Entry information : BdiPrx50 (Bradi2g04490)
Entry ID 7849
Creation 2011-01-13 (Toky Ramarohetra)
Last sequence changes 2011-01-13 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx50 (Bradi2g04490)
Name (synonym) BdiPrx50 (Bradi2g04490)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx50
start..stop
S start..stop
OsPrx01 580 0 1..326 1..326
SiPrx18 570 0 1..326 1..327
SbPrx51 550 0 1..326 1..331
CroPrx57 475 1e-170 22..326 24..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3154500..3154715 216 N° 2 3154879..3155058 180 N° 3 3155270..3155432 163 N° 4 3155545..3155966 422
join(3154500..3154715,3154879..3155058,3155270..3155432,3155545..3155966)


exon

Literature and cross-references BdiPrx50 (Bradi2g04490)
DNA ref. Phytozome 12:   Bd2 (3154500..3155966)
EST ref. GenBank:   DV489065.1 [Fragment]
Protein sequence: BdiPrx50 (Bradi2g04490)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (302)
PWM (Da):   %s   35019.63 (32451.2)  
PI (pH):   %s   7.31 (7.31) Peptide Signal:   %s   cut: 25 range:25-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTASEIAALFFLFSALLRSSLVLSQGLQRGFYDSNCPDAEDIVRSTVKKYYNNDATIAPGLLRLHFHDCFVQGCDASVLISGASSERTAPQNFGLRGFEVIDDAKSQLEATCPGVVSCADILALAARDSVDLTGGPSWSVPLGRRDGRISSAADAKALPSPADPVSVQRQKFADQGLSDHDLVTLVGAHTIGQTDCALFRYRLFNFTATGNADPTISPAFLPQLRALCPPNGDPSRRVALDKDSTGTFDASFFKNVRDGNAVLESDQRLWSDDATQGLVQKYAGNVRGLFGLRFAYDFPKAMVSMSSVAVKTGRQGEIRRKCSRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, introns 1, 2 and 3), 1 EST. Cultivar="Bd21".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAGCATCAGAAATAGCTGCTCTTTTCTTTCTATTCAGTGCTTTACTGAGAAGTTCTTTGGTCCTTAGCCAGGGACTGCAGAGAGGATTCTACGACTCCAACTGTCCTGATGCCGAG
GATATAGTGAGGTCTACTGTCAAAAAGTACTACAACAATGATGCCACCATTGCCCCAGGCTTGCTCAGGCTACACTTCCATGACTGTTTTGTCCAA
GTTAGTTCTATAATTCGATTCTCT
GTACTACTTTGTGGTTTGGTACTCCTGACTTTCCTCTCGATCCCATGTTCTGTTGTCCTCATTTTACAATTGATGGCGAAGGACCCTGTGCAGTTTTGCTTTCCTGTCTGACATTTGTTT
CTTCTGCCATGCACTGTAGGGATGTGATGCTTCTGTTTTGATTTCTGGAGCATCATCTGAAAGGACTGCCCCACAGAATTTTGGTCTCAGGGGATTTGAAGTGATAGACGATGCCAAGTC
CCAGTTGGAGGCCACCTGCCCTGGGGTGGTATCTTGTGCTGATATATTGGCCCTCGCCGCTCGTGATTCGGTTGATCTG
GTGAGTCACTCTGTAACTACGCAGGCCTTAATTATGTCTCT
CTAGCCATGTGCTGAATTCATGCTGATTAAGAACTGTTTACCTTTTGGTAGAGGGTCTGATGATTGAATTGCTGGCTTATGTAGTTATGTTATCGTTTACAGGGATAGCTTATGTTACTG
TTGAGAGAAAAATAAAGGACTGATTGACTCACTTTTTTGTACCATGTAAGACTGGTGGGCCAAGCTGGTCAGTACCTCTGGGACGAAGAGACGGAAGAATTTCATCAGCAGCGGATGCCA
AGGCCTTACCATCTCCCGCCGATCCTGTATCCGTTCAGCGGCAAAAGTTTGCCGATCAAGGCTTAAGTGACCACGATCTCGTAACGCTAGTCG
GTATGGTCTTGACATCGACTTGCATAA
TACATAGTCTTCAGTGAATTGTATCTCATTTTGCTGATAAATGCTGCAACAAGTTAACAAGTGACCTGGCAACACGGGCCTGTAGGTGCTCACACCATCGGGCAGACTGACTGTGCGCTC
TTCCGGTACCGCCTGTTCAACTTCACGGCGACGGGCAACGCGGACCCGACGATCAGCCCGGCGTTCCTGCCGCAGCTGCGGGCACTGTGCCCGCCCAACGGCGACCCCTCGCGGCGGGTG
GCGCTGGACAAGGACAGCACGGGCACGTTCGACGCGAGCTTCTTCAAGAACGTGAGGGACGGCAACGCCGTGCTGGAGTCGGACCAGAGGCTGTGGAGCGACGACGCCACGCAGGGCCTC
GTGCAGAAGTACGCCGGCAACGTCCGCGGCCTGTTCGGGCTCCGGTTCGCCTATGATTTCCCCAAGGCCATGGTGAGCATGAGCAGCGTCGCCGTGAAGACCGGCAGGCAGGGCGAGATA
AGGAGGAAGTGCTCCAGGGTTAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAGCATCAGAAATAGCTGCTCTTTTCTTTCTATTCAGTGCTTTACTGAGAAGTTCTTTGGTCCTTAGCCAGGGACTGCAGAGAGGATTCTACGACTCCAACTGTCCTGATGCCGAG
GATATAGTGAGGTCTACTGTCAAAAAGTACTACAACAATGATGCCACCATTGCCCCAGGCTTGCTCAGGCTACACTTCCATGACTGTTTTGTCCAA
GGATGTGATGCTTCTGTTTTGATT
TCTGGAGCATCATCTGAAAGGACTGCCCCACAGAATTTTGGTCTCAGGGGATTTGAAGTGATAGACGATGCCAAGTCCCAGTTGGAGGCCACCTGCCCTGGGGTGGTATCTTGTGCTGAT
ATATTGGCCCTCGCCGCTCGTGATTCGGTTGATCTG
ACTGGTGGGCCAAGCTGGTCAGTACCTCTGGGACGAAGAGACGGAAGAATTTCATCAGCAGCGGATGCCAAGGCCTTACCATCT
CCCGCCGATCCTGTATCCGTTCAGCGGCAAAAGTTTGCCGATCAAGGCTTAAGTGACCACGATCTCGTAACGCTAGTCG
GTGCTCACACCATCGGGCAGACTGACTGTGCGCTCTTCCGG
TACCGCCTGTTCAACTTCACGGCGACGGGCAACGCGGACCCGACGATCAGCCCGGCGTTCCTGCCGCAGCTGCGGGCACTGTGCCCGCCCAACGGCGACCCCTCGCGGCGGGTGGCGCTG
GACAAGGACAGCACGGGCACGTTCGACGCGAGCTTCTTCAAGAACGTGAGGGACGGCAACGCCGTGCTGGAGTCGGACCAGAGGCTGTGGAGCGACGACGCCACGCAGGGCCTCGTGCAG
AAGTACGCCGGCAACGTCCGCGGCCTGTTCGGGCTCCGGTTCGCCTATGATTTCCCCAAGGCCATGGTGAGCATGAGCAGCGTCGCCGTGAAGACCGGCAGGCAGGGCGAGATAAGGAGG
AAGTGCTCCAGGGTTAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAGCAT CAGAAATAGC TGCTCTTTTC TTTCTATTCA GTGCTTTACT GAGAAGTTCT TTGGTCCTTA GCCAGGGACT GCAGAGAGGA TTCTACGACT CCAACTGTCC TGATGCCGAG  GATATAGTGA GGTCTACTGT CAAAAAGTAC TACAACAATG ATGCCACCAT TGCCCCAGGC TTGCTCAGGC TACACTTCCA TGACTGTTTT GTCCAAGGAT GTGATGCTTC TGTTTTGATT  TCTGGAGCAT CATCTGAAAG GACTGCCCCA CAGAATTTTG GTCTCAGGGG ATTTGAAGTG ATAGACGATG CCAAGTCCCA GTTGGAGGCC ACCTGCCCTG GGGTGGTATC TTGTGCTGAT  ATATTGGCCC TCGCCGCTCG TGATTCGGTT GATCTGACTG GTGGGCCAAG CTGGTCAGTA CCTCTGGGAC GAAGAGACGG AAGAATTTCA TCAGCAGCGG ATGCCAAGGC CTTACCATCT  CCCGCCGATC CTGTATCCGT TCAGCGGCAA AAGTTTGCCG ATCAAGGCTT AAGTGACCAC GATCTCGTAA CGCTAGTCGG TGCTCACACC ATCGGGCAGA CTGACTGTGC GCTCTTCCGG  TACCGCCTGT TCAACTTCAC GGCGACGGGC AACGCGGACC CGACGATCAG CCCGGCGTTC CTGCCGCAGC TGCGGGCACT GTGCCCGCCC AACGGCGACC CCTCGCGGCG GGTGGCGCTG  GACAAGGACA GCACGGGCAC GTTCGACGCG AGCTTCTTCA AGAACGTGAG GGACGGCAAC GCCGTGCTGG AGTCGGACCA GAGGCTGTGG AGCGACGACG CCACGCAGGG CCTCGTGCAG  AAGTACGCCG GCAACGTCCG CGGCCTGTTC GGGCTCCGGT TCGCCTATGA TTTCCCCAAG GCCATGGTGA GCATGAGCAG CGTCGCCGTG AAGACCGGCA GGCAGGGCGA GATAAGGAGG  AAGTGCTCCA GGGTTAACTG ATGTCTGATG ATTAGGAGGG GGGAGGGGGT CGATACTTGT AGCCTGGCTT GGTAAAAAAA AAAAGCATCC CGTATCATAC AGTACCACTT CCTTATTTTC 
TTTGTGTCAA GGCTGTTATT CCAGAATCGA GTGCTTAAGA TG 

Retrieve as FASTA