Entry information : BdiPrx27 (Bradi1g39190)
Entry ID 7809
Creation 2011-01-06 (Toky Ramarohetra)
Last sequence changes 2011-01-06 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx27 (Bradi1g39190)
Name (synonym) BdiPrx27 (Bradi1g39190)
Class Class III peroxidase    [Orthogroup: Prx079]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx27
start..stop
S start..stop
TaPrx28 486 4e-175 23..325 25..322
BdiPrx26 437 1e-155 22..325 24..321
SiPrx40 431 5e-153 3..326 4..327
ZmPrx117 423 5e-150 3..325 4..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35745187..35745402 216 N° 2 35745535..35746299 765  
join(35745187..35745402,35745535..35746299)


exon

Literature and cross-references BdiPrx27 (Bradi1g39190)
DNA ref. Phytozome 11:   Bd1 (35745187..35746299)
Protein sequence: BdiPrx27 (Bradi1g39190)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (304)
PWM (Da):   %s   35073.84 (32696.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.92 (4.92) Peptide Signal:   %s   cut: 23 range:23-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSSSSWFALLLFVGLACTAANSNVLSAGYYEKTCPNVQGVVRSVMAHRVAGEPRMAPAVLRLFFHDCFVNGCDGSVLLDATPFSASEKDAEPNDSLTGFTVIDEIKSILEHDCPATVSCADVLALASRDAVALLGGPTWAVPLGRKDSRAAADPESTKNALPSPKDNLEELITMFAKHGLDASDMTALSGAHTVGMAKCESYRDRVYGIDNEHYIDPSFADARRQTCPLQEGPSDGKAPFDSQTPMRFDNAYYRDLTAHRGLLSSDQALYGGHGGMQDHLVEMYSTDGEAFARDFANAMVKMGNIPPPMGMPVEVRLHCSKVNY*

Retrieve as FASTA  
Remarks Complete sequence (Chromo 1, Intron 1), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCTCTTCTTCTTCTTGGTTTGCACTGCTCCTCTTCGTTGGTCTCGCCTGCACGGCGGCCAATTCCAACGTGCTCTCCGCGGGGTACTACGAAAAGACATGCCCAAACGTACAG
GGCGTCGTGAGGTCCGTGATGGCGCACAGGGTGGCCGGCGAGCCGAGGATGGCACCCGCAGTCCTCCGCCTCTTCTTCCATGACTGCTTCGTCAAC
GTAAGCATTTCAACATACTCATGC
ATGTCATGTTCTTCACTACCAAGTTACTCTCTCTGCGATCCTAAATTCTTGTCGTGTTTTTAGTTTTTATATATTGCTAAACGACCGTTCACAAATGATATATGACAGGGATGTGACGGC
TCTGTTCTCCTGGATGCCACGCCATTCTCCGCCAGCGAGAAGGACGCGGAGCCGAACGACTCGCTCACGGGCTTCACGGTAATCGACGAAATCAAGTCCATTCTCGAGCACGACTGTCCG
GCCACGGTCTCCTGCGCCGACGTGCTGGCCCTGGCGTCCCGCGACGCCGTGGCCCTTCTCGGAGGCCCCACCTGGGCCGTGCCGCTGGGCCGCAAGGACTCACGGGCCGCCGCTGACCCA
GAGTCCACCAAGAACGCGCTCCCGAGCCCAAAAGATAACCTGGAAGAACTCATCACCATGTTCGCAAAGCACGGCCTCGACGCCAGCGACATGACGGCGCTCTCGGGTGCGCACACCGTC
GGCATGGCCAAATGCGAGAGCTACAGGGACCGTGTCTACGGGATTGACAACGAGCACTACATCGATCCTTCCTTCGCGGACGCCAGGCGGCAAACGTGCCCGTTGCAAGAAGGCCCCTCC
GACGGGAAAGCGCCGTTTGACTCGCAGACGCCCATGAGGTTCGACAACGCCTACTACCGGGACCTTACCGCGCACCGCGGCCTTCTGTCCTCCGACCAGGCTCTCTACGGGGGGCACGGT
GGGATGCAGGACCATCTGGTGGAGATGTACAGCACCGATGGTGAGGCCTTCGCCAGGGACTTCGCCAACGCCATGGTCAAGATGGGGAACATACCACCACCCATGGGGATGCCCGTCGAG
GTCAGGCTCCACTGCTCCAAGGTCAACTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCTCTTCTTCTTCTTGGTTTGCACTGCTCCTCTTCGTTGGTCTCGCCTGCACGGCGGCCAATTCCAACGTGCTCTCCGCGGGGTACTACGAAAAGACATGCCCAAACGTACAG
GGCGTCGTGAGGTCCGTGATGGCGCACAGGGTGGCCGGCGAGCCGAGGATGGCACCCGCAGTCCTCCGCCTCTTCTTCCATGACTGCTTCGTCAAC
GGATGTGACGGCTCTGTTCTCCTG
GATGCCACGCCATTCTCCGCCAGCGAGAAGGACGCGGAGCCGAACGACTCGCTCACGGGCTTCACGGTAATCGACGAAATCAAGTCCATTCTCGAGCACGACTGTCCGGCCACGGTCTCC
TGCGCCGACGTGCTGGCCCTGGCGTCCCGCGACGCCGTGGCCCTTCTCGGAGGCCCCACCTGGGCCGTGCCGCTGGGCCGCAAGGACTCACGGGCCGCCGCTGACCCAGAGTCCACCAAG
AACGCGCTCCCGAGCCCAAAAGATAACCTGGAAGAACTCATCACCATGTTCGCAAAGCACGGCCTCGACGCCAGCGACATGACGGCGCTCTCGGGTGCGCACACCGTCGGCATGGCCAAA
TGCGAGAGCTACAGGGACCGTGTCTACGGGATTGACAACGAGCACTACATCGATCCTTCCTTCGCGGACGCCAGGCGGCAAACGTGCCCGTTGCAAGAAGGCCCCTCCGACGGGAAAGCG
CCGTTTGACTCGCAGACGCCCATGAGGTTCGACAACGCCTACTACCGGGACCTTACCGCGCACCGCGGCCTTCTGTCCTCCGACCAGGCTCTCTACGGGGGGCACGGTGGGATGCAGGAC
CATCTGGTGGAGATGTACAGCACCGATGGTGAGGCCTTCGCCAGGGACTTCGCCAACGCCATGGTCAAGATGGGGAACATACCACCACCCATGGGGATGCCCGTCGAGGTCAGGCTCCAC
TGCTCCAAGGTCAACTATTGA

Retrieve as FASTA