Entry information : BdiPrx32 (Bradi1g44790)
Entry ID 7839
Creation 2011-01-12 (Toky Ramarohetra)
Last sequence changes 2011-01-12 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx32 (Bradi1g44790)
Name (synonym) BdiPrx32 (Bradi1g44790)
Class Class III peroxidase    [Orthogroup: Prx223]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx32
start..stop
S start..stop
BdiPrx33 603 0 1..320 1..320
BdiPrx30 514 0 19..320 18..322
TaPrx101 492 3e-177 26..320 34..339
SbPrx145 487 2e-175 20..320 22..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42899346..42899561 216 N° 2 42899731..42900477 747  
join(42899346..42899561,42899731..42900477)


exon

Literature and cross-references BdiPrx32 (Bradi1g44790)
DNA ref. Phytozome 12:   Bd1 (42899346..42900477)
Protein sequence: BdiPrx32 (Bradi1g44790)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (295)
PWM (Da):   %s   33967.36 (31435.9)  
PI (pH):   %s   7.73 (7.41) Peptide Signal:   %s   cut: 26 range:26-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIIRSWQLPLALLVILAASSAAAAQLEIGFYSKTCPDAEKIVQEEMTKIIAAAPSLAGPLLRLHFHDCFVRGCDASVLLESTAGNTAEKDAKPNRSLRGFGSVDRVKAKLEAACPGTVSCADVLTLMSRDAVVLSNGPHWPVALGRRDGRASSAAEASKELPPASGDVPLLAKIFASKGLNLKDLAVLSGGHTLGTAHCASFDDRLANATVDPSLDSEYADRLRLKCGSGSVLAEMDPGSYKTFDGSYYRHVVKRRGLFRSDAALLDDATTGDYVRRVASGKFDAEFFTDFSESMIKMGNVGVLTGNQGEIRKKCYVLN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATCATCAGGTCTTGGCAGCTCCCTCTGGCCCTCCTGGTCATCCTCGCAGCTAGCTCGGCCGCAGCGGCTCAGCTGGAGATCGGCTTCTACAGCAAGACGTGCCCTGACGCCGAG
AAGATCGTCCAAGAGGAGATGACCAAGATCATCGCCGCCGCGCCCAGCCTCGCCGGCCCTCTCCTCCGCCTCCATTTCCACGACTGCTTCGTCCGG
GTAAGTACATACACAATTAATTTG
CGTTGCCGTTCGTCTCATTTGTCATTTCCACGACTCACTTTTTTCTTCGAAAAGGAAGAAGCTTAGAAGCCCCCTGGCCTCTACATCGATTGATGCACACAACCATATTTCCACGACTCA
CAAGCTACGTAAATTTGCATTGCAGGGATGTGATGCGTCGGTGCTGCTGGAGTCCACGGCGGGGAACACGGCAGAGAAGGACGCGAAGCCGAACAGGAGCCTACGCGGGTTTGGGTCGGT
GGACCGGGTGAAAGCCAAACTAGAAGCCGCGTGCCCAGGCACTGTCTCCTGCGCCGACGTGCTCACGCTCATGTCCCGCGACGCCGTGGTCCTGTCCAACGGGCCCCACTGGCCAGTAGC
GCTAGGCCGGAGGGACGGCAGGGCGTCGAGTGCCGCCGAGGCCAGCAAAGAGCTTCCCCCGGCGTCCGGCGACGTGCCGCTCCTTGCCAAGATCTTTGCTTCCAAGGGGCTCAACCTCAA
GGACCTCGCCGTGCTCTCCGGCGGCCACACCCTCGGCACGGCGCACTGCGCGTCGTTTGACGACAGGCTCGCCAACGCCACTGTTGATCCGTCACTGGACAGCGAGTACGCCGACAGGCT
GAGGCTCAAGTGCGGGAGCGGCAGCGTGCTGGCGGAGATGGACCCCGGGAGCTACAAGACCTTTGATGGAAGCTACTACCGCCACGTGGTGAAGCGGAGGGGGCTCTTTCGATCCGACGC
AGCGCTCCTCGACGACGCTACCACCGGGGACTACGTCCGGAGAGTTGCCTCGGGGAAGTTTGATGCCGAGTTCTTCACGGATTTCAGCGAGTCCATGATCAAGATGGGCAACGTCGGCGT
GCTCACCGGAAACCAGGGGGAGATCAGAAAGAAGTGCTACGTCCTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATCATCAGGTCTTGGCAGCTCCCTCTGGCCCTCCTGGTCATCCTCGCAGCTAGCTCGGCCGCAGCGGCTCAGCTGGAGATCGGCTTCTACAGCAAGACGTGCCCTGACGCCGAG
AAGATCGTCCAAGAGGAGATGACCAAGATCATCGCCGCCGCGCCCAGCCTCGCCGGCCCTCTCCTCCGCCTCCATTTCCACGACTGCTTCGTCCGG
GGATGTGATGCGTCGGTGCTGCTG
GAGTCCACGGCGGGGAACACGGCAGAGAAGGACGCGAAGCCGAACAGGAGCCTACGCGGGTTTGGGTCGGTGGACCGGGTGAAAGCCAAACTAGAAGCCGCGTGCCCAGGCACTGTCTCC
TGCGCCGACGTGCTCACGCTCATGTCCCGCGACGCCGTGGTCCTGTCCAACGGGCCCCACTGGCCAGTAGCGCTAGGCCGGAGGGACGGCAGGGCGTCGAGTGCCGCCGAGGCCAGCAAA
GAGCTTCCCCCGGCGTCCGGCGACGTGCCGCTCCTTGCCAAGATCTTTGCTTCCAAGGGGCTCAACCTCAAGGACCTCGCCGTGCTCTCCGGCGGCCACACCCTCGGCACGGCGCACTGC
GCGTCGTTTGACGACAGGCTCGCCAACGCCACTGTTGATCCGTCACTGGACAGCGAGTACGCCGACAGGCTGAGGCTCAAGTGCGGGAGCGGCAGCGTGCTGGCGGAGATGGACCCCGGG
AGCTACAAGACCTTTGATGGAAGCTACTACCGCCACGTGGTGAAGCGGAGGGGGCTCTTTCGATCCGACGCAGCGCTCCTCGACGACGCTACCACCGGGGACTACGTCCGGAGAGTTGCC
TCGGGGAAGTTTGATGCCGAGTTCTTCACGGATTTCAGCGAGTCCATGATCAAGATGGGCAACGTCGGCGTGCTCACCGGAAACCAGGGGGAGATCAGAAAGAAGTGCTACGTCCTCAAC
TAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATCA TCAGGTCTTG GCAGCTCCCT CTGGCCCTCC TGGTCATCCT CGCAGCTAGC TCGGCCGCAG CGGCTCAGCT GGAGATCGGC TTCTACAGCA AGACGTGCCC TGACGCCGAG  AAGATCGTCC AAGAGGAGAT GACCAAGATC ATCGCCGCCG CGCCCAGCCT CGCCGGCCCT CTCCTCCGCC TCCATTTCCA CGACTGCTTC GTCCGGGGAT GTGATGCGTC GGTGCTGCTG  GAGTCCACGG CGGGGAACAC GGCAGAGAAG GACGCGAAGC CGAACAGGAG CCTACGCGGG TTTGGGTCGG TGGACCGGGT GAAAGCCAAA CTAGAAGCCG CGTGCCCAGG CACTGTCTCC  TGCGCCGACG TGCTCACGCT CATGTCCCGC GACGCCGTGG TCCTGTCCAA CGGGCCCCAC TGGCCAGTAG CGCTAGGCCG GAGGGACGGC AGGGCGTCGA GTGCCGCCGA GGCCAGCAAA  GAGCTTCCCC CGGCGTCCGG CGACGTGCCG CTCCTTGCCA AGATCTTTGC TTCCAAGGGG CTCAACCTCA AGGACCTCGC CGTGCTCTCC GGCGGCCACA CCCTCGGCAC GGCGCACTGC  GCGTCGTTTG ACGACAGGCT CGCCAACGCC ACTGTTGATC CGTCACTGGA CAGCGAGTAC GCCGACAGGC TGAGGCTCAA GTGCGGGAGC GGCAGCGTGC TGGCGGAGAT GGACCCCGGG  AGCTACAAGA CCTTTGATGG AAGCTACTAC CGCCACGTGG TGAAGCGGAG GGGGCTCTTT CGATCCGACG CAGCGCTCCT CGACGACGCT ACCACCGGGG ACTACGTCCG GAGAGTTGCC  TCGGGGAAGT TTGATGCCGA GTTCTTCACG GATTTCAGCG AGTCCATGAT CAAGATGGGC AACGTCGGCG TGCTCACCGG AAACCAGGGG GAGATCAGAA AGAAGTGCTA CGTCCTCAAC  TAGGCTGTGT GGAGCAGCGA TTCGTACGTA AGTCCTCGTG TTGTTAAGCG GAGTAGCGGA CTAAGGTGGG GTACGTTAAT TTTAGTTGTG TGTCTGATGG TATTCATTGT AGTGTGAGAA  ATTATTGTCA TCACCAAATA TTCAGTAAAT TATTTCTTTA CCAAGTTAGT ATGCATGTAT GTAACGCAGT ACTTTGATAA ATAGACATGT GTCACACATT GTGTGATATG CTCTGTTCCA 
AAATAGAAGA TATATAGGAA ATGATATTCA GAAAATCTAT AAAGCACACG ATTCGC 

Retrieve as FASTA