Entry information : BdiPrx15 (Bradi1g20020)
Entry ID 7834
Creation 2011-01-12 (Toky Ramarohetra)
Last sequence changes 2011-01-12 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx15 (Bradi1g20020)
Name (synonym) BdiPrx15 (Bradi1g20020)
Class Class III peroxidase    [Orthogroup: Prx081]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx15
start..stop
S start..stop
BdiPrx14 412 4e-145 1..346 1..346
BdiPrx13 412 6e-145 22..347 3..330
ZmPrx63 342 3e-117 50..346 52..349
ZmPrx68 340 1e-116 47..346 29..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16010701..16010988 288 N° 2 16011120..16011875 756  
join(16010701..16010988,16011120..16011875)


exon

Literature and cross-references BdiPrx15 (Bradi1g20020)
DNA ref. Phytozome 12:   Bd1 (16010701..16011875)
EST ref. GenBank:   GT800427.1 [3' end]   GT800428.1 [3' end]
Protein sequence: BdiPrx15 (Bradi1g20020)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347 (320)
PWM (Da):   %s   37687.95 (35004.5) Transmb domain:   %s   i9-31o
PI (pH):   %s   5.77 (5.77) Peptide Signal:   %s   cut: 28 range:28-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSDKQKLVALAVVVALLGCVATICEASHGFPYPMTPREKKTIPALGLGLAFDYYKDTKCRGVEKTVRRVVKEEVDRYPGIGAGLIRLFFHDCFVEGCDASVLLKATKDNPQPEMLGIPNINSLRGFEVIDKAKDALGEECREVVSCADILAFAARDATVLLGKVKHFEMPAGRYDGKRSLASDTLPNLPPPFADVATLKAMFLEKGLNTDEMVVLSGAHTIGISHCSSFGSRINASNPSDMDPNYASELRAKCNNQPTNTVNQDFKTPDDLDRQYYQNVLDKKVLFESDAALLSSSDTEGAVKEYAEPSGKWEEKFQEAMVKMGNIGVKSKGNDAEIRKVCGSVNY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1), 2 ESTs. Strain="Bd21".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTAGTGACAAGCAGAAGCTTGTGGCCTTGGCTGTGGTGGTAGCGTTGCTTGGTTGCGTGGCAACCATATGCGAAGCGAGCCATGGGTTTCCCTACCCGATGACCCCTAGAGAGAAG
AAGACCATTCCTGCCTTAGGCTTAGGGCTCGCCTTCGACTATTACAAAGATACCAAGTGCCGCGGAGTGGAGAAAACCGTGAGGCGCGTCGTGAAAGAGGAGGTGGACCGGTACCCCGGC
ATCGGTGCAGGGCTCATCCGCCTCTTCTTCCACGACTGTTTTGTCGAG
GTACTTACATTTACATATACATATGTGTCTCTGTTGCAGTCAAAAAAATAAATCTTACTATCTCGATGGGTT
GATCTAGAATGTACTAGCTTGCAATTTGACACGACAGATTTATTTACTTTGGAGTCCAGGGCTGCGACGCATCGGTCCTCCTCAAGGCGACCAAGGACAACCCACAACCGGAGATGCTCG
GCATCCCCAACATCAATAGCCTGCGTGGCTTCGAAGTGATCGACAAGGCCAAAGACGCTCTCGGTGAGGAGTGCAGGGAGGTCGTGTCGTGCGCCGATATCCTGGCCTTCGCTGCGCGTG
ATGCCACCGTCCTCCTCGGGAAGGTAAAGCACTTCGAAATGCCCGCTGGCCGCTACGACGGGAAACGGTCCCTTGCCAGCGACACCCTCCCCAACCTGCCCCCTCCCTTCGCCGATGTCG
CCACCCTCAAGGCTATGTTCCTAGAGAAGGGGCTCAACACCGACGAGATGGTTGTCCTCTCTGGTGCCCACACCATCGGGATCTCCCACTGCTCATCCTTCGGCAGCCGCATCAACGCCT
CTAACCCCTCGGATATGGACCCCAATTACGCATCTGAGCTGAGGGCTAAATGCAACAACCAGCCAACGAACACGGTAAATCAGGACTTCAAGACCCCGGATGATCTAGACAGGCAGTACT
ACCAGAACGTGCTCGACAAGAAAGTGTTATTCGAATCAGACGCCGCACTCTTGTCGTCGTCAGACACAGAGGGCGCAGTGAAAGAATACGCCGAGCCCTCTGGGAAGTGGGAGGAAAAGT
TCCAGGAAGCCATGGTGAAGATGGGAAACATCGGGGTGAAGAGCAAAGGCAATGATGCCGAGATCAGGAAGGTGTGCGGGTCCGTCAACTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTAGTGACAAGCAGAAGCTTGTGGCCTTGGCTGTGGTGGTAGCGTTGCTTGGTTGCGTGGCAACCATATGCGAAGCGAGCCATGGGTTTCCCTACCCGATGACCCCTAGAGAGAAG
AAGACCATTCCTGCCTTAGGCTTAGGGCTCGCCTTCGACTATTACAAAGATACCAAGTGCCGCGGAGTGGAGAAAACCGTGAGGCGCGTCGTGAAAGAGGAGGTGGACCGGTACCCCGGC
ATCGGTGCAGGGCTCATCCGCCTCTTCTTCCACGACTGTTTTGTCGAG
GGCTGCGACGCATCGGTCCTCCTCAAGGCGACCAAGGACAACCCACAACCGGAGATGCTCGGCATCCCCAAC
ATCAATAGCCTGCGTGGCTTCGAAGTGATCGACAAGGCCAAAGACGCTCTCGGTGAGGAGTGCAGGGAGGTCGTGTCGTGCGCCGATATCCTGGCCTTCGCTGCGCGTGATGCCACCGTC
CTCCTCGGGAAGGTAAAGCACTTCGAAATGCCCGCTGGCCGCTACGACGGGAAACGGTCCCTTGCCAGCGACACCCTCCCCAACCTGCCCCCTCCCTTCGCCGATGTCGCCACCCTCAAG
GCTATGTTCCTAGAGAAGGGGCTCAACACCGACGAGATGGTTGTCCTCTCTGGTGCCCACACCATCGGGATCTCCCACTGCTCATCCTTCGGCAGCCGCATCAACGCCTCTAACCCCTCG
GATATGGACCCCAATTACGCATCTGAGCTGAGGGCTAAATGCAACAACCAGCCAACGAACACGGTAAATCAGGACTTCAAGACCCCGGATGATCTAGACAGGCAGTACTACCAGAACGTG
CTCGACAAGAAAGTGTTATTCGAATCAGACGCCGCACTCTTGTCGTCGTCAGACACAGAGGGCGCAGTGAAAGAATACGCCGAGCCCTCTGGGAAGTGGGAGGAAAAGTTCCAGGAAGCC
ATGGTGAAGATGGGAAACATCGGGGTGAAGAGCAAAGGCAATGATGCCGAGATCAGGAAGGTGTGCGGGTCCGTCAACTACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTTCACCCAT CATCCTTCCT TCTTATCTCC TCTCTTCTCT TGAGCTTCAC AGCAAGCAAC CATGGGTAGT GACAAGCAGA AGCTTGTGGC CTTGGCTGTG GTGGTAGCGT TGCTTGGTTG  CGTGGCAACC ATATGCGAAG CGAGCCATGG GTTTCCCTAC CCGATGACCC CTAGAGAGAA GAAGACCATT CCTGCCTTAG GCTTAGGGCT CGCCTTCGAC TATTACAAAG ATACCAAGTG  CCGCGGAGTG GAGAAAACCG TGAGGCGCGT CGTGAAAGAG GAGGTGGACC GGTACCCCGG CATCGGTGCA GGGCTCATCC GCCTCTTCTT CCACGACTGT TTTGTCGAGG GCTGCGACGC  ATCGGTCCTC CTCAAGGCGA CCAAGGACAA CCCACAACCG GAGATGCTCG GCATCCCCAA CATCAATAGC CTGCGTGGCT TCGAAGTGAT CGACAAGGCC AAAGACGCTC TCGGTGAGGA  GTGCAGGGAG GTCGTGTCGT GCGCCGATAT CCTGGCCTTC GCTGCGCGTG ATGCCACCGT CCTCCTCGGG AAGGTAAAGC ACTTCGAAAT GCCCGCTGGC CGCTACGACG GGAAACGGTC  CCTTGCCAGC GACACCCTCC CCAACCTGCC CCCTCCCTTC GCCGATGTCG CCACCCTCAA GGCTATGTTC CTAGAGAAGG GGCTCAACAC CGACGAGATG GTTGTCCTCT CTGGTGCCCA  CACCATCGGG ATCTCCCACT GCTCATCCTT CGGCAGCCGC ATCAACGCCT CTAACCCCTC GGATATGGAC CCCAATTACG CATCTGAGCT GAGGGCTAAA TGCAACAACC AGCCAACGAA  CACGGTAAAT CAGGACTTCA AGACCCCGGA TGATCTAGAC AGGCAGTACT ACCAGAACGT GCTCGACAAG AAAGTGTTAT TCGAATCAGA CGCCGCACTC TTGTCGTCGT CAGACACAGA  GGGCGCAGTG AAAGAATACG CCGAGCCCTC TGGGAAGTGG GAGGAAAAGT TCCAGGAAGC CATGGTGAAG ATGGGAAACA TCGGGGTGAA GAGCAAAGGC AATGATGCCG AGATCAGGAA  GGTGTGCGGG TCCGTCAACT ACTGATCCAA TGATCATGCA TGCATACATC ATCTTATTAA TCCACTCAAC ATCAACACCT GTGACCTTAC CGAGATTTTG CTGTGTGTAC GCTATTTTGG  AATTTCCGTT CATTGTTGTT TAATTATTTA ATTTCACTAA ACTATCTTGC TTTATTATCG GGTTACATTT GTATAATGAA GTTATGGTTG TACTTCCATC TATTAACGAG AGTTCCGTGC 
TACTTCTTGT GCTACTTCTT GTTT 

Retrieve as FASTA