCCAACGCGATCGTGCGCTTCCCCACCGAT
CAGCTGACTCCGGACCAGGAGCGCTCACTCATGTTCATGCAATGGGGCCAGCTGTTGGACCACGACCTCGACTTCACCCCTGAGCCGGCCGCCCGGGCCTCCTTCGTCACTGGCGTCAAC
TGCGAGACCAGCTGCGTTCAGCAGCCGCCCTGCTTCCCTCTCAAG
ATCCCGCCCAACGACCCCCGCATCAAGAACCAAGCCGACTGCATCCCGTTCTTCCGCTCCTGCCCGGCTTGCCCC
GGGAGCAACATCACCATCCGCAACCAGATCAACGCGCTCACCTCCTTCGTGGACGCCAGCATGGTGTACGGCAGCGAGGAGCCCCTGGCCAGGAACCTGCGCAACATGTCCAACCAGCTG
GGGCTGCTGGCCGTCAACCAGCGCTTCCAAGACAACGGCCGGGCCCTGCTGCCCTTCGACAATCTGCACGATAACCCCTGTCTCCTCACCAACCGCTCAGCAGGCATCCCCTGCTTCCTG
GCAG
GGGACACCCGTTCCAGTGAGATGCCCGAGCTCACCTCCATGCACACCCTCTTACTTCGGGAGCACAACCGGCTGGCCACAGAGCTCAAGAGCCTGAACCCTAGGTGGGATGGGGAG
AGGCTGTACCAGGAAGCCCGGAAGATCGTGGGGGCCATGGTCCAG
ATCATCACTTACCGGGACTACCTGCCCCTGGTGCTGGGGCCAACGGCCATGAGGAAGTACCTGCCCACGTACCGT
TCCTACAATGACTCAGTGGACCCACGCATCGCCAACGTCTTCACCAATGCCTTCCGCTACGGCCACACCCTCATCCAACCCTTCATGTTCCGCCTGGACAATCGGTACCAGCCCATGGAA
CCCAACCCCCGTGTCCCCCTCAGCAGGGTCTTTTTTGCCTCCTGGAGGGTCGTTCTGGAAG
GTGGCATTGACCCCATCCTCCGGGGCCTCATGGCCACCCCTGCCAAGCTGAATCGTCAG
AACCAAATTGCAGTGGATGAGATCCGGGAGCGATTGTTTGAGCAGGTCATGAGGATTGGGCTGGACCTGCCTGCTCTGAACATGCAGCGCAGCAGGGACCACGGCCTCCCAG
GATACAAT
GCCTGGAGGCGCTTCTGTGGGCTCCCGCAGCCCGAAAATGTGGGCCAGCTGGGCACGGTGCTGAGGAACCTGAAATTGGCGAGGCAACTGATGGAGCAGTATGGCACGCCCAACAACATC
GACATCTGGATGGGCGGTGTGTCCGAGCCTCTGAAGCGCAACGGCCGCGTGGGCCCACTCCTCGCCTGCATCATCGGTACCCAGTTCAGGAAGCTCCGGGATGGTGATCG
GTTTTGGTGG
GAGAACGAGGGTGTGTTCAGCACGCAGCAGCGACAGGCCCTGGCCCAGATCTCATTGCCCCGGATCATCTGCGACAACACAGGCATCACCACCGTGTCTAAGAACAACATCTTCATGTCC
AACTCATATCCCCGGGACTTTGTCAACTGCAGTACACTTCCTGCATTGAACCTGGCTTCCTGGAGGGAAGCCTCCTAG

Retrieve as FASTA