Entry information : ZmPrx74
Entry ID 784
Creation 2006-02-02 (Christophe Dunand)
Last sequence changes 2006-02-02 (Christophe Dunand)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx74
Name ZmPrx74
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Ears
Endosperm
Meristems
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx74
start..stop
S start..stop
SbPrx02 587 0 1..325 1..326
SiPrx163 559 0 1..325 1..324
OsPrx51 526 0 1..324 1..323
BdiPrx01 488 9e-176 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 279566100..279566312 213 N° 2 279566406..279566606 201 N° 3 279566823..279566988 166 N° 4 279567486..279567883 398
join(279566100..279566312,279566406..279566606,279566823..279566988,279567486..2 79567883)


exon

Literature and cross-references ZmPrx74
Literature Wen,T.J. et al., unpublushed
DNA ref. GenBank:   AC177884.3 (8283..10063)   AC186424.4 (58034..59817)
mRNA ref. GenBank:   AX546798 [Mismatch]
Cluster/Prediction ref. UniGene:   Zm.17662
Protein sequence: ZmPrx74
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (301)
PWM (Da):   %s   33825.97 (31691.8) Transmb domain:   %s   i7-24o
PI (pH):   %s   4.27 (4.22) Peptide Signal:   %s   cut: 25 range:25-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGAGIRVLAALLAALAAATAGVTAQLRQDYYAAVCPDLESIVRAAVSKKVQAQPVAVGATIRLFFHDCFVEGCDASVILVSTGNNTAEKDHPSNLSLAGDGFDTVIQAKAAVDAVPACANQVSCADILALATRDVIELAGGPSYAVELGRLDGLVSMSTNVDGKLPPPSFNLDQLTSIFALNNLSQADMIALSAAHTVGFAHCSTFSDRIQPQSVDPTMNATYAEDLQAACPAGVDPNIALQLDPVTPQAFDNQYFANLVDGRGLFASDQVLFSDARSQPTVVAWAQNATAFEQAFVDAITRLGRVGVKTDPSLGDVRRDCAFLN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns) and 137 ESTs. Cultivar="W22", "B73".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGCCGGGATCAGGGTCCTGGCGGCGCTCTTGGCGGCGCTCGCGGCAGCCACCGCCGGCGTGACGGCGCAGCTGCGGCAGGACTACTACGCGGCGGTGTGCCCGGACCTGGAGAGC
ATCGTGCGCGCCGCGGTGTCCAAGAAGGTGCAGGCGCAGCCCGTCGCCGTGGGCGCCACCATCCGCCTCTTCTTCCACGACTGCTTCGTCGAG
GTGCGCGCTTCCTCTTCCTCTTCCTCG
ACGACTGCCTGTGTTTCTGACGGACCGGGGCGACTGGCGATGCTTCAACTTCCCGCGTGCATGCAGGGCTGCGACGCGTCGGTGATCCTGGTGTCCACGGGGAACAACACGGCGGAGAAG
GACCACCCGAGCAACCTCTCCCTGGCCGGCGACGGCTTCGACACCGTCATCCAGGCCAAGGCGGCCGTGGACGCCGTGCCGGCGTGCGCCAACCAGGTGTCGTGCGCCGACATCCTGGCG
CTGGCCACCCGGGACGTCATTGAGCTG
GTACCATACCACACGTCCTCTCCTAGCACACGCGGCGCGGTCCAATCAATGCCCGGCACAGATCGCACCCACCTTTCTTCTTCCGGACCCCCA
AAGCTCCCGAACTTTGGAGGATTCCCCTGGGATGCGGAAGCGGAGCCTACTAGTAAAGCGTAGCGTAGTAGGACAGCAGCACTACAGGGTACAGGCTCTCTGATCCTCGATCGGTTCGCG
CAGGCTGGCGGGCCGTCGTACGCGGTGGAGCTGGGGAGGCTGGACGGGCTGGTGTCCATGTCCACCAACGTCGACGGCAAGCTGCCGCCGCCGTCCTTCAACCTGGACCAGCTGACGAGC
ATTTTCGCCCTCAACAACCTGTCGCAGGCCGACATGATTGCTTTATCTG
GTGAGCAAATTACTACCGCTCCAGTGCGTTCTTCTTTTTTCCCCCTTCAACAGCTGCTGTATCAGCGTCAG
CGAAGTACGCAGGCTAGATTCCGTTCCATGTCTTTCAAGTCAAGCAAAGGGCCCGCCCAACGGACCAAGGCCAACGCTCCCAGCGCCGCAATTAACTGCAAACGTTTTATTATTAGTGGT
CTCTCGAAGCATCCGTAGCGCCCATAGAAAATGCATTATCCCCCCTAGCCCTAGGTTAGTAGTAGTACAGTGGAGTGTGTGTGTGTGTGGCACTGCAGCTGGTCGCTCGTAGTCGTAGAT
CTGAAACGAGTCAACCGTGGCGACTGTCTCTGTCTGGAATGCTGGCTCGGTAGCCGTGCTTGCTTGCACAGATGCACGTGAAAGACCGGCCAGCATCGCATTATTGATACCATACCATGG
CCTCTGGCTGAACTGAGCTGACGTGGCGTTGGGGTTCCTTCCTCATCGGCTCATCCTCTTGCACAGCGGCGCACACGGTGGGGTTCGCGCACTGCAGCACGTTCTCGGACCGGATCCAGC
CGCAGTCGGTGGACCCGACGATGAACGCGACGTACGCGGAGGACCTGCAGGCGGCGTGCCCGGCGGGGGTGGACCCCAACATCGCGCTGCAGCTGGACCCCGTGACGCCGCAGGCCTTCG
ACAACCAGTACTTCGCCAACCTGGTGGACGGCCGGGGGCTCTTCGCCTCCGACCAGGTGCTCTTCTCCGACGCGCGGTCGCAGCCCACCGTGGTGGCGTGGGCGCAGAACGCCACCGCCT
TCGAGCAGGCCTTCGTCGACGCCATCACCAGGCTCGGCCGCGTCGGCGTCAAGACCGACCCGTCGCTGGGGGACGTCCGCCGCGACTGCGCCTTCCTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGCCGGGATCAGGGTCCTGGCGGCGCTCTTGGCGGCGCTCGCGGCAGCCACCGCCGGCGTGACGGCGCAGCTGCGGCAGGACTACTACGCGGCGGTGTGCCCGGACCTGGAGAGC
ATCGTGCGCGCCGCGGTGTCCAAGAAGGTGCAGGCGCAGCCCGTCGCCGTGGGCGCCACCATCCGCCTCTTCTTCCACGACTGCTTCGTCGAG
GGCTGCGACGCGTCGGTGATCCTGGTG
TCCACGGGGAACAACACGGCGGAGAAGGACCACCCGAGCAACCTCTCCCTGGCCGGCGACGGCTTCGACACCGTCATCCAGGCCAAGGCGGCCGTGGACGCCGTGCCGGCGTGCGCCAAC
CAGGTGTCGTGCGCCGACATCCTGGCGCTGGCCACCCGGGACGTCATTGAGCTG
GCTGGCGGGCCGTCGTACGCGGTGGAGCTGGGGAGGCTGGACGGGCTGGTGTCCATGTCCACCAAC
GTCGACGGCAAGCTGCCGCCGCCGTCCTTCAACCTGGACCAGCTGACGAGCATTTTCGCCCTCAACAACCTGTCGCAGGCCGACATGATTGCTTTATCTG
CGGCGCACACGGTGGGGTTC
GCGCACTGCAGCACGTTCTCGGACCGGATCCAGCCGCAGTCGGTGGACCCGACGATGAACGCGACGTACGCGGAGGACCTGCAGGCGGCGTGCCCGGCGGGGGTGGACCCCAACATCGCG
CTGCAGCTGGACCCCGTGACGCCGCAGGCCTTCGACAACCAGTACTTCGCCAACCTGGTGGACGGCCGGGGGCTCTTCGCCTCCGACCAGGTGCTCTTCTCCGACGCGCGGTCGCAGCCC
ACCGTGGTGGCGTGGGCGCAGAACGCCACCGCCTTCGAGCAGGCCTTCGTCGACGCCATCACCAGGCTCGGCCGCGTCGGCGTCAAGACCGACCCGTCGCTGGGGGACGTCCGCCGCGAC
TGCGCCTTCCTCAACTGA

Retrieve as FASTA