Entry information : BdiPrx02 (Bradi1g07790)
Entry ID 7828
Creation 2011-01-12 (Toky Ramarohetra)
Last sequence changes 2011-01-12 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx02 (Bradi1g07790)
Name (synonym) BdiPrx02 (Bradi1g07790)
Class Class III peroxidase    [Orthogroup: Prx097]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx02
start..stop
S start..stop
HvPrx20 505 0 1..323 1..320
SbPrx03 462 2e-165 10..323 15..334
OsPrx50 459 4e-164 1..323 1..326
ZmPrx108 455 1e-162 27..323 28..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5519827..5520042 216 N° 2 5519487..5519681 195 N° 3 5519214..5519379 166 N° 4 5518702..5519096 395
complement(join(5518702..5519096,5519214..5519379,5519487..5519681,5519827..5520 042))


exon

Literature and cross-references BdiPrx02 (Bradi1g07790)
DNA ref. Phytozome 12:   Bd1 (5520042..5518702)
Protein sequence: BdiPrx02 (Bradi1g07790)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (298)
PWM (Da):   %s   34693.39 (31899.9)  
PI (pH):   %s   8 (7.73) Peptide Signal:   %s   cut: 26 range:26-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARSSWFMVLVLLLVFALSARLSDSALTPDYYNRTCPGVASIVSGVVRQKRDATIRTIGSTIRLFFHDCFVEGCDASVLIQSTPGNPTEMDADDNKSLAFEGYDTVRGAKAAVEAACPDQVSCADILALATRDAIVLSGGPFYEVELGRLDGLSSSARSVAGKLPNPNHSMNQLIAIFRAHGLTMSHLVALSAAHTVGLAHCGKFASRAYSSPPDPTLNPKYAAFLRSRCPFDRSSDPTVFMDQASPARFDNQYFRNLQDGGGLLGSDQLLYTDNRTRPMVDSWAASDAAFSKAFVDAIVKLGRVGVKSGRQGNIRKQCDVFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1, 2 and 3), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGATCGTCGTGGTTCATGGTTCTTGTGCTGCTGCTTGTCTTCGCCCTCTCCGCGCGGCTGAGCGATTCCGCCCTGACGCCGGACTACTACAACAGGACGTGCCCCGGCGTGGCG
AGCATCGTGAGCGGCGTGGTGAGGCAGAAGAGGGACGCCACCATCCGGACCATCGGCTCCACCATCCGCCTCTTCTTCCACGACTGCTTCGTCGAA
GTACGTTTCTTGCTGCACACCGCA
CAGTAATTAATCAACACCAATCAAATCTTACTTTATGTGAGACGTTGAAACACACCGATTATTGTTGAAGTATTAGTGTATTATACTGTTTGATCGATTTGGGTGATGATCGATCATGCA
GGGCTGCGACGCATCGGTGCTGATCCAGTCGACGCCGGGCAACCCGACGGAGATGGACGCCGACGACAACAAGTCCCTGGCGTTCGAAGGCTACGACACGGTGCGGGGCGCCAAGGCCGC
CGTGGAGGCCGCGTGCCCCGACCAGGTCTCCTGCGCCGACATCCTCGCCCTCGCCACGCGAGACGCCATCGTCCTG
GTACACACTGATCGAGTACTCACTTCTCTGCATTTTCTCTTTTC
TAATCTGTGCTGTGCCTGAGACTGACGAGCCTAGTTTGTCTTGTGTCGTGTCGTGTCGTGCAGAGCGGCGGGCCCTTCTACGAGGTGGAGCTGGGCAGGCTGGACGGGCTGAGCTCCAGC
GCCAGAAGCGTGGCAGGCAAGCTGCCGAACCCGAACCACAGCATGAACCAGCTGATCGCCATCTTCAGAGCCCACGGGCTCACCATGTCGCACCTGGTCGCCCTCTCAG
GTGACACACAC
TTCTTCTTCTTCTGAACCTGACACACCCGACATGCAGTTGTAATTAATTAAACGAACACTTTATAACCGCCATTTACGTGCTGTATATATATATATCCGTGTGCAGCGGCGCACACGGTG
GGCCTGGCGCACTGCGGAAAGTTCGCGAGCCGGGCGTACAGCAGCCCGCCGGACCCGACGCTGAACCCGAAGTACGCGGCGTTCCTGCGGAGCCGGTGCCCGTTCGACCGGTCGTCGGAC
CCGACGGTGTTCATGGACCAGGCCAGCCCGGCGCGGTTCGACAACCAGTACTTCCGGAACCTGCAGGACGGCGGCGGCCTGCTGGGCTCCGACCAGCTGCTCTACACCGACAACCGCACG
CGGCCCATGGTGGACTCGTGGGCCGCCAGCGACGCCGCCTTCAGCAAGGCCTTCGTCGACGCCATCGTCAAGCTCGGCCGCGTCGGGGTCAAGTCCGGCAGGCAGGGCAACATACGCAAG
CAGTGCGACGTCTTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGATCGTCGTGGTTCATGGTTCTTGTGCTGCTGCTTGTCTTCGCCCTCTCCGCGCGGCTGAGCGATTCCGCCCTGACGCCGGACTACTACAACAGGACGTGCCCCGGCGTGGCG
AGCATCGTGAGCGGCGTGGTGAGGCAGAAGAGGGACGCCACCATCCGGACCATCGGCTCCACCATCCGCCTCTTCTTCCACGACTGCTTCGTCGAA
GGCTGCGACGCATCGGTGCTGATC
CAGTCGACGCCGGGCAACCCGACGGAGATGGACGCCGACGACAACAAGTCCCTGGCGTTCGAAGGCTACGACACGGTGCGGGGCGCCAAGGCCGCCGTGGAGGCCGCGTGCCCCGACCAG
GTCTCCTGCGCCGACATCCTCGCCCTCGCCACGCGAGACGCCATCGTCCTG
AGCGGCGGGCCCTTCTACGAGGTGGAGCTGGGCAGGCTGGACGGGCTGAGCTCCAGCGCCAGAAGCGTG
GCAGGCAAGCTGCCGAACCCGAACCACAGCATGAACCAGCTGATCGCCATCTTCAGAGCCCACGGGCTCACCATGTCGCACCTGGTCGCCCTCTCAG
CGGCGCACACGGTGGGCCTGGCG
CACTGCGGAAAGTTCGCGAGCCGGGCGTACAGCAGCCCGCCGGACCCGACGCTGAACCCGAAGTACGCGGCGTTCCTGCGGAGCCGGTGCCCGTTCGACCGGTCGTCGGACCCGACGGTG
TTCATGGACCAGGCCAGCCCGGCGCGGTTCGACAACCAGTACTTCCGGAACCTGCAGGACGGCGGCGGCCTGCTGGGCTCCGACCAGCTGCTCTACACCGACAACCGCACGCGGCCCATG
GTGGACTCGTGGGCCGCCAGCGACGCCGCCTTCAGCAAGGCCTTCGTCGACGCCATCGTCAAGCTCGGCCGCGTCGGGGTCAAGTCCGGCAGGCAGGGCAACATACGCAAGCAGTGCGAC
GTCTTCAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGAT CGTCGTGGTT CATGGTTCTT GTGCTGCTGC TTGTCTTCGC CCTCTCCGCG CGGCTGAGCG ATTCCGCCCT GACGCCGGAC TACTACAACA GGACGTGCCC CGGCGTGGCG  AGCATCGTGA GCGGCGTGGT GAGGCAGAAG AGGGACGCCA CCATCCGGAC CATCGGCTCC ACCATCCGCC TCTTCTTCCA CGACTGCTTC GTCGAAGGCT GCGACGCATC GGTGCTGATC  CAGTCGACGC CGGGCAACCC GACGGAGATG GACGCCGACG ACAACAAGTC CCTGGCGTTC GAAGGCTACG ACACGGTGCG GGGCGCCAAG GCCGCCGTGG AGGCCGCGTG CCCCGACCAG  GTCTCCTGCG CCGACATCCT CGCCCTCGCC ACGCGAGACG CCATCGTCCT GAGCGGCGGG CCCTTCTACG AGGTGGAGCT GGGCAGGCTG GACGGGCTGA GCTCCAGCGC CAGAAGCGTG  GCAGGCAAGC TGCCGAACCC GAACCACAGC ATGAACCAGC TGATCGCCAT CTTCAGAGCC CACGGGCTCA CCATGTCGCA CCTGGTCGCC CTCTCAGCGG CGCACACGGT GGGCCTGGCG  CACTGCGGAA AGTTCGCGAG CCGGGCGTAC AGCAGCCCGC CGGACCCGAC GCTGAACCCG AAGTACGCGG CGTTCCTGCG GAGCCGGTGC CCGTTCGACC GGTCGTCGGA CCCGACGGTG  TTCATGGACC AGGCCAGCCC GGCGCGGTTC GACAACCAGT ACTTCCGGAA CCTGCAGGAC GGCGGCGGCC TGCTGGGCTC CGACCAGCTG CTCTACACCG ACAACCGCAC GCGGCCCATG  GTGGACTCGT GGGCCGCCAG CGACGCCGCC TTCAGCAAGG CCTTCGTCGA CGCCATCGTC AAGCTCGGCC GCGTCGGGGT CAAGTCCGGC AGGCAGGGCA ACATACGCAA GCAGTGCGAC  GTCTTCAACT GATTGATGAT ATGTCGTATC GTGAAAGGGA CCGGCCGATG CGTAGGTGCC TGTGTGCCCA AAAATGTGTT GTTTGTGTGC GACACAGAGA TTTCGTTCGG TTTTCTGGTT  CTGCGTGGTT TGTGAACTGT ACATGCGTGA TTTATGTTGT TTTATTCGTT GCTCGTGAAT GTGCGAGTGA TGCACATAAG TTGGATTCGA TCGAGTAAAT AAATAAAGCT CCACCAAAAT 
GTACGTAATG GGGGC 

Retrieve as FASTA