Entry information : BdiPrx23 (Bradi1g38290)
Entry ID 7812
Creation 2011-01-06 (Toky Ramarohetra)
Last sequence changes 2011-01-06 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx23 (Bradi1g38290)
Name (synonym) BdiPrx23 (Bradi1g38290)
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type Callus
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx23
start..stop
S start..stop
TaPrx32 550 0 1..319 1..322
OsPrx86 526 0 26..319 31..324
SbPrx138 521 0 21..319 26..325
SiPrx33 514 0 26..319 32..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34473949..34474164 216 N° 2 34474277..34474468 192 N° 3 34474567..34475118 552  
join(34473949..34474164,34474277..34474468,34474567..34475118)


exon

Literature and cross-references BdiPrx23 (Bradi1g38290)
Literature Vogel,J.P., Gu,Y.Q., Twigg,P., Lazo,G.R., Laudencia-Chingcuanco,D., Hayden,D.M., Donze,T.J., Vivian,L.A., Stamova,B. and Coleman-Derr,D.
EST sequencing and phylogenetic analysis of the model grass Brachypodium distachyon. Theor Appl Genet 113 (2), 186-195 (2006)
DNA ref. Phytozome 11:   Bd1 (34473949..34475118)
EST ref. GenBank:   DV470318.1 [5' end]
Protein sequence: BdiPrx23 (Bradi1g38290)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   33493.67 (30945.4)  
PI (pH):   %s   8.75 (8.57) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIFTKSALFGFAVVFSVFTGAANAQLSPNFYSTSCPNLGTIVRSGMASAVQTEKRMGASILRLFFHDCFVNGCDGSILLDDTPTFTGEKNAGPNANSARGFEVIDAIKKQVEASCKATVSCADILALAARDGVSLLGGPTWSVPLGRKDSRTASQSAANANLPGPGSSLATLISMFGSKNLSPRDMTALSGAHTVGQARCTTFRSRIYTERNINGTFAALRQRTCPRTGGDSALAPFDVQTADGFDNAYYQNLVAQRGLLHSDQELFNGGSQDALVRQYSNSPVQFSADFVSAMLKMGGLLPSSGTPTEVRLKCSKAN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 1, intron 1 and 2), 1 EST. Cultivar="Bd21".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATCTTCACCAAATCGGCCTTGTTTGGCTTTGCCGTCGTCTTCTCTGTTTTCACCGGCGCGGCCAATGCGCAGCTCTCTCCCAACTTCTACTCCACGTCTTGCCCCAACCTTGGT
ACCATCGTGCGGTCGGGGATGGCATCGGCCGTGCAGACGGAGAAGCGGATGGGCGCTTCCATCCTTCGTCTCTTCTTCCACGACTGCTTCGTGAAT
GTAAGCACGCAGACCGTCCTGGTT
CCTCTGTTCCTCATGCACTACTCAATATTTGCTTTATTTGCTGAATTTCTGCGTGCTGGGTACTGATCGGTTTATCTGATATCGGCAGGGATGTGACGGTTCCATCTTGCTCGACGACAC
GCCGACCTTCACCGGCGAGAAGAACGCCGGACCAAACGCCAACTCGGCGCGCGGGTTCGAAGTGATCGACGCCATCAAGAAGCAGGTCGAGGCGTCGTGCAAGGCCACCGTGTCCTGCGC
CGACATCCTCGCGCTCGCCGCCCGCGACGGAGTCAGCCTG
GTTAGTCAACGCTGACCCGCACAATATATACTACAGTACCACCGTAGTACTTTTGACTAGTCATGGCTGACTCGGCTTGT
ACTGTTCCATGCGTGCAGCTTGGAGGTCCGACGTGGAGCGTGCCGCTGGGGCGCAAGGACTCGCGCACGGCGAGCCAGAGCGCGGCCAACGCGAACCTGCCGGGGCCCGGGTCCAGCCTC
GCCACGCTCATCTCCATGTTCGGCAGCAAGAACCTCTCGCCGCGGGACATGACGGCGCTCTCCGGCGCGCACACCGTCGGGCAGGCCCGGTGCACCACCTTCCGCAGCCGCATCTACACG
GAGCGCAACATCAACGGCACCTTCGCGGCGCTGCGGCAGCGGACGTGCCCGCGGACGGGCGGGGACAGCGCCCTCGCGCCGTTCGACGTCCAGACCGCCGACGGGTTCGACAACGCCTAC
TACCAGAACCTGGTCGCCCAGCGCGGGCTGCTGCACTCGGACCAGGAGCTCTTCAACGGCGGCTCGCAGGACGCGCTGGTGAGGCAGTACAGCAACAGCCCGGTCCAGTTCTCGGCTGAC
TTCGTGTCGGCCATGCTCAAGATGGGCGGCCTGCTGCCGTCGTCCGGGACGCCGACGGAGGTCAGGCTCAAATGCAGTAAAGCCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATCTTCACCAAATCGGCCTTGTTTGGCTTTGCCGTCGTCTTCTCTGTTTTCACCGGCGCGGCCAATGCGCAGCTCTCTCCCAACTTCTACTCCACGTCTTGCCCCAACCTTGGT
ACCATCGTGCGGTCGGGGATGGCATCGGCCGTGCAGACGGAGAAGCGGATGGGCGCTTCCATCCTTCGTCTCTTCTTCCACGACTGCTTCGTGAAT
GGATGTGACGGTTCCATCTTGCTC
GACGACACGCCGACCTTCACCGGCGAGAAGAACGCCGGACCAAACGCCAACTCGGCGCGCGGGTTCGAAGTGATCGACGCCATCAAGAAGCAGGTCGAGGCGTCGTGCAAGGCCACCGTG
TCCTGCGCCGACATCCTCGCGCTCGCCGCCCGCGACGGAGTCAGCCTG
CTTGGAGGTCCGACGTGGAGCGTGCCGCTGGGGCGCAAGGACTCGCGCACGGCGAGCCAGAGCGCGGCCAAC
GCGAACCTGCCGGGGCCCGGGTCCAGCCTCGCCACGCTCATCTCCATGTTCGGCAGCAAGAACCTCTCGCCGCGGGACATGACGGCGCTCTCCGGCGCGCACACCGTCGGGCAGGCCCGG
TGCACCACCTTCCGCAGCCGCATCTACACGGAGCGCAACATCAACGGCACCTTCGCGGCGCTGCGGCAGCGGACGTGCCCGCGGACGGGCGGGGACAGCGCCCTCGCGCCGTTCGACGTC
CAGACCGCCGACGGGTTCGACAACGCCTACTACCAGAACCTGGTCGCCCAGCGCGGGCTGCTGCACTCGGACCAGGAGCTCTTCAACGGCGGCTCGCAGGACGCGCTGGTGAGGCAGTAC
AGCAACAGCCCGGTCCAGTTCTCGGCTGACTTCGTGTCGGCCATGCTCAAGATGGGCGGCCTGCTGCCGTCGTCCGGGACGCCGACGGAGGTCAGGCTCAAATGCAGTAAAGCCAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGAAGCTGGT ACCCTGCAGG TACCGGTCCG GAATTCCCGG GTCGACCCCC TCGTCCGCTC TCCGATCTCA TAACAATGGC CATCTTCACC AAATCGGCCT TGTTTGGCTT TGCCGTCGTC  TTCTCTGTTT TCACCGGCGC GGCCAATGCG CAGCTCTCTC CCAACTTCTA CTCCACGTCT TGCCCCAACC TTGGTACCAT CGTGCGGTCG GGGATGGCAT CGGCCGTGCA GACGGAGAAG  CGGATGGGCG CTTCCATCCT TCGTCTCTTC TTCCACGACT GCTTCGTGAA TGGATGTGAC GGTTCCATCT TGCTCGACGA CACGCCGACC TTCACCGGCG AGAAGAACGC CGGACCAAAC  GCCAACTCGG CGCGCGGGTT CGAAGTGATC GACGCCATCA AGAAGCAGGT CGAGGCGTCG TGCAAGGCCA CCGTGTCCTG CGCCGACATC CTCGCGCTCG CCGCCCGCGA CGGAGTCAGC  CTGCTTGGAG GTCCGACGTG GAGCGTGCCG CTGGGGCGCA AGGACTCGCG CACGGCGAGC CAGAGCGCGG CCAACGCGAA CCTGCCGGGG CCCGGGTCCA GCCTCGCCAC GCTCATCTCC  ATGTTCGGCA GCAAGAACCT CTCGCCGCGG GACATGACGG CGCTCTCCGG CGCGCACACC GTCGGGCAGG CCCGGTGCAC CACCTTCCGC AGCCGCATCT ACACGGAGCG CAACATCAAC  GGCACCTTCG CGGCGCTGCG GCAGCGGACG TGCCCGCGGA CGGGCGGGGA CAGCGCCCTC GCGCCGTTCG ACGTCCAGAC CGCCGACGGG TTCGACAACG CCTACTACCA GAACCTGGTC  GCCCAGCGCG GGCTGCTGCA CTCGGACCAG GAGCTCTTCA ACGGCGGCTC GCAGGACGCG CTGGTGAGGC AGTACAGCAA CAGCCCGGTC CAGTTCTCGG CTGACTTCGT GTCGGCCATG 
CTCAAGATGG GCGGCCTGCT GCCGTCGTCC GGGACGCCGA CGGAGGTCAG GCTCAAATGC AGTAAAGCCA ACTAA 

Retrieve as FASTA