Entry information : BdiPrx33 (Bradi1g44800)
Entry ID 7813
Creation 2011-01-06 (Toky Ramarohetra)
Last sequence changes 2011-01-06 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx33 (Bradi1g44800)
Name (synonym) BdiPrx33 (Bradi1g44800)
Class Class III peroxidase    [Orthogroup: Prx223]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx33
start..stop
S start..stop
BdiPrx32 603 0 1..320 1..320
BdiPrx30 510 0 19..320 18..322
TaPrx101 494 4e-178 26..320 34..339
SbPrx145 487 2e-175 20..320 22..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42914290..42914505 216 N° 2 42914596..42915342 747  
join(42914290..42914505,42914596..42915342)


exon

Literature and cross-references BdiPrx33 (Bradi1g44800)
DNA ref. Phytozome 12:   Bd1 (42914290..42915342)
Protein sequence: BdiPrx33 (Bradi1g44800)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (295)
PWM (Da):   %s   34030.3 (31422.9)  
PI (pH):   %s   7.41 (7.41) Peptide Signal:   %s   cut: 26 range:26-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIMRSWQLPLALLVILAASSAAAAQLEIGFYSKTCPDAEKIVQEEMTKIIAAAPSLAGPLLRLHFHDCFVRGCDASVLLESTPGNTAEKDAKPNKSLRGFGSVERVKAKLEAACPGIVSCADVLTLMSRDAVVLSHGPHWPVALGRRDGMASSATEASNELPPASGDVPLLAKIFASKGLNLKDLAVLSGGHTLGTAHCASFDDRLSNSTVDPSLDSEYADRLRLKCGSGGVLAEMDPGSYKTFDGSYYRQVAKRRGLFRSDAALLADATTGDYVRRVASGKFDAEFFRDFSESMIKMGNVGVLTGSQGEIRKKCYVLN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 1, intron 1), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATCATGAGGTCTTGGCAGCTCCCTCTGGCCCTCCTGGTCATCCTCGCAGCTAGCTCGGCCGCAGCGGCTCAGCTGGAGATCGGCTTCTACAGCAAGACGTGCCCTGACGCCGAG
AAGATCGTACAAGAGGAAATGACCAAGATCATCGCCGCCGCCCCCAGCCTCGCCGGCCCTCTCCTCCGGCTCCATTTCCACGACTGCTTCGTCAGG
GTACATACTTGCCGTCAATCCGTC
TCATTTCTACTTCTCGTACTCATCAGTCATCATGGAACATATACTCATGAGTTACATAATTTGCAGGGGTGTGACGCGTCCGTGCTGCTGGAGTCGACCCCGGGGAACACGGCGGAGAAG
GACGCGAAGCCGAACAAGAGCCTGCGCGGGTTCGGGTCCGTGGAGCGGGTGAAAGCCAAGCTGGAAGCCGCGTGCCCGGGCATCGTCTCCTGCGCCGACGTGCTCACGCTCATGTCCCGC
GATGCCGTGGTCCTGTCCCACGGGCCCCACTGGCCAGTAGCGCTAGGCCGGAGGGATGGCATGGCCTCGAGCGCCACCGAGGCCAGCAACGAGCTTCCCCCGGCCTCCGGCGACGTGCCG
CTCCTCGCCAAGATCTTCGCCTCCAAGGGGCTCAACCTCAAGGACCTAGCCGTGCTCTCGGGCGGCCACACGCTCGGCACGGCGCACTGCGCGTCCTTCGATGACAGGCTTTCCAACTCC
ACCGTTGATCCGTCGCTGGACAGCGAGTACGCCGACAGGCTGAGGCTCAAGTGCGGGAGCGGCGGTGTGCTGGCGGAGATGGACCCTGGGAGCTACAAGACCTTTGATGGGAGCTATTAT
AGGCAAGTGGCCAAGCGGAGGGGCCTGTTCCGCTCCGACGCCGCGCTCCTGGCTGATGCAACTACTGGGGACTACGTCCGGAGAGTTGCCTCGGGGAAGTTTGACGCGGAGTTCTTTAGG
GATTTTAGCGAGTCCATGATCAAGATGGGTAATGTCGGTGTGCTCACCGGGAGCCAGGGGGAGATCAGGAAAAAGTGCTACGTCCTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATCATGAGGTCTTGGCAGCTCCCTCTGGCCCTCCTGGTCATCCTCGCAGCTAGCTCGGCCGCAGCGGCTCAGCTGGAGATCGGCTTCTACAGCAAGACGTGCCCTGACGCCGAG
AAGATCGTACAAGAGGAAATGACCAAGATCATCGCCGCCGCCCCCAGCCTCGCCGGCCCTCTCCTCCGGCTCCATTTCCACGACTGCTTCGTCAGG
GGGTGTGACGCGTCCGTGCTGCTG
GAGTCGACCCCGGGGAACACGGCGGAGAAGGACGCGAAGCCGAACAAGAGCCTGCGCGGGTTCGGGTCCGTGGAGCGGGTGAAAGCCAAGCTGGAAGCCGCGTGCCCGGGCATCGTCTCC
TGCGCCGACGTGCTCACGCTCATGTCCCGCGATGCCGTGGTCCTGTCCCACGGGCCCCACTGGCCAGTAGCGCTAGGCCGGAGGGATGGCATGGCCTCGAGCGCCACCGAGGCCAGCAAC
GAGCTTCCCCCGGCCTCCGGCGACGTGCCGCTCCTCGCCAAGATCTTCGCCTCCAAGGGGCTCAACCTCAAGGACCTAGCCGTGCTCTCGGGCGGCCACACGCTCGGCACGGCGCACTGC
GCGTCCTTCGATGACAGGCTTTCCAACTCCACCGTTGATCCGTCGCTGGACAGCGAGTACGCCGACAGGCTGAGGCTCAAGTGCGGGAGCGGCGGTGTGCTGGCGGAGATGGACCCTGGG
AGCTACAAGACCTTTGATGGGAGCTATTATAGGCAAGTGGCCAAGCGGAGGGGCCTGTTCCGCTCCGACGCCGCGCTCCTGGCTGATGCAACTACTGGGGACTACGTCCGGAGAGTTGCC
TCGGGGAAGTTTGACGCGGAGTTCTTTAGGGATTTTAGCGAGTCCATGATCAAGATGGGTAATGTCGGTGTGCTCACCGGGAGCCAGGGGGAGATCAGGAAAAAGTGCTACGTCCTCAAC
TAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATCA TGAGGTCTTG GCAGCTCCCT CTGGCCCTCC TGGTCATCCT CGCAGCTAGC TCGGCCGCAG CGGCTCAGCT GGAGATCGGC TTCTACAGCA AGACGTGCCC TGACGCCGAG  AAGATCGTAC AAGAGGAAAT GACCAAGATC ATCGCCGCCG CCCCCAGCCT CGCCGGCCCT CTCCTCCGGC TCCATTTCCA CGACTGCTTC GTCAGGGGGT GTGACGCGTC CGTGCTGCTG  GAGTCGACCC CGGGGAACAC GGCGGAGAAG GACGCGAAGC CGAACAAGAG CCTGCGCGGG TTCGGGTCCG TGGAGCGGGT GAAAGCCAAG CTGGAAGCCG CGTGCCCGGG CATCGTCTCC  TGCGCCGACG TGCTCACGCT CATGTCCCGC GATGCCGTGG TCCTGTCCCA CGGGCCCCAC TGGCCAGTAG CGCTAGGCCG GAGGGATGGC ATGGCCTCGA GCGCCACCGA GGCCAGCAAC  GAGCTTCCCC CGGCCTCCGG CGACGTGCCG CTCCTCGCCA AGATCTTCGC CTCCAAGGGG CTCAACCTCA AGGACCTAGC CGTGCTCTCG GGCGGCCACA CGCTCGGCAC GGCGCACTGC  GCGTCCTTCG ATGACAGGCT TTCCAACTCC ACCGTTGATC CGTCGCTGGA CAGCGAGTAC GCCGACAGGC TGAGGCTCAA GTGCGGGAGC GGCGGTGTGC TGGCGGAGAT GGACCCTGGG  AGCTACAAGA CCTTTGATGG GAGCTATTAT AGGCAAGTGG CCAAGCGGAG GGGCCTGTTC CGCTCCGACG CCGCGCTCCT GGCTGATGCA ACTACTGGGG ACTACGTCCG GAGAGTTGCC  TCGGGGAAGT TTGACGCGGA GTTCTTTAGG GATTTTAGCG AGTCCATGAT CAAGATGGGT AATGTCGGTG TGCTCACCGG GAGCCAGGGG GAGATCAGGA AAAAGTGCTA CGTCCTCAAC  TAGCTACGAC GTGGAGCCAG TACGTGTTGT TAAGCGGGGT GCATGCATAT CTGTGTGTGT TTGATGGTAT TCATTTGTAG TGTGAGAAAT TATTCTCTAT CATCATATAT TCAGTAAATT 
GTTTCTTCGC TAAGGCTAGC TGATTAGGCT TTAATCTCTT 

Retrieve as FASTA