Entry information : BdiPrx63 (Bradi2g12180)
Entry ID 7857
Creation 2011-01-13 (Toky Ramarohetra)
Last sequence changes 2011-01-13 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-29 (Qiang Li)
Peroxidase information: BdiPrx63 (Bradi2g12180)
Name (synonym) BdiPrx63 (Bradi2g12180)
Class Class III peroxidase    [Orthogroup: Prx099]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx63
start..stop
S start..stop
BdiPrx64 558 0 3..351 7..353
OsPrx14 547 0 16..351 16..356
ZmPrx101 541 0 16..350 26..367
SiPrx01 532 0 16..325 26..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10518804..10519022 219 N° 2 10520333..10520758 426 N° 3 10520850..10521260 411  
join(10518804..10519022,10520333..10520758,10520850..10521260)


exon

Literature and cross-references BdiPrx63 (Bradi2g12180)
Literature Vogel,J.P., Gu,Y.Q., Twigg,P., Lazo,G.R., Laudencia-Chingcuanco,D., Hayden,D.M., Donze,T.J., Vivian,L.A., Stamova,B. and Coleman-Derr,D. EST sequencing and phylogenetic analysis of the model grass Brachypodium distachyon. Theor Appl Genet 113 (2), 186-195 (2006).
DNA ref. Phytozome 12:   Bd2 (10518804..10521260)
EST ref. GenBank:   DV489189.1 [5' end]
Protein sequence: BdiPrx63 (Bradi2g12180)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351 (325)
PWM (Da):   %s   37249.73 (34557.2)  
PI (pH):   %s   6.5 (5.69) Peptide Signal:   %s   cut: 27 range:27-351
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDRVMVVVALMAVAAVCLRLPAVARGQLQVGFYNTSCPNAESLVRQAVANAFANDSGIAAGLIRLHFHDCFVKGCDASVLLVSANGTAERDAAPNKPSLRGFEVIDAAKAAVESSCARTVSCADIVAFAARDSINLTGQAAYQVPSGRRDGNISVDQDAINNLPPPTFTAQQLVDRFANKTLTAEEMVILSGAHSVGRSFCSSFLPRIWNNTTPIVDAGLSSGYATLLRSLCPSTPNNSTTTMIDPTTPAVLDNNYYKLLPLNLGLFFSDNQLRTNATLNTSVNSFAANETLWKEKFVAAMIKMGNIEVLTGTQGEIRLNCSIVNNRSSVGIEMAHYNPGSTAFINEVATN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, introns 1 and 3') and 1 EST. Containing IntR (3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCGCGTGATGGTGGTGGTGGCGCTGATGGCCGTGGCGGCGGTGTGCCTCCGGCTGCCGGCGGTGGCCCGCGGGCAGCTGCAGGTGGGGTTCTACAACACGAGCTGTCCCAACGCG
GAGTCTCTGGTCCGGCAGGCCGTGGCCAACGCCTTCGCCAATGACTCCGGCATCGCCGCCGGCCTCATTCGCCTCCATTTCCATGACTGCTTTGTCAAG
GTACCGAACCCATCGTTATTC
CTTTACATCTCCATCCTAACAGGTTTTTTCTGCTAGCAACTTAATTCGCTGGAAAATAACTAATTTGTTTTGAAATTAGTAAGTTTACTAGTATAGTTTTTTTTACTGCAGCAGCAGCTG
TGTGTCAAGGAAGGTCCTAAAAGTAATCTCTGATCAATAATGCACTGGAGTAACAGATTGTTTGTAGGTTCGAATATATCGATCTACATCTAGCTTGCCCATGCACGGAAGAAACGTATA
TACTTCTTCCGTCCAAAAAAGATGTTTTAAGTTTGTCAAAATTTGAATGTATTTAGACATAACTTAATATATAGATGCATTCAAATTTAGTCAAAGTTGAGACATCTTTTACGAAAAAAG
TATATGAAGTCGATCCTATCCCTCTCTCGTCAAAATAAAAGTGAAAGCAGGGTCTCACTTTGCTCCTTTCTCCCGAAAGAAGAGTCAAACAAAGCAACAACTATCTAAAAGAAAAACAAG
GCTGTTATTCTTTTACTCGCTCCGTTCCATATTAAGTGCTGAAATATTACATGTATCAGACGTATTTTAGTACTCCCTCCGTACAACAAAAGATGTCTCAAATTTGTCAAAATTTGAATG
TATCTAGACATGATTTAGTGTATAGATGCATTCAAATTTGGTCAAAGTTGAAACATCCTTTGTTAAACGGAGTGAGTATATAGATACGTCCATTTCTAGACAAATCGGAGGGTGTACATG
CTTCTGATATCCAGACACAGCTAGTCATAGCTGTTTTTCTTTCAAAATATTAGATTAGGGAGAATGGGAGATCACACGCATCACGTATGTTCGTACCGTGCCTCTGTCTTGTCCAGATAA
CAATATCACGATGCGGTTTACATAAAAAAAACATGATTCATTGTGCCTCTGTTCGTCGTTATTACACAGTGGGTGCGGAGCAGCCTTAACGATATGCACATGCCTCACACTGACCTTTAG
ATAGATGCTAGTTCAAAATATCACTCGTATGTCAGCAAAGATATTGCATTTTGTAAGTCAGATCGCAATGCACGTTCACATATGTTTAGCAGAGGTGAGAAATAGTAATTGTTAACGGTT
TGGTATTTTTTAAACGATTGAGAAATAATTATTTCTTAGTCGATGATAACAAGCTTTTGATTCAATCAAAAGCGATTCGTGTAGAATTAATGCAGATCTTGATTGGATGCCTAGAATTAT
TGACTGAAAAATACTATATTTCAGGTGACCGAGAAATAAACACTCCCAATTGTTAATTACTTACATGACTTGTCTCCTCCATCGTTCAGGGTTGTGACGCTTCGGTGTTGCTGGTGTCCG
CGAACGGCACGGCCGAGCGTGACGCGGCGCCAAACAAGCCAAGCCTTCGTGGTTTCGAGGTGATCGATGCCGCCAAGGCCGCTGTGGAGAGCAGCTGTGCACGCACGGTCTCCTGCGCTG
ACATCGTAGCCTTCGCGGCCCGCGACAGCATCAACCTCACGGGCCAGGCCGCGTACCAGGTCCCCTCTGGTCGCCGGGACGGCAACATCTCCGTCGATCAGGATGCCATCAACAACCTCC
CCCCGCCCACCTTCACCGCGCAGCAGCTCGTTGACCGCTTCGCCAACAAGACCCTCACCGCCGAGGAGATGGTCATCCTCTCCGGCGCCCACTCCGTCGGCCGTTCCTTCTGCTCCTCCT
TCCTCCCCCGCATCTGGAACAACACAACCCCAATC
GTAAGATCTGACCGTTCGTACCACACATGGGTGTCTATCCATGAATTGATCCATGACCATGACACTCCATTTTGGGCGAATTAAC
ATGCAGGTGGACGCCGGGCTGAGCTCGGGGTATGCAACGCTGCTGCGGTCGCTGTGCCCTTCGACCCCGAACAACTCGACCACGACGATGATTGACCCGACCACGCCGGCGGTGCTGGAC
AACAACTACTACAAGCTGCTGCCGCTCAACCTAGGCTTGTTCTTCTCCGATAACCAGCTGCGGACCAATGCCACGCTCAATACCTCCGTAAACAGCTTCGCAGCCAACGAGACGCTCTGG
AAGGAGAAGTTCGTGGCGGCCATGATCAAGATGGGGAACATCGAGGTGCTCACGGGGACTCAGGGGGAGATCCGCCTCAACTGCAGTATTGTCAATAACCGCTCGTCTGTTGGGATAGAG
ATGGCGCACTACAACCCCGGATCCACCGCCTTCATTAACGAGGTCGCGACGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCGCGTGATGGTGGTGGTGGCGCTGATGGCCGTGGCGGCGGTGTGCCTCCGGCTGCCGGCGGTGGCCCGCGGGCAGCTGCAGGTGGGGTTCTACAACACGAGCTGTCCCAACGCG
GAGTCTCTGGTCCGGCAGGCCGTGGCCAACGCCTTCGCCAATGACTCCGGCATCGCCGCCGGCCTCATTCGCCTCCATTTCCATGACTGCTTTGTCAAG
GGTTGTGACGCTTCGGTGTTG
CTGGTGTCCGCGAACGGCACGGCCGAGCGTGACGCGGCGCCAAACAAGCCAAGCCTTCGTGGTTTCGAGGTGATCGATGCCGCCAAGGCCGCTGTGGAGAGCAGCTGTGCACGCACGGTC
TCCTGCGCTGACATCGTAGCCTTCGCGGCCCGCGACAGCATCAACCTCACGGGCCAGGCCGCGTACCAGGTCCCCTCTGGTCGCCGGGACGGCAACATCTCCGTCGATCAGGATGCCATC
AACAACCTCCCCCCGCCCACCTTCACCGCGCAGCAGCTCGTTGACCGCTTCGCCAACAAGACCCTCACCGCCGAGGAGATGGTCATCCTCTCCGGCGCCCACTCCGTCGGCCGTTCCTTC
TGCTCCTCCTTCCTCCCCCGCATCTGGAACAACACAACCCCAATC
GTGGACGCCGGGCTGAGCTCGGGGTATGCAACGCTGCTGCGGTCGCTGTGCCCTTCGACCCCGAACAACTCGACC
ACGACGATGATTGACCCGACCACGCCGGCGGTGCTGGACAACAACTACTACAAGCTGCTGCCGCTCAACCTAGGCTTGTTCTTCTCCGATAACCAGCTGCGGACCAATGCCACGCTCAAT
ACCTCCGTAAACAGCTTCGCAGCCAACGAGACGCTCTGGAAGGAGAAGTTCGTGGCGGCCATGATCAAGATGGGGAACATCGAGGTGCTCACGGGGACTCAGGGGGAGATCCGCCTCAAC
TGCAGTATTGTCAATAACCGCTCGTCTGTTGGGATAGAGATGGCGCACTACAACCCCGGATCCACCGCCTTCATTAACGAGGTCGCGACGAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCTTAGGCA TCTAAATTAC ACTAGCTTAG CTCCAACCAG AGAAAGACAT CATCTTCGTG CACCCGATTC GAACAAACTA AAGCAGAGTC GACGATGGAT CGCGTGATGG TGGTGGTGGC  GCTGATGGCC GTGGCGGCGG TGTGCCTCCG GCTGCCGGCG GTGGCCCGCG GGCAGCTGCA GGTGGGGTTC TACAACACGA GCTGTCCCAA CGCGGAGTCT CTGGTCCGGC AGGCCGTGGC  CAACGCCTTC GCCAATGACT CCGGCATCGC CGCCGGCCTC ATTCGCCTCC ATTTCCATGA CTGCTTTGTC AAGGGTTGTG ACGCTTCGGT GTTGCTGGTG TCCGCGAACG GCACGGCCGA  GCGTGACGCG GCGCCAAACA AGCCAAGCCT TCGTGGTTTC GAGGTGATCG ATGCCGCCAA GGCCGCTGTG GAGAGCAGCT GTGCACGCAC GGTCTCCTGC GCTGACATCG TAGCCTTCGC  GGCCCGCGAC AGCATCAACC TCACGGGCCA GGCCGCGTAC CAGGTCCCCT CTGGTCGCCG GGACGGCAAC ATCTCCGTCG ATCAGGATGC CATCAACAAC CTCCCCCCGC CCACCTTCAC  CGCGCAGCAG CTCGTTGACC GCTTCGCCAA CAAGACCCTC ACCGCCGAGG AGATGGTCAT CCTCTCCGGC GCCCACTCCG TCGGCCGTTC CTTCTGCTCC TCCTTCCTCC CCCGCATCTG  GAACAACACA ACCCCAATCG TGGACGCCGG GCTGAGCTCG GGGTATGCAA CGCTGCTGCG GTCGCTGTGC CCTTCGACCC CGAACAACTC GACCACGACG ATGATTGACC CGACCACGCC  GGCGGTGCTG GACAACAACT ACTACAAGCT GCTGCCGCTC AACCTAGGCT TGTTCTTCTC CGATAACCAG CTGCGGACCA ATGCCACGCT CAATACCTCC GTAAACAGCT TCGCAGCCAA  CGAGACGCTC TGGAAGGAGA AGTTCGTGGC GGCCATGATC AAGATGGGGA ACATCGAGGT GCTCACGGGG ACTCAGGGGG AGATCCGCCT CAACTGCAGT ATTGTCAATA ACCGCTCGTC  TGTTGGGATA GAGATGGCGC ACTACAACCC CGGATCCACC GCCTTCATTA ACGAGGTCGC GACGAACTAA TGAAATATAT GTGTATTATG TAGGTTAAGA TCAGTGTTTT TGTGTGCGTG  TTTTTTAGTA TTTCCCATGC CGTGCGTGCA GGACTGTACT ATTGTGTTTG AATTTTGATG GTCACTGTGT GCCTCTGTGG TTCCTTCACG TGAATAAATT AAGGTTGTTT GTTGATGGCT  TGTGATATTT TTTTTCCGGG CTTGCTATTT TTTGGACCAC TGAGGAACAA CAACTACTAG TTAAGTGTCC GTGCGTTGCA ACGGAAAGAT AAACATTCTG TACCTTAACA AGAATAATGG 
CAAATACCGT TCATTTACCA GGTTC 

Retrieve as FASTA