Entry information : BdiPrx73 (Bradi2g20850)
Entry ID 7862
Creation 2011-01-13 (Toky Ramarohetra)
Last sequence changes 2011-01-13 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx73 (Bradi2g20850)
Name (synonym) BdiPrx73 (Bradi2g20850)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx73
start..stop
S start..stop
BdiPrx72 594 0 17..326 18..327
BdiPrx71 591 0 1..326 1..323
TaPrx100 581 0 1..326 1..326
AvePrx109-1A 577 0 1..326 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18279463..18279669 207 N° 2 18279189..18279374 186 N° 3 18278504..18279091 588  
complement(join(18278504..18279091,18279189..18279374,18279463..18279669))


exon

Literature and cross-references BdiPrx73 (Bradi2g20850)
DNA ref. Phytozome 12:   Bd2 (18279669..18278504)
Protein sequence: BdiPrx73 (Bradi2g20850)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (304)
PWM (Da):   %s   35356.78 (33185.6)  
PI (pH):   %s   7.05 (6.51) Peptide Signal:   %s   cut: 23 range:23-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRALMMALLLAAVAVGCARAQLQEKFYSETCPSVEEVVRKEMVRALSVAPSLAGPLLRMHFHDCFVRGCDGSVLLDSANKTAEKDALPNQTLRGFGFVERVKAAVEKACPDTVSCADVLALMARDAVWLSKGPFWEVPLGRRDGSVSISNETDQLPPPTANFTVLTQLFAAKNLDIKDLVVLSAGHTIGTSHCFSFSDRLFNFTGRVNPQDVDPTLDSEYMAKLKGKCASLNDNTTLVEMDPGSFKTFDLDYFTIVAKRRGLFHSDGALLTNAFTRAYVQRHAGGAFKEEFFADFAASMIKMGNADVLTGSQGEIRKKCSVPNQ*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 2 introns). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCGAGGGCTCTGATGATGGCGCTGCTGCTCGCGGCGGTGGCCGTGGGGTGCGCCCGGGCGCAGCTGCAGGAGAAGTTCTACAGCGAGACTTGCCCCAGCGTGGAGGAAGTCGTC
AGGAAGGAGATGGTGAGGGCTCTCTCCGTGGCGCCCAGCCTCGCCGGGCCTTTGCTCAGGATGCATTTCCATGACTGCTTCGTCAGG
GTAAGCAACGTGCATTCGCCATCGAATGTTCAG
TGGCCGGCCGTGTATGTTCAGTGGCCTGAGAATTGTGAATGAGTGATGAATGCAGGGTTGCGACGGGTCGGTTCTGCTGGACTCGGCGAACAAGACGGCGGAGAAGGACGCGTTGCCCAA
CCAGACGCTGCGCGGGTTCGGCTTCGTCGAGCGGGTGAAGGCCGCCGTGGAGAAGGCCTGCCCCGACACCGTCTCCTGCGCCGACGTGCTCGCCCTCATGGCCAGGGACGCGGTCTGGCT
G
GTCAGTAGCACAACCCACATTGCTTTGATGACATCCAACATTCCAAACTGTGCAACAAAAATTCTCAATGCTGCTCGATTCTGTTCTTTTTTTCCAGAGCAAGGGGCCATTCTGGGAAG
TTCCTCTGGGCCGGAGAGACGGCAGCGTGTCCATCTCCAACGAGACCGACCAGCTGCCACCCCCGACCGCCAACTTCACCGTGCTGACCCAGCTCTTCGCCGCCAAGAACCTCGACATCA
AGGACCTCGTGGTCCTCTCCGCCGGGCACACCATCGGGACATCCCATTGCTTCTCCTTCTCCGACCGCCTCTTCAACTTCACCGGCAGGGTCAACCCGCAAGACGTCGACCCGACGCTGG
ACTCGGAGTACATGGCCAAGCTCAAGGGCAAGTGCGCCAGCCTCAACGACAACACGACGCTGGTGGAGATGGACCCCGGGAGCTTCAAGACCTTCGACCTGGACTACTTCACCATCGTGG
CCAAGCGGAGGGGGCTCTTCCACTCCGACGGCGCCCTGCTCACCAACGCCTTCACCCGCGCCTACGTGCAGCGCCATGCTGGCGGCGCCTTCAAGGAGGAGTTCTTCGCCGACTTCGCCG
CCTCCATGATCAAGATGGGCAACGCCGACGTGCTCACCGGCAGCCAGGGCGAGATCAGGAAGAAGTGCTCCGTGCCTAATCAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCGAGGGCTCTGATGATGGCGCTGCTGCTCGCGGCGGTGGCCGTGGGGTGCGCCCGGGCGCAGCTGCAGGAGAAGTTCTACAGCGAGACTTGCCCCAGCGTGGAGGAAGTCGTC
AGGAAGGAGATGGTGAGGGCTCTCTCCGTGGCGCCCAGCCTCGCCGGGCCTTTGCTCAGGATGCATTTCCATGACTGCTTCGTCAGG
GGTTGCGACGGGTCGGTTCTGCTGGACTCGGCG
AACAAGACGGCGGAGAAGGACGCGTTGCCCAACCAGACGCTGCGCGGGTTCGGCTTCGTCGAGCGGGTGAAGGCCGCCGTGGAGAAGGCCTGCCCCGACACCGTCTCCTGCGCCGACGTG
CTCGCCCTCATGGCCAGGGACGCGGTCTGGCTG
AGCAAGGGGCCATTCTGGGAAGTTCCTCTGGGCCGGAGAGACGGCAGCGTGTCCATCTCCAACGAGACCGACCAGCTGCCACCCCCG
ACCGCCAACTTCACCGTGCTGACCCAGCTCTTCGCCGCCAAGAACCTCGACATCAAGGACCTCGTGGTCCTCTCCGCCGGGCACACCATCGGGACATCCCATTGCTTCTCCTTCTCCGAC
CGCCTCTTCAACTTCACCGGCAGGGTCAACCCGCAAGACGTCGACCCGACGCTGGACTCGGAGTACATGGCCAAGCTCAAGGGCAAGTGCGCCAGCCTCAACGACAACACGACGCTGGTG
GAGATGGACCCCGGGAGCTTCAAGACCTTCGACCTGGACTACTTCACCATCGTGGCCAAGCGGAGGGGGCTCTTCCACTCCGACGGCGCCCTGCTCACCAACGCCTTCACCCGCGCCTAC
GTGCAGCGCCATGCTGGCGGCGCCTTCAAGGAGGAGTTCTTCGCCGACTTCGCCGCCTCCATGATCAAGATGGGCAACGCCGACGTGCTCACCGGCAGCCAGGGCGAGATCAGGAAGAAG
TGCTCCGTGCCTAATCAGTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AACACAGCCG CGATCAAGCT AGAGCTAGCT TCTCCTGATT AGCCAAAGAG GCGAGTTTGA CACAGCTGAA GCTTCTGGTG ATCATGGCGT CGAGGGCTCT GATGATGGCG CTGCTGCTCG  CGGCGGTGGC CGTGGGGTGC GCCCGGGCGC AGCTGCAGGA GAAGTTCTAC AGCGAGACTT GCCCCAGCGT GGAGGAAGTC GTCAGGAAGG AGATGGTGAG GGCTCTCTCC GTGGCGCCCA  GCCTCGCCGG GCCTTTGCTC AGGATGCATT TCCATGACTG CTTCGTCAGG GGTTGCGACG GGTCGGTTCT GCTGGACTCG GCGAACAAGA CGGCGGAGAA GGACGCGTTG CCCAACCAGA  CGCTGCGCGG GTTCGGCTTC GTCGAGCGGG TGAAGGCCGC CGTGGAGAAG GCCTGCCCCG ACACCGTCTC CTGCGCCGAC GTGCTCGCCC TCATGGCCAG GGACGCGGTC TGGCTGAGCA  AGGGGCCATT CTGGGAAGTT CCTCTGGGCC GGAGAGACGG CAGCGTGTCC ATCTCCAACG AGACCGACCA GCTGCCACCC CCGACCGCCA ACTTCACCGT GCTGACCCAG CTCTTCGCCG  CCAAGAACCT CGACATCAAG GACCTCGTGG TCCTCTCCGC CGGGCACACC ATCGGGACAT CCCATTGCTT CTCCTTCTCC GACCGCCTCT TCAACTTCAC CGGCAGGGTC AACCCGCAAG  ACGTCGACCC GACGCTGGAC TCGGAGTACA TGGCCAAGCT CAAGGGCAAG TGCGCCAGCC TCAACGACAA CACGACGCTG GTGGAGATGG ACCCCGGGAG CTTCAAGACC TTCGACCTGG  ACTACTTCAC CATCGTGGCC AAGCGGAGGG GGCTCTTCCA CTCCGACGGC GCCCTGCTCA CCAACGCCTT CACCCGCGCC TACGTGCAGC GCCATGCTGG CGGCGCCTTC AAGGAGGAGT  TCTTCGCCGA CTTCGCCGCC TCCATGATCA AGATGGGCAA CGCCGACGTG CTCACCGGCA GCCAGGGCGA GATCAGGAAG AAGTGCTCCG TGCCTAATCA GTAACTGAGG TAGAAAAGGG  CCCGTTCACA GTATGATCGA CTACGGGTTT GACGATGATT TTTCTGTTTG TGACCATCTT TTTCCGTGTA GATTATGTCC TTTCTCCCCG CCGATTTTCT GTTTATTAAT TGATTATTTT 
GTTACATCCG TGCATGTAAA GTTTGCTACA ACAACTCACG ATCATAATAA ACTTTGTTTT TTCATGTTGC GAATTGCGAT ATATATATGG TCCTGAGTTG ACATTTCTAA GGATCAAA 

Retrieve as FASTA