Entry information : BdiPrx25 (Bradi1g38310)
Entry ID 7811
Creation 2011-01-06 (Toky Ramarohetra)
Last sequence changes 2011-01-06 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx25 (Bradi1g38310)
Name (synonym) BdiPrx25 (Bradi1g38310)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx25
start..stop
S start..stop
TaPrx34 535 0 2..322 3..320
OsPrx88 517 0 21..322 20..318
SbPrx136 514 0 2..322 6..329
ZmPrx106 496 7e-179 28..322 32..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34494293..34494508 216 N° 2 34494634..34494825 192 N° 3 34494925..34495485 561  
join(34494293..34494508,34494634..34494825,34494925..34495485)


exon

Literature and cross-references BdiPrx25 (Bradi1g38310)
DNA ref. Phytozome 12:   Bd1 (34494293..34495485)
Protein sequence: BdiPrx25 (Bradi1g38310)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (298)
PWM (Da):   %s   33878.67 (31508.4) Transmb domain:   %s   i5-24o
PI (pH):   %s   6.73 (6.74) Peptide Signal:   %s   cut: 25 range:25-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANAVTCLLMAAVVLAPLFAGAAGGKLSTRFYDRKCPNLQSIVRLAMVEAVAAEPRMGASILRMFFHDCFVNGCDASILLDDTADLTGEKNAGPNANSVRGYEVIDAIKAQVEASCSATVSCADIVALAARDGVNLLGGPTWTVQLGRRDARNASQSAANSNLPSPGSSLATLITVFGNKGLSARDMTALSGAHTIGQARCTTFRDRIYNDANINGSFAALRQQTCPQASGTGGDGTLAPIDVTSPDVFDNYYYQNLMSKQGLFHSDQELFNGGSQDALVRRYSGNGAMFAADFAKAMVRMGGLMPSADTPTEVRLDCKKVN*

Retrieve as FASTA  
Remarks Complete sequence (chromo 1, intron 1 and 2), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAATGCAGTAACGTGCTTGCTCATGGCTGCCGTCGTGTTGGCCCCGCTTTTCGCTGGCGCTGCAGGTGGGAAGCTGTCAACGAGGTTCTACGACAGGAAGTGCCCGAACTTGCAG
AGCATTGTGCGGTTAGCGATGGTGGAGGCCGTCGCGGCCGAGCCGCGGATGGGCGCATCTATCCTCCGGATGTTCTTCCACGACTGCTTCGTCAAT
GTGAGACGCAGGTGTCATTTTTTC
GTTTGCAATTAGTGTATCGATCTCTGTATACTTGAAAGATTTCTGCTTGCTCTTGTATCGATGTAACGTTTGTGTTGGATTAAATTTTTTATTCCGTGCAGGGCTGCGACGCGTCGATCT
TGCTTGACGACACCGCGGACTTGACCGGCGAGAAGAATGCCGGACCGAACGCTAACTCGGTGCGCGGGTACGAGGTCATCGACGCAATCAAGGCCCAGGTCGAGGCTTCTTGCAGCGCCA
CGGTCTCCTGCGCTGACATCGTCGCTCTTGCCGCACGGGACGGCGTTAACCTG
GTACAGATAGAACCATTTAATCCATGCGGCGTTGCGCCAATGTAAATTGTAATGCAACATTTTTGGA
ACTTACTGATTGGTGTTGAGAATGAACTGCAGCTGGGAGGGCCGACGTGGACGGTGCAGCTGGGCCGGCGCGACGCGCGGAACGCGAGCCAGAGCGCGGCTAACTCCAATCTCCCGAGTC
CAGGGTCCAGCCTCGCAACGCTCATCACCGTATTCGGCAACAAGGGGCTCTCGGCGCGGGACATGACGGCGCTGTCCGGCGCGCACACGATCGGGCAGGCCCGGTGCACCACCTTCCGCG
ACCGTATCTACAACGACGCCAACATCAACGGCTCCTTCGCGGCGCTCCGGCAGCAGACGTGCCCCCAGGCGTCCGGGACCGGCGGCGACGGCACGCTCGCGCCCATCGACGTGACGTCCC
CGGACGTGTTCGACAACTACTACTACCAGAACCTGATGAGCAAGCAGGGCCTGTTCCACTCGGACCAGGAGCTCTTCAACGGCGGGTCGCAGGACGCGCTCGTGAGGAGGTACAGCGGCA
ATGGCGCCATGTTCGCGGCTGACTTTGCGAAGGCGATGGTCAGGATGGGGGGACTCATGCCGTCGGCGGACACGCCCACGGAAGTCAGGTTGGACTGCAAGAAGGTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAATGCAGTAACGTGCTTGCTCATGGCTGCCGTCGTGTTGGCCCCGCTTTTCGCTGGCGCTGCAGGTGGGAAGCTGTCAACGAGGTTCTACGACAGGAAGTGCCCGAACTTGCAG
AGCATTGTGCGGTTAGCGATGGTGGAGGCCGTCGCGGCCGAGCCGCGGATGGGCGCATCTATCCTCCGGATGTTCTTCCACGACTGCTTCGTCAAT
GGCTGCGACGCGTCGATCTTGCTT
GACGACACCGCGGACTTGACCGGCGAGAAGAATGCCGGACCGAACGCTAACTCGGTGCGCGGGTACGAGGTCATCGACGCAATCAAGGCCCAGGTCGAGGCTTCTTGCAGCGCCACGGTC
TCCTGCGCTGACATCGTCGCTCTTGCCGCACGGGACGGCGTTAACCTG
CTGGGAGGGCCGACGTGGACGGTGCAGCTGGGCCGGCGCGACGCGCGGAACGCGAGCCAGAGCGCGGCTAAC
TCCAATCTCCCGAGTCCAGGGTCCAGCCTCGCAACGCTCATCACCGTATTCGGCAACAAGGGGCTCTCGGCGCGGGACATGACGGCGCTGTCCGGCGCGCACACGATCGGGCAGGCCCGG
TGCACCACCTTCCGCGACCGTATCTACAACGACGCCAACATCAACGGCTCCTTCGCGGCGCTCCGGCAGCAGACGTGCCCCCAGGCGTCCGGGACCGGCGGCGACGGCACGCTCGCGCCC
ATCGACGTGACGTCCCCGGACGTGTTCGACAACTACTACTACCAGAACCTGATGAGCAAGCAGGGCCTGTTCCACTCGGACCAGGAGCTCTTCAACGGCGGGTCGCAGGACGCGCTCGTG
AGGAGGTACAGCGGCAATGGCGCCATGTTCGCGGCTGACTTTGCGAAGGCGATGGTCAGGATGGGGGGACTCATGCCGTCGGCGGACACGCCCACGGAAGTCAGGTTGGACTGCAAGAAG
GTCAATTAA

Retrieve as FASTA