Entry information : TstAPx-CcP
Entry ID 7831
Creation 2011-01-12 (Marcel Zamocky)
Last sequence changes 2011-01-12 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-04-10 (Christophe Dunand)
Peroxidase information: TstAPx-CcP
Name TstAPx-CcP
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Talaromyces
Organism Talaromyces stipitatus (Penicillium stipitatum)    [TaxId: 28564 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TstAPx-CcP
start..stop
S start..stop
MicaAPx-CcP01 839 0 16..730 14..735
MicaAPx-CcP01 93 4e-19 806..1041 516..735
MicaAPx-CcP01 91 1e-18 540..631 648..739
MicaAPx-CcP01 89 4e-18 637..740 539..642
MicaAPx-CcP01 53 0.0000005 835..932 647..740
TtoAPx-CcP1_CBS112818 837 0 7..730 5..735
TtoAPx-CcP1_CBS112818 96 4e-20 836..1041 545..735
TtoAPx-CcP1_CBS112818 96 5e-20 639..731 541..633
TtoAPx-CcP1_CBS112818 87 1e-17 540..629 648..737
TtoAPx-CcP1_CBS112818 52 0.000001 835..932 647..740
TeqAPx-CcP1 833 0 7..730 5..735
TeqAPx-CcP1 96 5e-20 836..1041 545..735
TeqAPx-CcP1 95 7e-20 639..731 541..633
TeqAPx-CcP1 87 2e-17 540..629 648..737
TeqAPx-CcP1 52 0.000001 835..932 647..740
TrubrAPx-CcP01 832 0 7..730 5..735
TrubrAPx-CcP01 99 4e-21 800..1041 510..735
TrubrAPx-CcP01 94 2e-19 638..731 540..633
TrubrAPx-CcP01 90 3e-18 540..629 648..737
TrubrAPx-CcP01 52 0.000001 949..1049 545..640
TrubrAPx-CcP01 51 0.000002 835..932 647..740
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1169487..1170617 1131 N° 2 1169227..1169433 207 N° 3 1167640..1169168 1529 N° 4 1167439..1167572 134
N° 5 1166363..1167384 1022 N° 6 1165632..1166306 675  
complement(join(1165632..1166306,1166363..1167384,1167439..1167572,1167640..1169 168,1169227..1169433,1169487..1170617))


exon

Literature and cross-references TstAPx-CcP
Literature unpublished since 2008
Protein ref. UniProtKB:   B8M0D9
DNA ref. GenBank:   EQ962653.1 (1170617..1165632)
Protein sequence: TstAPx-CcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1565 (1544)
PWM (Da):   %s   166376.08 (164299.0)  
PI (pH):   %s   4.22 (4.23) Peptide Signal:   %s   cut: 22 range:22-1565
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTAEWLLFLTAAGSILGSASGLPTWPSSVDELEDIMFLNTGYQARAFPADITPCSFSPDGPSRISSAEWLRTAFHDMAPGNAFTGVGGLDASLQYELGGDGGENIGTAFNNTLLSFTPFFSSRASLADLIALGVYTSVRVCGGPTIPIRTGRIDATAAGPIGVPLPQNSQYTFIQQFSRMGFNVSEMIALTACGHTIGGVHASNFPEVVQSGTVPNDYQHFDSTTKFDEKIASEYIGGNTSDPLAGPLAIKNTYDSDMAVFTADNSTIRLMADPEYFQSRCQVMLQRMIEVVPAGVALTDPIAPYEVKPSNLQLTIQPGGTQLQFTGEIRVRTTNLSGDISNVQLVYVDRDGASTCGSCVIGTQYAGTANGFDDSFVFYSFSATLPAKASISSFTVQVTAGGNTVTHNNNGNGYPVQDNILFQNPQSCIAGSTDSNGNTKMTVTAAVRNTVTSGTSTLSVEVKTPRSCCVVPGLSTVNVTMAKTGTIGEYDLYRGSYALTPKQITTSKFSVSIGKFSDSFKSTALTGSCSELSGSSPVAYSYLGCYTDDVNSRTFPAATTSDNNMTLTECSNFCSGYPYFGTEYTTQCFCGSSLSNSTTEAAETDCNMLCGGDSTESCGGPSRLSVYTNNKYVIPGGTTIPGYQYLGCYNDTAAARSLSGTYTYNSKMTVESCATFCNGATYFGVEYYSECYCGDTLAADSTKQSVTDCSFPCSGNSSEFCGGGNRMNLYQLGSTIVTTSSDPVSSSTTPTTVASLPTTVTILTTTSTAASSSTSSTIVSSSSSTTVSTSAMLTSDPPPSSTSVPASLSATFSTTGSTSATTTSDTTTATGLPAGWAYRGCYVDNIGGVRSMLVQENDNSTMTIESCISQCISLDYTVAGMEYSQQCFCDNYVRNNASLATSDSQCAMTCAGSTNEICGGPNLLSVYSNAEITVLPPPTAQTTDLPGSWVYKGCLQDNVNNTRTFPYMITYANNNSATACLSRCQEYGFQAAGMEYGEQCFCGDTFDIGPDVQIVPDSQCNILCTGDTFHYCGAGNLLSYYVWEGDTPLYDWTYASGNDAGLYQFLIGGVVVPLMTTVNINGKVTFLEKWGTGPPNTTGAYELDLFYETDFDKAWRPMHVKTDIFCSAGLVLPDKAGRQLTVGGWSGVSTEGIRLYWPDGSPGNPGINDWQENQNELTLQDGRWYPSGMIMANGSILIVGGETGSNGPPVPTLEILPKVGPTLYMDWLQRTDPNNLYPFMGVLPSKTILAAYYNEARLLDEATFQTVRTLPNMPGAVNNDLGGRTYPLEGTMVFFPQYAPYTDPVRVLICGGSTPYGGDAIDNCLSIQPDVPGQNWTIERMPSKRVMTCITPLPDGTFLILNGAHQGVAGFGLATSPNLNAVLYDPTKPVNKRMTVMANTTIARLYHSESVLLPDGRVLVSGSDPEDGTHPQEYRVEVFIPPYILSGAPRPAYTITETDWAYGGTYIITVTAGNIANLKVSLIGLISTTHGNSFGHRTFFPAFTCQGNQCTITAPPDPWTSPPGWFHLFILDGPTPSHSSFVRIGGDPGELGNWPDLPDFNVPGV

Retrieve as FASTA  
Remarks complete sequence from genomic (5 introns). Fusion protein with 4 WSC carbohydrate binding domains and 1 Glyoxal oxidase. No EST found. Strain="ATCC 10500".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTAGACACCAGGAACGTTGAAGTCAGGAAGATCTGGCCAATTACCCAGTTCTCCAGGATCTCCTCCGATTCGAACGAAGGAGCTGTGGGACGGGGTAGGACCGTCAAGGATGAACAGGTG
AAACCAGCCAGGAGGAGAAGTCCACGGGTCCGGAGGGGCAGTAATAGTACACTGATTACCTTGGCAAGTAAATGCTGGGAAGAAAGTGCGATGGCCGAAACTGTTTCCGTGAGTGGTTGA
GATGAGACCAATCAGGGACACCTTCAAGTTTGCAATGTTGCCGGCGGTAACTGTGATGATGTATGTGCCTCCGTATGCCCAATCAGTTTCGGTGATGGTATATGCTGGTCGTGGGGCTCC
AGATAGGATGTACGGCGGAATGAACACCTCTACTCTGTATTCTTGGGGATGTGTACCGTCCTCTGGGTCCGAGCCGGAGACTAACACCCGCCCATCAGGTAGGAGAACTGACTCAGAGTG
GTAAAGACGAGCAATGGTGGTATTTGCCATCACTGTCATACGCTTATTGACTGGCTTTGTCGGGTCGTATAGGACAGCATTTAAATTGGGACTAGTAGCAAGACCGAAGCCGGCAACACC
TTGGTGAGCTCCATTCAGAATGAGAAAAGTGCCGTCTGGGAGGGGAGTTATGCATGTCATGACACGTTTTGAGGGCTATTAAAACGGGCGTTAGCTATGATAACTCAGTTTCTAATAGAG
ATAAAACTGACCATGCGCTCAATTGTCCAATTCTGTCCCGGAACGTCGGGCTGAATGGAGAGACAATTGTCGATAGCATCCCCGCCATAGGGAGTTGAGCCACCGCATATGAGAACCCTC
ACAGGATCTGTGTATGGAGCATACTGGGGGAAGAACACCATAGTGCCTTCGAGAGGATAAGTACGCCCGCCGAGATCGTTGTTGACGGCACCAGGCATGTTCGGCAGCGTTCGAACCGTC
TGGAATGTGGCCTCATCCAACAAACGAGCCTCATTGTAATAAGCAGCTAGAATCGTCTTGGAAGGCAAAACTCCCATAAATGGATACAGATTGTTAGGATCCGTACGTTGCAACCAATCC
ATGTAGAGTGTTGGGCCAACTTTCGGCAGGATTTCGAGGGTAGGAACAGGG
GGGCCATTGGACCCTGTCTCACCACCAACAATAAGGATAGAACCATTAGCCATGATCATACCAGAAGGA
TACCAACGACCATCCTGTAGAGTGAGTTCGTTCTGGTTTTCCTGCCAGTCATTGATACCGGGGTTTCCTGGAGAGCCATCCGGCCAATAAAGTCGGATTCCTTCGGTGGACACTCCTGAC
CACCCTCCAACAGTAAGCTGCCTTCCGGCCTTGTCAGGAAGAACGAGACCGGCGGAGCAAAAAATATCTGT
TTTGACGTGCATCGGCCGCCATGCTTTATCAAAATCAGTCTCATAAAAT
AGATCCAGCTCATAGGCACCGGTAGTGTTTGGAGGTCCGGTACCCCATTTTTCTAAGAAGGTGACTTTCCCATTAATATTAACGGTAGTCATCAAAGGCACCACAACACCACCGATCAGG
AACTGGTAAAGACCAGCGTCATTTCCCGAAGCATATGTCCAATCGTACAAAGGAGTGTCGCCTTCCCAAACGTAGTAACTAAGGAGGTTTCCGGCGCCACAATAGTGAAAGGTATCACCA
GTGCAGAGAATGTTGCATTGAGAATCAGGGACGATTTGAACATCAGGGCCAATGTCAAATGTGTCGCCGCAGACTAAGATGCGTTAAAACTGACAGAATAATTTCTCTAGATGGAATAGG
GACCCACAGCACTGTTCACCGTACTCCATACCGGCCGCCTGGAATCCGTACTCTTGGCAACGAGAAAGACAAGCAGTCGCCGAGTTATTGTTTGCGTAAGTAATCATATAGGGGAAAGTT
CGTGTGTTATTAACGTTGTCCCTAGAGAATATCAGCTTTAGTCACGATCCTGTGATAAGACTTGAAATGTAGTAGTGTATGGACATACTGAAGGCAGCCCTTGTAGACCCAGGATCCAGG
TAAATCCGTTGTTTGAGCTGTCGGCGGAGGTAAAACGGTTATTTCGGCGTTAGAATAGACACTGAGGAGATTAGGTCCACCACAAATTTCATTTGTACTCCCGGCACAGGTCATGGCACA
CTGGGAATCCGAGGTTGCCAACGAAGCATTGTTACGCACGTAGTTATCACAGAAGCACTGTTGGGAATATTCCATGCCTGCCACGGTATAGTCCAAGGATATACATTGACTAATGCAGGA
TTCGATGGTCATTGTAGAGTTATCATTTTCTTGGACGAGCATAGAACGAACGCCACCGATATTGTCCACATAGCAACCCCGGTAGGCCCATCCAGCGGGTAACCCTGTAGCAGTTGTAGT
GTCACTGGTGGTAGTTGCGCTGGTAGATCCAGTAGTGCTGAAGGTAGCCGAGAGAGATGCAGGTACGCTCGTAGAAGATGGTGGGGGATCGGAGGTTAACATAGCGCTGGTGGATACGGT
TGTAGAAGATGATGAGGATACGATGGTTGACGAAGTACTGCTAGATGCAGCTGTGCTTGTGGTAGTTAGGATAGTGACGGTTGTAGGCAAGGATGCAACGGTGGTTGGTGTCGTGCTGGA
AGAGACTGGATCTGAAGAAGTCGTCACAATAGTTGAGCCCAGCTGGTACAAATTCATTCTGTTACCACCACCGCAGAATTCGCTGCTGTTCCCAGAGCAGGGAAAAGAACAATCAGTCAC
TGACTGTTTGGTGCTATCTGCTGCCAGAGTGTCACCACAGTAGCATTCGCTGTAGTACTCTACACCGAAATAAGTGGCACCATTGCAGAAAGTAGCACAAGACTCTACTGTCATCTTGCT
GTTGTATGTGTAGGTGCCAGAAAGACTGCGAGCGGCAGCTGTGTCGTTGTAACAGCCAAGATATTGATAGCCCGGAATTGTAGTTCCTCCTGGGATGA
CATACTTGTTGTTCGTGTAGAC
GGAAAGCCTGCTGGGTCCACCGCATGATTCTGTGCTATCTCCTCCACAAAGCATGTTGCAATCCGTCTCCGCAGCCTCGGTAGTCGAGTTGCTTAGACTAGAGCCGCAAAAACACTGTGT
TGTATATTCAGTTCCAAAATATGGATAGCCACTGCAGAAGTTCGAACACTCCGTCAGGG
TCATGTTGTTGTCACTGGTAGTCGCGGCTGGGAATGTTCTGGAGTTGACGTCGTCGGTGTA
GCAGCCAAGATAGCTATACGCTACCGGACTAGAGCCACTCAGTTCCGAGCAGGAGCCAGTAAGTGCTGTGCTTTTGAAACTATCAGAAAATTTCCCGATCGAAACGCTGAATTTGGATGT
AGTAATCTGTTTGGGTGTAAGAGCATAGCTCCCTCTATACAGGTCGTATTCGCCAATCGTTCCTGTCTTTGCCATCGTGACGTTAACGGTGGACAGCCCCGGAACAACACAGCAGGATCG
AGGTGTTTTGACCTCTACAGAGAGGGTTGAAGTGCCTGAAGTGACTGTGTTACGGACCTGCAATAACATATCTTAGAACTATGTCACCAAGTCCTCAGGACATAAGATTCCTTACCGCGG
CAGTAACTGTCATTTTGGTATTACCGTTGCTGTCAGTTGAACCGGCTATGCAGCTTTGGGGATTTTGAAACAAAATGTTGTCCTGAACTGGATACCCATTCCCATTATTATTATGGGTCA
CTGTATTACCACCAGCCGTCACCTGCACAGTGAATGACGAGATAGAGGCCTTGGCCGGCAATGTTGCAGAGAAGCTATAGAACTGTTGATCACTGTCAGTAACACTAACCTCCTTAAAGC
TGAAGAAAGCCTTACGACAAAAGAATCATCAAAGCCATTGGCTGTTCCCGCGTACTGCGTTCCGATAACACAGGATCCGCAAGTGGAAGCGCCGTCGCGGTCAACATATACAAGTTGAAC
GTTCGAAATATCACCGCTGAGGTTTGTTGTTCGGACACGGATCTCACCAGTAAATTGCAGCTGAGTGCCACCGGGCTGTATTGTTAACTGCAAGTTACTCGGCTTTACCTCATAAGGAGC
AATTGGGTCCGTGAGAGCCACCCCAGCAGGGACAACCTCAATCATTCGCTGAAGCATCACCTGGCAACGGGATTGAAAGTACTCAGGGTCGGCCATGAGGCGAATTGTAGAATTGTCAGC
GGTAAAGACTGCCATATCCGAGTCGTAGGTATTCTTTATTGCCAATGGCCCAGCT
AGCGGATCTGAGGTGTTTCCACCGATATATTCTGAGGCAATCTTCTCATCAAACTTTGTCGTCGA
ATCGAAGTGCTGGTAGTCATTTGGGACTGTCCCAGACTGTACCACCTCGGGGAAGTTGCTGGCATGAACGCCGCCGATAGTATGACCGCACGCTGTCAGGGCAATCATTTCCGACACATT
GAAGCCCATACGCGAAAACTGCTGGATGAACGTATACTGTGAATTTTGCGGCAACGGCACTCCTATCGGTCCAGCTGCAGTGGCATCAATGCGGCCTGTGCGAATAGGGATGGTCGGGCC
ACCGCAGACTCGAACTGATGTATACACACCCAGTGCAATGAGATCGGCCAGTGATGCTCGAGATGAAAAAAAAGGCGTGAAGGAGAGTAGAGTGTTATTAAACGCGGTACCGATGTTTTC
CCCGCCGTCTCCTCCCAACTCATACTGCAAAGACGCATCCAGTCCTCCTACACCGGTGAAGGCGTTACCTGGGGCCATGTCGTGGAAAGCTGTGCGAAGCCATTCTGCTGAGGAAATCCT
CGACGGGCCGTCTGGCGAGAATGAACACGGCGTGATGTCGGCGGGGAAAGCTCTTGCCTGGTAGCCAGTGTTCAAGAACATGATATCTTCTAGCTCATCTACCGAGGAGGGCCATGTCGG
CAGACCTGAGGCAGACCCCAGGATCGATCCGGCCGCCGTCAGGAAGAGTAGCCACTCAGCCGTCAT

Retrieve as FASTA