Entry information : BdiPrx30 (Bradi1g42900)
Entry ID 7821
Creation 2011-01-07 (Toky Ramarohetra)
Last sequence changes 2011-01-07 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx30 (Bradi1g42900)
Name (synonym) BdiPrx30 (Bradi1g42900)
Class Class III peroxidase    [Orthogroup: Prx052]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type Callus
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx30
start..stop
S start..stop
SbPrx145 539 0 19..322 22..329
SiPrx31 539 0 19..322 21..328
SbPrx129 536 0 8..322 13..332
SiPrx30 534 0 19..322 22..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 40330029..40330241 213 N° 2 40330479..40331234 756  
join(40330029..40330241,40330479..40331234)


exon

Literature and cross-references BdiPrx30 (Bradi1g42900)
Literature Vogel,J.P., Gu,Y.Q., Twigg,P., Lazo,G.R., Laudencia-Chingcuanco,D., Hayden,D.M., Donze,T.J., Vivian,L.A., Stamova,B. and Coleman-Derr,D.
EST sequencing and phylogenetic analysis of the model grass Brachypodium distachyon. Theor Appl Genet 113 (2), 186-195 (2006)
DNA ref. Phytozome 12:   Bd1 (40330029..40331234)
EST ref. GenBank:   DV469872.1 [5' end]   DV471684.1 [5' end]
Protein sequence: BdiPrx30 (Bradi1g42900)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (298)
PWM (Da):   %s   34828.94 (32336.5)  
PI (pH):   %s   8.38 (8.19) Peptide Signal:   %s   cut: 25 range:25-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIMIRSLLLPLTLLVLAATSTVAQLEIGYYSKSCPNVEAIVREEMVKIISAAPSLAGPLLRLHFHDCFVRGCDASVLIDSTKGNLAERDAKPNRSLRGFGSVERVKAKLESACPGVVSCADVLTLMARDAVVLAKGPSWPVELGRRDGRTSNAAEASDELPPAFGDIPLLTKIFASKGLDLKDLVVLSGAHTLGTAHCPSYADRLYNATADPSLDSEYAEKLRMKCRSVNDGSTLSEMDPGSYKTFDGSYYRHVAKRRGLFRSDAALLTDATTREYVRRVATGKFDDAFFKDFSESMIKMGNVGVLTGVQGEIRKKCYVLN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1), 2 ESTs. (cultivar 'Bd21').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATTATGATCAGGTCTTTGCTGCTTCCTCTGACCCTCCTGGTTCTCGCAGCCACCTCAACTGTGGCCCAGCTGGAGATCGGCTACTACAGCAAGTCATGCCCCAACGTCGAGGCC
ATAGTCCGCGAGGAGATGGTGAAGATCATCTCCGCCGCACCCAGCCTCGCCGGCCCGCTCCTCAGGCTCCATTTCCACGACTGCTTCGTCAGG
GTAAGTACATGTCGATTATTCTAAATA
CTTAGCCATTCATTCATTCTTCATTCATTGATCATATGATCTAAAGTACTCCCTTTGATCCTAAATAGTTATCGAAATATTACGTGTATCTAGACGCATTTTAAGAATAGATACATCCAT
ATTTGAGCAAATTTGAGTGAAGAATTTAGGATAAAAGGGAATAGTAGTTAACTATATATGCTTACCAAACATGTCAAACACAAAATGCAGGGCTGTGACGCGTCTGTGCTGATCGACTCC
ACCAAGGGCAACCTGGCAGAGAGGGACGCCAAGCCGAACAGGAGCCTGCGAGGATTCGGCTCCGTGGAGAGAGTGAAGGCCAAGCTGGAGTCCGCCTGCCCGGGCGTCGTCTCCTGCGCC
GACGTCCTCACTCTCATGGCACGCGACGCCGTGGTGCTAGCAAAGGGCCCTTCGTGGCCCGTGGAGCTGGGAAGGAGAGACGGACGTACGTCTAACGCTGCCGAGGCCAGCGACGAGCTG
CCCCCGGCCTTCGGCGACATCCCTCTGCTCACCAAGATCTTCGCCTCCAAGGGCCTCGACCTCAAGGACCTCGTCGTGCTCTCCGGCGCCCACACGCTAGGCACGGCGCACTGCCCGTCG
TACGCCGACCGGCTCTACAACGCCACCGCCGACCCATCGCTGGACAGCGAGTACGCTGAAAAGCTGAGGATGAAGTGCAGGAGCGTTAACGACGGGAGCACGCTTTCGGAGATGGACCCC
GGTAGCTACAAGACCTTCGATGGCAGCTACTACCGCCATGTCGCCAAGCGGAGGGGCCTGTTCCGCTCCGACGCCGCGCTGCTCACCGATGCCACCACCAGGGAGTACGTCCGGCGCGTT
GCCACCGGCAAGTTCGATGACGCCTTCTTCAAGGATTTCAGCGAGTCGATGATCAAGATGGGCAACGTCGGTGTCCTCACCGGGGTTCAGGGAGAGATCAGGAAGAAGTGCTACGTCCTC
AACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATTATGATCAGGTCTTTGCTGCTTCCTCTGACCCTCCTGGTTCTCGCAGCCACCTCAACTGTGGCCCAGCTGGAGATCGGCTACTACAGCAAGTCATGCCCCAACGTCGAGGCC
ATAGTCCGCGAGGAGATGGTGAAGATCATCTCCGCCGCACCCAGCCTCGCCGGCCCGCTCCTCAGGCTCCATTTCCACGACTGCTTCGTCAGG
GGCTGTGACGCGTCTGTGCTGATCGAC
TCCACCAAGGGCAACCTGGCAGAGAGGGACGCCAAGCCGAACAGGAGCCTGCGAGGATTCGGCTCCGTGGAGAGAGTGAAGGCCAAGCTGGAGTCCGCCTGCCCGGGCGTCGTCTCCTGC
GCCGACGTCCTCACTCTCATGGCACGCGACGCCGTGGTGCTAGCAAAGGGCCCTTCGTGGCCCGTGGAGCTGGGAAGGAGAGACGGACGTACGTCTAACGCTGCCGAGGCCAGCGACGAG
CTGCCCCCGGCCTTCGGCGACATCCCTCTGCTCACCAAGATCTTCGCCTCCAAGGGCCTCGACCTCAAGGACCTCGTCGTGCTCTCCGGCGCCCACACGCTAGGCACGGCGCACTGCCCG
TCGTACGCCGACCGGCTCTACAACGCCACCGCCGACCCATCGCTGGACAGCGAGTACGCTGAAAAGCTGAGGATGAAGTGCAGGAGCGTTAACGACGGGAGCACGCTTTCGGAGATGGAC
CCCGGTAGCTACAAGACCTTCGATGGCAGCTACTACCGCCATGTCGCCAAGCGGAGGGGCCTGTTCCGCTCCGACGCCGCGCTGCTCACCGATGCCACCACCAGGGAGTACGTCCGGCGC
GTTGCCACCGGCAAGTTCGATGACGCCTTCTTCAAGGATTTCAGCGAGTCGATGATCAAGATGGGCAACGTCGGTGTCCTCACCGGGGTTCAGGGAGAGATCAGGAAGAAGTGCTACGTC
CTCAACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCCATCCAT TTTATCTTAA GGCGCTCTCA CATAACGATC GCTTGCTCTC TTCAGGCTTT AACTAACTGG TTAAGGTCCA TGGCCATTAT GATCAGGTCT TTGCTGCTTC CTCTGACCCT  CCTGGTTCTC GCAGCCACCT CAACTGTGGC CCAGCTGGAG ATCGGCTACT ACAGCAAGTC ATGCCCCAAC GTCGAGGCCA TAGTCCGCGA GGAGATGGTG AAGATCATCT CCGCCGCACC  CAGCCTCGCC GGCCCGCTCC TCAGGCTCCA TTTCCACGAC TGCTTCGTCA GGGGCTGTGA CGCGTCTGTG CTGATCGACT CCACCAAGGG CAACCTGGCA GAGAGGGACG CCAAGCCGAA  CAGGAGCCTG CGAGGATTCG GCTCCGTGGA GAGAGTGAAG GCCAAGCTGG AGTCCGCCTG CCCGGGCGTC GTCTCCTGCG CCGACGTCCT CACTCTCATG GCACGCGACG CCGTGGTGCT  AGCAAAGGGC CCTTCGTGGC CCGTGGAGCT GGGAAGGAGA GACGGACGTA CGTCTAACGC TGCCGAGGCC AGCGACGAGC TGCCCCCGGC CTTCGGCGAC ATCCCTCTGC TCACCAAGAT  CTTCGCCTCC AAGGGCCTCG ACCTCAAGGA CCTCGTCGTG CTCTCCGGCG CCCACACGCT AGGCACGGCG CACTGCCCGT CGTACGCCGA CCGGCTCTAC AACGCCACCG CCGACCCATC  GCTGGACAGC GAGTACGCTG AAAAGCTGAG GATGAAGTGC AGGAGCGTTA ACGACGGGAG CACGCTTTCG GAGATGGACC CCGGTAGCTA CAAGACCTTC GATGGCAGCT ACTACCGCCA  TGTCGCCAAG CGGAGGGGCC TGTTCCGCTC CGACGCCGCG CTGCTCACCG ATGCCACCAC CAGGGAGTAC GTCCGGCGCG TTGCCACCGG CAAGTTCGAT GACGCCTTCT TCAAGGATTT  CAGCGAGTCG ATGATCAAGA TGGGCAACGT CGGTGTCCTC ACCGGGGTTC AGGGAGAGAT CAGGAAGAAG TGCTACGTCC TCAACTAGCT AGAGAAGCTA GCTTTCCTAG CGAATTATTG  TGGCATGGAA CAACGTGTGT TGTGAAGAGG TGAATTGGAT TTCTGTTGTT AATTGTACTA CTCTTTAGTT GGCTGCATCA CTTCGTGCAA CAGATAAGCC AATATTACAA CTCTGAGCTA 
ACCACGGGGT TTAAATTACC TCTTGAACTC C 

Retrieve as FASTA