Entry information : BdiPrx43 (Bradi1g63070)
Entry ID 7845
Creation 2011-01-13 (Toky Ramarohetra)
Last sequence changes 2011-01-13 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx43 (Bradi1g63070)
Name (synonym) BdiPrx43 (Bradi1g63070)
Class Class III peroxidase    [Orthogroup: Prx024]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx43
start..stop
S start..stop
BdiPrx44 613 0 1..324 2..327
SofPrx11 513 0 10..322 1..317
SiPrx165 501 0 15..322 1..311
OsPrx40 496 4e-179 22..324 15..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 62275051..62275272 222 N° 2 62274752..62274940 189 N° 3 62274082..62274645 564  
complement(join(62274082..62274645,62274752..62274940,62275051..62275272))


exon

Literature and cross-references BdiPrx43 (Bradi1g63070)
DNA ref. Phytozome 12:   Bd1 (62275272..62274082)
Protein sequence: BdiPrx43 (Bradi1g63070)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (298)
PWM (Da):   %s   33687.88 (31134.6) Transmb domain:   %s   i5-24o
PI (pH):   %s   6.34 (6.02) Peptide Signal:   %s   cut: 27 range:27-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRGYCFVACVVALALALLATASNGQPLDACFYDKVCPAALPAIKTVVEQAVAVEPRMGASLLRLHFHDCFVNGCDGSILLDDTPSFTGEKNAAPNANSVRGFDVIDRIKDAVDAACRGNVVSCADILAAAARDSILGGPSYAVPLGRRDSRTASQAAANNSIPAPTLDLGGLVSNFASHGLSVQDLVVLSGGHTLGFSRCTNFRDRLYNETATLDASLAASLRAVCPRPAGDGDDNLAPLDPTPARFDGAYYGSLLRSKALLHSDQQLLAAGATEGLVRFYGANPEAFRRDFAEAMVRMSSLAPLTGSSGEIRANCRKVNGY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1 and 2), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCGCGGGTACTGCTTTGTGGCGTGCGTCGTGGCGCTGGCGCTGGCTTTGTTGGCCACGGCGAGCAATGGCCAGCCGCTGGACGCTTGTTTCTATGACAAGGTGTGCCCAGCG
GCGCTCCCGGCCATTAAGACGGTCGTGGAGCAGGCCGTCGCGGTGGAGCCGCGCATGGGCGCCTCGCTCCTGCGTCTGCACTTCCACGACTGCTTCGTCAAC
GTACGTACACTACACACT
TCGAACTTCGATCTTTCTTTGGATTGGTACGCCGCGCGTACGTATTGCTAATTTGCCACATGTACGTGTACTCGATTCATTTATATATTCAGGGGTGTGACGGGTCCATCCTGCTGGACG
ACACGCCCTCCTTCACCGGCGAGAAGAACGCCGCGCCTAACGCCAACTCCGTGCGCGGCTTCGACGTGATCGACCGCATCAAGGACGCCGTCGACGCCGCGTGCAGGGGAAACGTGGTGT
CCTGCGCCGACATCCTGGCCGCCGCAGCACGTGACTCCATC
GTCGCGGTTCGCCTCGCTCGAATAATACTCTTATATATTGTCACGTTTATACGTACATGCGCGTAACGAATATGATCGA
CCTGACAGTTGAAGTTGTTAATTGCAGCTGGGAGGGCCGTCATACGCGGTGCCGCTGGGCCGGAGGGACAGCCGGACGGCGAGCCAGGCAGCTGCGAACAACAGCATCCCGGCGCCGACC
TTGGACCTGGGAGGGCTCGTCTCAAACTTCGCCTCGCACGGGCTCTCCGTGCAGGACCTCGTGGTGCTCTCGGGGGGACACACGCTGGGCTTCTCCCGGTGCACAAACTTCCGGGACCGC
CTCTACAACGAGACGGCCACACTGGACGCCTCCCTGGCCGCGTCGCTCAGGGCGGTCTGCCCGCGGCCGGCCGGGGACGGAGACGACAACCTCGCGCCGCTCGACCCGACGCCCGCGCGG
TTCGACGGCGCGTACTACGGCTCGTTGCTGCGCAGCAAGGCACTGCTGCACTCGGACCAGCAGTTGTTAGCCGCCGGTGCCACGGAGGGGCTCGTGAGGTTCTACGGCGCTAACCCCGAG
GCGTTCAGGAGGGACTTCGCCGAGGCCATGGTCAGGATGAGCAGCCTCGCCCCGCTCACCGGGAGCAGCGGCGAGATCCGCGCCAACTGCAGGAAAGTGAACGGCTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCGCGGGTACTGCTTTGTGGCGTGCGTCGTGGCGCTGGCGCTGGCTTTGTTGGCCACGGCGAGCAATGGCCAGCCGCTGGACGCTTGTTTCTATGACAAGGTGTGCCCAGCG
GCGCTCCCGGCCATTAAGACGGTCGTGGAGCAGGCCGTCGCGGTGGAGCCGCGCATGGGCGCCTCGCTCCTGCGTCTGCACTTCCACGACTGCTTCGTCAAC
GGGTGTGACGGGTCCATC
CTGCTGGACGACACGCCCTCCTTCACCGGCGAGAAGAACGCCGCGCCTAACGCCAACTCCGTGCGCGGCTTCGACGTGATCGACCGCATCAAGGACGCCGTCGACGCCGCGTGCAGGGGA
AACGTGGTGTCCTGCGCCGACATCCTGGCCGCCGCAGCACGTGACTCCATC
CTGGGAGGGCCGTCATACGCGGTGCCGCTGGGCCGGAGGGACAGCCGGACGGCGAGCCAGGCAGCTGCG
AACAACAGCATCCCGGCGCCGACCTTGGACCTGGGAGGGCTCGTCTCAAACTTCGCCTCGCACGGGCTCTCCGTGCAGGACCTCGTGGTGCTCTCGGGGGGACACACGCTGGGCTTCTCC
CGGTGCACAAACTTCCGGGACCGCCTCTACAACGAGACGGCCACACTGGACGCCTCCCTGGCCGCGTCGCTCAGGGCGGTCTGCCCGCGGCCGGCCGGGGACGGAGACGACAACCTCGCG
CCGCTCGACCCGACGCCCGCGCGGTTCGACGGCGCGTACTACGGCTCGTTGCTGCGCAGCAAGGCACTGCTGCACTCGGACCAGCAGTTGTTAGCCGCCGGTGCCACGGAGGGGCTCGTG
AGGTTCTACGGCGCTAACCCCGAGGCGTTCAGGAGGGACTTCGCCGAGGCCATGGTCAGGATGAGCAGCCTCGCCCCGCTCACCGGGAGCAGCGGCGAGATCCGCGCCAACTGCAGGAAA
GTGAACGGCTACTAG

Retrieve as FASTA