Entry information : BdiPrx69 (Bradi2g17120)
Entry ID 7859
Creation 2011-01-13 (Toky Ramarohetra)
Last sequence changes 2011-01-13 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx69 (Bradi2g17120)
Name (synonym) BdiPrx69 (Bradi2g17120)
Class Class III peroxidase    [Orthogroup: Prx159]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx69
start..stop
S start..stop
BdiPrx136 360 2e-124 10..337 6..332
BdiPrx138 356 5e-123 1..347 1..332
BdiPrx137 329 1e-112 12..335 2..319
OsPrx59 304 2e-102 13..347 6..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15279517..15279783 267 N° 2 15278609..15279385 777  
complement(join(15278609..15279385,15279517..15279783))


exon

Literature and cross-references BdiPrx69 (Bradi2g17120)
DNA ref. Phytozome 12:   Bd2 (15279783..15278609)
Protein sequence: BdiPrx69 (Bradi2g17120)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347 (319)
PWM (Da):   %s   37805.99 (34833.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.12 (6.62) Peptide Signal:   %s   cut: 29 range:29-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAWSCRAVLAKPMGLILTALLFFPAALSAPTPPLISLPTEDDGLSYGFHDHKCPALLNNVSTAVRNARRSDPGITAGLLRLTFNDCFPQGCDASILLTGPNSEQDILPQNAGLQQGALDLIESIRAKVHRACGPTVSCADITNLATREAVLQSGLPRYEVPLGRRDSIAPARRQDVEALPRPDFDVHQLVQSFRSRGLDETDLVALSGAHTIGEAGCGSFENRFSSEEINTNGFVKRLLDNCTVNADRRQDLDVTTPMKFDNKYFTNLYRGIGVLSSDMALLLDVNTRSKVKDFAGDQEWFFRQFSNSMSKLAHRQGAKGNNAEIRNHCFERNNGGPFVGMGFKASA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 1 intron). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTGGAGCTGCAGGGCAGTGTTGGCCAAGCCCATGGGCCTGATCCTTACAGCGTTGCTCTTCTTCCCGGCAGCTCTATCCGCGCCTACGCCACCGCTAATCTCCTTGCCCACCGAG
GACGACGGCCTCTCCTATGGCTTCCACGACCACAAATGCCCGGCCCTGCTCAACAACGTGAGCACCGCCGTGCGGAACGCGCGTCGCAGCGACCCCGGCATCACCGCCGGCCTCCTCCGC
CTCACCTTCAACGACTGCTTCCCTCAG
GTACATCCCCAAATTCCCCCCAGCAAATTCTTTTCGAATTCGGGTTTGTTCCGCTATCTCCTGTGAAACATGGTTATTTTGGTGCAATGGAAA
AATAAATTATTTGATCGAGTAGTACAACATGGTTGTAGGGCTGCGACGCGTCGATCCTGCTGACGGGGCCCAACAGCGAGCAGGACATACTTCCCCAGAACGCCGGGCTGCAGCAGGGCG
CGCTTGACCTCATCGAGAGCATCCGCGCCAAGGTGCACCGCGCGTGCGGGCCCACCGTCTCCTGCGCCGACATCACCAACCTCGCCACCCGGGAGGCCGTCCTGCAGTCGGGCCTCCCGC
GGTACGAGGTGCCTCTGGGCCGGCGCGACAGCATCGCGCCGGCCCGGAGGCAGGACGTCGAGGCCCTGCCGCGGCCCGACTTCGACGTGCACCAGCTCGTCCAGTCCTTCCGGAGCCGGG
GGCTCGACGAGACCGACCTCGTCGCGCTCTCCGGCGCGCATACCATCGGCGAGGCCGGCTGCGGAAGCTTCGAGAACCGCTTCTCCTCCGAGGAGATCAACACCAATGGCTTCGTCAAGA
GGCTCCTGGACAACTGCACCGTGAACGCCGACAGGCGGCAGGACCTGGACGTGACAACGCCGATGAAGTTCGACAACAAGTATTTTACCAACCTTTATCGGGGCATCGGGGTGTTGAGCT
CCGACATGGCGCTCCTCCTGGACGTGAACACCAGGAGCAAGGTGAAAGACTTTGCGGGTGACCAGGAGTGGTTCTTTAGGCAGTTCAGTAATTCTATGAGCAAGCTGGCGCATCGGCAGG
GCGCCAAGGGGAACAACGCCGAGATCCGCAACCACTGCTTCGAACGGAACAACGGAGGGCCGTTCGTTGGCATGGGGTTCAAGGCCTCTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTGGAGCTGCAGGGCAGTGTTGGCCAAGCCCATGGGCCTGATCCTTACAGCGTTGCTCTTCTTCCCGGCAGCTCTATCCGCGCCTACGCCACCGCTAATCTCCTTGCCCACCGAG
GACGACGGCCTCTCCTATGGCTTCCACGACCACAAATGCCCGGCCCTGCTCAACAACGTGAGCACCGCCGTGCGGAACGCGCGTCGCAGCGACCCCGGCATCACCGCCGGCCTCCTCCGC
CTCACCTTCAACGACTGCTTCCCTCAG
GGCTGCGACGCGTCGATCCTGCTGACGGGGCCCAACAGCGAGCAGGACATACTTCCCCAGAACGCCGGGCTGCAGCAGGGCGCGCTTGACCTC
ATCGAGAGCATCCGCGCCAAGGTGCACCGCGCGTGCGGGCCCACCGTCTCCTGCGCCGACATCACCAACCTCGCCACCCGGGAGGCCGTCCTGCAGTCGGGCCTCCCGCGGTACGAGGTG
CCTCTGGGCCGGCGCGACAGCATCGCGCCGGCCCGGAGGCAGGACGTCGAGGCCCTGCCGCGGCCCGACTTCGACGTGCACCAGCTCGTCCAGTCCTTCCGGAGCCGGGGGCTCGACGAG
ACCGACCTCGTCGCGCTCTCCGGCGCGCATACCATCGGCGAGGCCGGCTGCGGAAGCTTCGAGAACCGCTTCTCCTCCGAGGAGATCAACACCAATGGCTTCGTCAAGAGGCTCCTGGAC
AACTGCACCGTGAACGCCGACAGGCGGCAGGACCTGGACGTGACAACGCCGATGAAGTTCGACAACAAGTATTTTACCAACCTTTATCGGGGCATCGGGGTGTTGAGCTCCGACATGGCG
CTCCTCCTGGACGTGAACACCAGGAGCAAGGTGAAAGACTTTGCGGGTGACCAGGAGTGGTTCTTTAGGCAGTTCAGTAATTCTATGAGCAAGCTGGCGCATCGGCAGGGCGCCAAGGGG
AACAACGCCGAGATCCGCAACCACTGCTTCGAACGGAACAACGGAGGGCCGTTCGTTGGCATGGGGTTCAAGGCCTCTGCTTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CACAGCACAG CTAGCTGTAG GATCGACCGA TGGCGTGGAG CTGCAGGGCA GTGTTGGCCA AGCCCATGGG CCTGATCCTT ACAGCGTTGC TCTTCTTCCC GGCAGCTCTA TCCGCGCCTA  CGCCACCGCT AATCTCCTTG CCCACCGAGG ACGACGGCCT CTCCTATGGC TTCCACGACC ACAAATGCCC GGCCCTGCTC AACAACGTGA GCACCGCCGT GCGGAACGCG CGTCGCAGCG  ACCCCGGCAT CACCGCCGGC CTCCTCCGCC TCACCTTCAA CGACTGCTTC CCTCAGGGCT GCGACGCGTC GATCCTGCTG ACGGGGCCCA ACAGCGAGCA GGACATACTT CCCCAGAACG  CCGGGCTGCA GCAGGGCGCG CTTGACCTCA TCGAGAGCAT CCGCGCCAAG GTGCACCGCG CGTGCGGGCC CACCGTCTCC TGCGCCGACA TCACCAACCT CGCCACCCGG GAGGCCGTCC  TGCAGTCGGG CCTCCCGCGG TACGAGGTGC CTCTGGGCCG GCGCGACAGC ATCGCGCCGG CCCGGAGGCA GGACGTCGAG GCCCTGCCGC GGCCCGACTT CGACGTGCAC CAGCTCGTCC  AGTCCTTCCG GAGCCGGGGG CTCGACGAGA CCGACCTCGT CGCGCTCTCC GGCGCGCATA CCATCGGCGA GGCCGGCTGC GGAAGCTTCG AGAACCGCTT CTCCTCCGAG GAGATCAACA  CCAATGGCTT CGTCAAGAGG CTCCTGGACA ACTGCACCGT GAACGCCGAC AGGCGGCAGG ACCTGGACGT GACAACGCCG ATGAAGTTCG ACAACAAGTA TTTTACCAAC CTTTATCGGG  GCATCGGGGT GTTGAGCTCC GACATGGCGC TCCTCCTGGA CGTGAACACC AGGAGCAAGG TGAAAGACTT TGCGGGTGAC CAGGAGTGGT TCTTTAGGCA GTTCAGTAAT TCTATGAGCA  AGCTGGCGCA TCGGCAGGGC GCCAAGGGGA ACAACGCCGA GATCCGCAAC CACTGCTTCG AACGGAACAA CGGAGGGCCG TTCGTTGGCA TGGGGTTCAA GGCCTCTGCT TGATTAGTCG  AGATTGATCT CTCGGATGTA TGTTGTACTC CTTCCCTTTC ACAAAAGTTG GCGTCGTTAA GACAAGCCTT TAACTAAAAA TTACTCTATC AATATGTACG TTATAAGATA TGAAATCATG 
ATCATTAGCA AGAACTTTTA AAGACGAATC CATTGCTATA AATTTCATGT ATGAAAAAAC ACATATCAAT AGAGTTTTCA TCGGT 

Retrieve as FASTA