Entry information : BdiPrx70 (Bradi2g20820)
Entry ID 7860
Creation 2011-01-13 (Toky Ramarohetra)
Last sequence changes 2011-01-13 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx70 (Bradi2g20820)
Name (synonym) BdiPrx70 (Bradi2g20820)
Class Class III peroxidase    [Orthogroup: Prx150]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx70
start..stop
S start..stop
SbPrx127 491 3e-176 5..341 10..347
OsPrx75 483 5e-173 36..341 37..349
SiPrx90 480 5e-172 34..341 33..336
ZmPrx102 476 2e-170 17..341 21..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18269013..18269255 243 N° 2 18268726..18268911 186 N° 3 18268469..18268634 166 N° 4 18267922..18268352 431
complement(join(18267922..18268352,18268469..18268634,18268726..18268911,1826901 3..18269255))


exon

Literature and cross-references BdiPrx70 (Bradi2g20820)
DNA ref. Phytozome 12:   Bd2 (18269255..18267922)
Protein sequence: BdiPrx70 (Bradi2g20820)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (314)
PWM (Da):   %s   36710.27 (33882.6)  
PI (pH):   %s   6.77 (5.83) Peptide Signal:   %s   cut: 28 range:28-341
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSRKPRLLLVACLVLLIGAALPKGSRAEEPGGAAGLRFGFYNATCPAAEDVVFAEMHAILREDPTLAPSLLRMHYHDCFVQGCDGSIMLRSRSGTAERDATPNRSMRGYGAIERIKARLESVCPLTVSCADIIAMAARDAVYLSKGPWYAVETGRRDGNETLAEYAETDLAPPDSNIVDVKTFFSVKSLNSKDIAVLFGCHSIGTSHCEAFEKRLYNFSADTEQDPSLDAVYAAKLKKLCPRGALHAHGGWATKVPMDPGSGFTFGLSYYRHVVAGRGLFQSDGGLLHDPATKVYVDRMAAASSPDEYFEDFAAAMVKMGRTDVLLGCLGEVRATCGIFVD

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAGGAAGCCGCGGCTTCTCCTGGTGGCCTGCCTGGTGCTGCTGATCGGTGCGGCCCTGCCGAAGGGTTCGCGTGCGGAGGAGCCAGGCGGCGCCGCCGGGCTGCGGTTCGGGTTC
TACAATGCGACGTGCCCGGCCGCGGAGGACGTCGTGTTCGCGGAGATGCACGCCATCCTCCGCGAGGACCCCACGCTCGCGCCCTCCCTGCTCCGGATGCACTACCACGACTGCTTCGTC
CAG
GTTTAACCCAGATCGAGATCGAATGCCTTATTTCAGCGTGTTTGGTTTGGGCGGCCAAGCCTTAATTAGATCGTGCGTGGTGGGGTGTTAATTGAGATCAGGGATGCGACGGATCGA
TCATGCTGAGGTCGAGGAGCGGGACGGCGGAGAGGGACGCGACGCCGAACCGGAGCATGCGCGGGTACGGCGCGATCGAGAGGATCAAGGCGAGGCTGGAGTCGGTCTGCCCGCTCACCG
TCTCCTGTGCCGACATCATAGCCATGGCCGCCAGAGACGCCGTCTACCTG
GTAAAAAGGAAAATTCACAATCGAGACCATCCCTCTCAAGCTGCTAGCTAAATTTGCTGACTGATTCGGC
CGGCTGCTTTTCTGTTTGCAGAGCAAAGGGCCGTGGTACGCCGTGGAGACCGGGAGGCGGGACGGCAACGAGACCCTGGCCGAGTACGCCGAGACCGACCTGGCGCCGCCGGACTCCAAC
ATCGTCGACGTCAAGACCTTCTTCAGCGTCAAGTCCCTCAACTCCAAGGACATCGCCGTCCTCTTCG
GTATAACTCTACCTACCTTACCTTCGCGCCCACTCCCCACACCTTAATTTCCT
TTTGCTTCGATCTCCGCGTGAACGAACGACAACAACAGCTTAACAGCCTTGGTTTCTCGTCAGGGTGCCACAGCATCGGGACATCGCACTGCGAGGCGTTCGAGAAGCGGCTGTACAACT
TCAGCGCCGACACGGAGCAGGACCCGTCGCTGGACGCCGTCTACGCGGCCAAGCTCAAGAAGCTCTGCCCGCGCGGCGCTCTGCACGCCCACGGCGGCTGGGCGACCAAGGTGCCCATGG
ACCCCGGCAGCGGCTTCACCTTCGGCCTGAGCTACTACCGCCACGTGGTCGCCGGGAGGGGCCTCTTCCAGTCCGACGGCGGCCTCCTCCACGACCCCGCCACCAAAGTCTACGTCGACA
GGATGGCCGCCGCGTCATCGCCCGACGAGTATTTCGAGGACTTCGCGGCGGCCATGGTCAAGATGGGACGCACCGACGTGCTCCTCGGCTGTCTCGGCGAGGTTAGGGCCACCTGTGGCA
TTTTTGTGGACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAGGAAGCCGCGGCTTCTCCTGGTGGCCTGCCTGGTGCTGCTGATCGGTGCGGCCCTGCCGAAGGGTTCGCGTGCGGAGGAGCCAGGCGGCGCCGCCGGGCTGCGGTTCGGGTTC
TACAATGCGACGTGCCCGGCCGCGGAGGACGTCGTGTTCGCGGAGATGCACGCCATCCTCCGCGAGGACCCCACGCTCGCGCCCTCCCTGCTCCGGATGCACTACCACGACTGCTTCGTC
CAG
GGATGCGACGGATCGATCATGCTGAGGTCGAGGAGCGGGACGGCGGAGAGGGACGCGACGCCGAACCGGAGCATGCGCGGGTACGGCGCGATCGAGAGGATCAAGGCGAGGCTGGAG
TCGGTCTGCCCGCTCACCGTCTCCTGTGCCGACATCATAGCCATGGCCGCCAGAGACGCCGTCTACCTG
AGCAAAGGGCCGTGGTACGCCGTGGAGACCGGGAGGCGGGACGGCAACGAG
ACCCTGGCCGAGTACGCCGAGACCGACCTGGCGCCGCCGGACTCCAACATCGTCGACGTCAAGACCTTCTTCAGCGTCAAGTCCCTCAACTCCAAGGACATCGCCGTCCTCTTCG
GGTGC
CACAGCATCGGGACATCGCACTGCGAGGCGTTCGAGAAGCGGCTGTACAACTTCAGCGCCGACACGGAGCAGGACCCGTCGCTGGACGCCGTCTACGCGGCCAAGCTCAAGAAGCTCTGC
CCGCGCGGCGCTCTGCACGCCCACGGCGGCTGGGCGACCAAGGTGCCCATGGACCCCGGCAGCGGCTTCACCTTCGGCCTGAGCTACTACCGCCACGTGGTCGCCGGGAGGGGCCTCTTC
CAGTCCGACGGCGGCCTCCTCCACGACCCCGCCACCAAAGTCTACGTCGACAGGATGGCCGCCGCGTCATCGCCCGACGAGTATTTCGAGGACTTCGCGGCGGCCATGGTCAAGATGGGA
CGCACCGACGTGCTCCTCGGCTGTCTCGGCGAGGTTAGGGCCACCTGTGGCATTTTTGTGGACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAGGA AGCCGCGGCT TCTCCTGGTG GCCTGCCTGG TGCTGCTGAT CGGTGCGGCC CTGCCGAAGG GTTCGCGTGC GGAGGAGCCA GGCGGCGCCG CCGGGCTGCG GTTCGGGTTC  TACAATGCGA CGTGCCCGGC CGCGGAGGAC GTCGTGTTCG CGGAGATGCA CGCCATCCTC CGCGAGGACC CCACGCTCGC GCCCTCCCTG CTCCGGATGC ACTACCACGA CTGCTTCGTC  CAGGGATGCG ACGGATCGAT CATGCTGAGG TCGAGGAGCG GGACGGCGGA GAGGGACGCG ACGCCGAACC GGAGCATGCG CGGGTACGGC GCGATCGAGA GGATCAAGGC GAGGCTGGAG  TCGGTCTGCC CGCTCACCGT CTCCTGTGCC GACATCATAG CCATGGCCGC CAGAGACGCC GTCTACCTGA GCAAAGGGCC GTGGTACGCC GTGGAGACCG GGAGGCGGGA CGGCAACGAG  ACCCTGGCCG AGTACGCCGA GACCGACCTG GCGCCGCCGG ACTCCAACAT CGTCGACGTC AAGACCTTCT TCAGCGTCAA GTCCCTCAAC TCCAAGGACA TCGCCGTCCT CTTCGGGTGC  CACAGCATCG GGACATCGCA CTGCGAGGCG TTCGAGAAGC GGCTGTACAA CTTCAGCGCC GACACGGAGC AGGACCCGTC GCTGGACGCC GTCTACGCGG CCAAGCTCAA GAAGCTCTGC  CCGCGCGGCG CTCTGCACGC CCACGGCGGC TGGGCGACCA AGGTGCCCAT GGACCCCGGC AGCGGCTTCA CCTTCGGCCT GAGCTACTAC CGCCACGTGG TCGCCGGGAG GGGCCTCTTC  CAGTCCGACG GCGGCCTCCT CCACGACCCC GCCACCAAAG TCTACGTCGA CAGGATGGCC GCCGCGTCAT CGCCCGACGA GTATTTCGAG GACTTCGCGG CGGCCATGGT CAAGATGGGA  CGCACCGACG TGCTCCTCGG CTGTCTCGGC GAGGTTAGGG CCACCTGTGG CATTTTTGTG GACTAACTAG CTAGAGGTCC AGGGTTGTAC ATATACACAT ACATGCACTG GTTGATCTGT  ATGGATCGGT GTTTATACGT GTCCTGGTAT TTTTGGTTCA GAACTTCAGA TTGAGCAAAA ATGCAAAACA GACTGGAAGT AACTTGTGCA CCTTTGCTGA GGAGATCATC AGTTTCACTT 
GAAAAACAAG TGGTGTCCTT GCTACGCATG ACCATCGTTG ACCACGAATC ATGCATGCAT GGGTTATTTC TTTGGTAGTT TAACCAACCA T 

Retrieve as FASTA