Entry information : BdiPrx03 (Bradi1g15600)
Entry ID 7823
Creation 2011-01-07 (Toky Ramarohetra)
Last sequence changes 2011-01-07 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx03 (Bradi1g15600)
Name (synonym) BdiPrx03 (Bradi1g15600)
Class Class III peroxidase    [Orthogroup: Prx051]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx03
start..stop
S start..stop
BdiPrx30 512 0 25..327 21..322
SbPrx145 488 1e-175 23..327 22..329
SiPrx32 484 5e-174 23..327 21..327
SiPrx31 482 3e-173 7..327 5..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12522026..12522250 225 N° 2 12521171..12521938 768  
complement(join(12521171..12521938,12522026..12522250))


exon

Literature and cross-references BdiPrx03 (Bradi1g15600)
DNA ref. Phytozome 12:   Bd1 (12522250..12521171)
Protein sequence: BdiPrx03 (Bradi1g15600)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (302)
PWM (Da):   %s   35272.1 (32308.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.47 (8.38) Peptide Signal:   %s   cut: 29 range:29-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTRDRSSVVTMLLVPLGIMLALSCSAFAQLETGFYSATCPKVEEIVREETVKIISAAPSLAGPLLRLHFHDCFVRGCDASVLLDSTPGHLAERDAKPNKSLRGFGSVERVKAKLEAACPGVVSCADVLALMAREAVVLAKGPTWTVPLGRRDGVASSAAEASKELPPSFGDVPLLAKIFASKGLGVKDLAVLSGAHTLGTAHCPSYADRLYGRVVDASLDSEYAEKLKSRCKSVNDTATLSEMDPGSYKTFDTSYYRHVAKRRGLFRSDAALLDDDTTKGYVQRVAAAGNFDGTFFRDFGESMVKMGNVGVLTGVQGEIRRKCYVINKTH*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGAGAGATAGGTCTTCTGTAGTCACAATGCTGCTAGTTCCTCTGGGCATCATGCTGGCCCTCTCGTGCTCAGCATTCGCTCAGCTGGAGACTGGGTTTTACAGCGCGACATGCCCC
AAAGTGGAGGAGATCGTCCGCGAGGAGACGGTGAAGATCATCTCCGCCGCGCCCAGCCTCGCCGGCCCGCTCCTCAGGCTTCACTTCCACGACTGCTTCGTCAGG
GTAAGCCGTACACGT
AACCCGATCGATTGCAAAGTTGCAATGAATTGATCCCATTGATCAACGCTTGCATTGCAACATTTTTTGCAGGGCTGTGACGCCTCCGTCCTCCTGGACTCAACGCCGGGGCACCTGGCA
GAGCGGGACGCGAAGCCCAACAAGAGCCTGCGAGGCTTCGGCTCCGTGGAGCGCGTCAAGGCCAAGCTGGAGGCCGCGTGCCCCGGCGTCGTCTCGTGCGCCGACGTCCTGGCGCTCATG
GCCCGCGAGGCCGTCGTGCTGGCAAAGGGGCCCACCTGGACGGTCCCGCTGGGGAGGAGAGACGGCGTGGCGTCCAGCGCCGCGGAGGCAAGCAAAGAGCTGCCCCCGTCCTTCGGCGAC
GTCCCACTCCTCGCCAAGATCTTCGCCTCCAAGGGGCTCGGCGTCAAGGACCTCGCCGTGCTCTCCGGCGCGCACACGCTCGGCACGGCGCACTGCCCGTCCTACGCCGACCGGCTCTAC
GGCCGCGTCGTCGACGCGTCGCTGGACAGCGAGTACGCCGAGAAGCTCAAGTCCAGGTGCAAGAGCGTCAACGACACGGCCACGCTGTCGGAGATGGATCCCGGCAGCTACAAGACCTTC
GACACGAGCTATTACCGCCACGTCGCCAAGCGGAGGGGCCTCTTCCGGTCCGACGCCGCGCTCCTCGACGACGACACGACAAAGGGTTACGTCCAGCGCGTCGCTGCCGCCGGCAACTTT
GATGGCACGTTCTTTAGGGATTTCGGCGAGTCCATGGTCAAGATGGGGAACGTCGGGGTGCTCACCGGGGTTCAGGGAGAGATCAGGAGAAAGTGTTACGTTATCAACAAGACGCACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGAGAGATAGGTCTTCTGTAGTCACAATGCTGCTAGTTCCTCTGGGCATCATGCTGGCCCTCTCGTGCTCAGCATTCGCTCAGCTGGAGACTGGGTTTTACAGCGCGACATGCCCC
AAAGTGGAGGAGATCGTCCGCGAGGAGACGGTGAAGATCATCTCCGCCGCGCCCAGCCTCGCCGGCCCGCTCCTCAGGCTTCACTTCCACGACTGCTTCGTCAGG
GGCTGTGACGCCTCC
GTCCTCCTGGACTCAACGCCGGGGCACCTGGCAGAGCGGGACGCGAAGCCCAACAAGAGCCTGCGAGGCTTCGGCTCCGTGGAGCGCGTCAAGGCCAAGCTGGAGGCCGCGTGCCCCGGC
GTCGTCTCGTGCGCCGACGTCCTGGCGCTCATGGCCCGCGAGGCCGTCGTGCTGGCAAAGGGGCCCACCTGGACGGTCCCGCTGGGGAGGAGAGACGGCGTGGCGTCCAGCGCCGCGGAG
GCAAGCAAAGAGCTGCCCCCGTCCTTCGGCGACGTCCCACTCCTCGCCAAGATCTTCGCCTCCAAGGGGCTCGGCGTCAAGGACCTCGCCGTGCTCTCCGGCGCGCACACGCTCGGCACG
GCGCACTGCCCGTCCTACGCCGACCGGCTCTACGGCCGCGTCGTCGACGCGTCGCTGGACAGCGAGTACGCCGAGAAGCTCAAGTCCAGGTGCAAGAGCGTCAACGACACGGCCACGCTG
TCGGAGATGGATCCCGGCAGCTACAAGACCTTCGACACGAGCTATTACCGCCACGTCGCCAAGCGGAGGGGCCTCTTCCGGTCCGACGCCGCGCTCCTCGACGACGACACGACAAAGGGT
TACGTCCAGCGCGTCGCTGCCGCCGGCAACTTTGATGGCACGTTCTTTAGGGATTTCGGCGAGTCCATGGTCAAGATGGGGAACGTCGGGGTGCTCACCGGGGTTCAGGGAGAGATCAGG
AGAAAGTGTTACGTTATCAACAAGACGCACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGAGAG ATAGGTCTTC TGTAGTCACA ATGCTGCTAG TTCCTCTGGG CATCATGCTG GCCCTCTCGT GCTCAGCATT CGCTCAGCTG GAGACTGGGT TTTACAGCGC GACATGCCCC  AAAGTGGAGG AGATCGTCCG CGAGGAGACG GTGAAGATCA TCTCCGCCGC GCCCAGCCTC GCCGGCCCGC TCCTCAGGCT TCACTTCCAC GACTGCTTCG TCAGGGGCTG TGACGCCTCC  GTCCTCCTGG ACTCAACGCC GGGGCACCTG GCAGAGCGGG ACGCGAAGCC CAACAAGAGC CTGCGAGGCT TCGGCTCCGT GGAGCGCGTC AAGGCCAAGC TGGAGGCCGC GTGCCCCGGC  GTCGTCTCGT GCGCCGACGT CCTGGCGCTC ATGGCCCGCG AGGCCGTCGT GCTGGCAAAG GGGCCCACCT GGACGGTCCC GCTGGGGAGG AGAGACGGCG TGGCGTCCAG CGCCGCGGAG  GCAAGCAAAG AGCTGCCCCC GTCCTTCGGC GACGTCCCAC TCCTCGCCAA GATCTTCGCC TCCAAGGGGC TCGGCGTCAA GGACCTCGCC GTGCTCTCCG GCGCGCACAC GCTCGGCACG  GCGCACTGCC CGTCCTACGC CGACCGGCTC TACGGCCGCG TCGTCGACGC GTCGCTGGAC AGCGAGTACG CCGAGAAGCT CAAGTCCAGG TGCAAGAGCG TCAACGACAC GGCCACGCTG  TCGGAGATGG ATCCCGGCAG CTACAAGACC TTCGACACGA GCTATTACCG CCACGTCGCC AAGCGGAGGG GCCTCTTCCG GTCCGACGCC GCGCTCCTCG ACGACGACAC GACAAAGGGT  TACGTCCAGC GCGTCGCTGC CGCCGGCAAC TTTGATGGCA CGTTCTTTAG GGATTTCGGC GAGTCCATGG TCAAGATGGG GAACGTCGGG GTGCTCACCG GGGTTCAGGG AGAGATCAGG  AGAAAGTGTT ACGTTATCAA CAAGACGCAC TAGCTAAGCA ATACCGTGGA GAAGATAGGT GCATCAACGC TTGCGTTTCT TCCTGTTTAT CTGTATGCCT GCCTCGTCCG GTACATTACT  AGCTAGAATT CCGTGTTTGT TTAGAACGGA AGTAATTAAG TCCGCAATGT GATTATTATT TGTAACTAGC ATGGTGTGGG AAACATCTTT AAGATTTTGA TTCACAGATA TATGTGTGTC 
GATGTATTAT TTTAAAAGTA CTAAATTAAT GATAGATGTG TGTCACACGT ATGTGTCATT AGACCAGTGT 

Retrieve as FASTA