Entry information : BdiPrx75 (Bradi2g37000)
Entry ID 7863
Creation 2011-01-13 (Toky Ramarohetra)
Last sequence changes 2011-01-13 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-29 (Qiang Li)
Peroxidase information: BdiPrx75 (Bradi2g37000)
Name (synonym) BdiPrx75 (Bradi2g37000)
Class Class III peroxidase    [Orthogroup: Prx152]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type Flowers
Inducer Drought
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx75
start..stop
S start..stop
TaPrx14 550 0 1..336 1..343
HvPrx09 544 0 23..336 29..342
PedPrx05 517 0 13..336 17..339
OsPrx71 461 6e-165 6..336 2..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37385418..37385645 228 N° 2 37384072..37384396 325 N° 3 37383320..37383777 458  
complement(join(37383320..37383777,37384072..37384396,37385418..37385645))


exon

Literature and cross-references BdiPrx75 (Bradi2g37000)
Literature Lucas,S., Rokhsar,D., Wang,M., Lindquist,E.A., Fox,S.E., Vogel,J., Bragg,J.N., McKenzie,N., Bevan,M.W., Garvin,D., Michael,T., Hazen,S., Chang,J., Laudencia-Chingcuanco,D., Weng,Y. and Mockler,T. DOE Joint Genome Institute Brachypodium distachyon EST project. Unpublished (2009).
DNA ref. Phytozome 12:   Bd2 (37385645..37383320)
EST ref. GenBank:   GT817402.1 [3' end]
Protein sequence: BdiPrx75 (Bradi2g37000)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (311)
PWM (Da):   %s   36117.88 (33501.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.22 (5.22) Peptide Signal:   %s   cut: 26 range:26-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGSSSAFSFVLLVLLLAVWWPVAATAGSGLSVGFYRESCPKAEKVVRRIMAKAFKKEPGTPADIIRLFFHDCFVRGCDASVLLESMPGSMAERDSKPNNPSLDGFEVIADAKELLEKLCPSTVSCADILALAARDGAYLAGGFDYAIPTGRRDGLVSKEEDVLPNVPHADFNHDELVGNFTAKGFTLEEMVTLSGAHTIGTSHCSSFTDRLYDYYHDGVYGTDPGMPVAYAAGLKKKCPPVTSAHDDPTMVQLDDVTPFAMDNQYYKNVLAGTVAFGSDMALLESPETAAMVERYAAKPTAYWLRRFAAAMVKVSEMAVLTGSKGEIRLNCSKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1 and 3 (before regular position)) and 3 ESTs. Containing IntR (proximal).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGCTCGTCGTCGGCGTTCAGCTTTGTCCTCCTCGTGCTGTTGCTGGCGGTGTGGTGGCCGGTGGCGGCGACGGCAGGGTCCGGACTGTCGGTGGGGTTCTACAGGGAGTCATGC
CCCAAGGCGGAGAAGGTGGTCAGAAGAATCATGGCCAAGGCCTTCAAGAAGGAGCCCGGCACCCCCGCCGACATCATCCGCCTCTTCTTCCACGACTGTTTCGTCCGT
GTAAGTTTCTGT
TCATCCTTGGAGCTGCTTAACTACACACTATGTACAAAGATATAGTGTCAATGTACATATGCGAAAATTGTTAACAGTTCTAATTCAATGCATCCCTTTATCGAACTCAAACAGAAGGAC
GGCTCAGATCCCATCATAACTCTTCGATAAGGAGGACATGATTGTCAATTTGCAATTTGTAAAAACTAATTAGATCCCTGCAATTTTATTTATTTCCTACATCGCGCGTGCGTGTCTCTG
CGTTGGGCCAGGGGAAGCGGAGGCAGAAGTGGCCAAACATGGGCGCAAACTGCAGGCACGGATCGATCATGTTGGTGCAGTCGGTGATACTCGTAGTCTCGTACTGGAACAACGGGGTAG
TCAGACCCGCCGACGGGATCCGCCGCCGCTGATGATGTCGACGCGGAGACGACCTCGTTGACCCGGTCGCCGATGCCGTCGCGTGCCCCGACGAGACGCAAGCCAGGGATAGGAGAAACT
GCCCCCTCCCGCAAGCTGGCAACCGCCCAGCGCCGCCCGCTGCGTAGGGGAAGGAGGAGAAGGAGATGCCTTGGTGAAGGCCGTGGAACTGGAAAGAGATGGCCCGCCGGTCTCCCTGCT
GCGATGGCGGCCTTGAAAGTCGCGAGCAGCTTCAGGTCATCCTTGAAACTCGCGAGCAGCTGCAGGTTGGCCGGGTCCCCCTACTGTGATGGCGGTGGCGGAGGAGGCGAATGGATGCTC
CGTCGTACGCGGCGGAAGGAGGAGGGTGAGGGGTCGCGACGCTTGATCTGGTGGCAGGTGTGGGTGTCTTGGTAGGTGACGTCGAACATGGCAAAATCGGCGTTGGAACGCTGCACCTGC
TTCGTGGCCAATTGAAAAAGACCACGGTACTCTTTGTTGAGAAAGGGGGGTAGGGGGGGGGGGGGCGTATCGAATCAGACCTCAATTGTTAATTGCATAGTGGTATTGATATTATATAGT
TGGACGTGCAAGTATTTATAGAGATGTGTTACATGTATATGTTTGTTAGGGTTGTGATGCATCGGTACTTTTGGAGTCCATGCCGGGGAGCATGGCGGAGAGGGACTCGAAGCCGAACAA
CCCTAGCCTAGACGGCTTTGAGGTCATCGCCGACGCCAAGGAGCTCCTGGAGAAGTTGTGCCCAAGCACCGTCTCCTGCGCCGACATCCTTGCGCTTGCCGCCCGTGATGGAGCCTACCT
TGCCGGCGGGTTTGACTACGCCATCCCCACGGGCCGCCGTGATGGCCTCGTCTCCAAGGAGGAAGATGTTCTCCCCAATGTCCCTCACGCCGACTTCAACCATGATGAACTTGTAGGAAA
CTTCACCGCAAAAG
GTAAAACAAGCATCCATGATTCGTATATACTTCCTCCCCTTCCGTGCATAAAAGATGTCATTTTCGATATTTACAGTCTCCAAAGCACAAGTGTGACCACTAGTTA
TATATATTTAAGACAAATTCCTAGGCATATCATTTTCAAGTATCCGGTAGACATATTTGTAAAAATGTTAGCTAGCTAGTATATATATTCAGAAATTTGAAAATTGTCCAAAAACAGTAT
ATGCATGCATGTGCCTATTAGTTTGTACGAAACAGAGCTCTCATACCATGTTCAAGCCGCATGTTCAGGTTTCACGCTGGAAGAGATGGTAACGCTTTCAGGGGCACACACCATCGGCAC
CTCGCACTGCTCGTCATTCACGGACCGTCTCTACGACTATTACCATGATGGCGTGTACGGCACGGACCCGGGGATGCCAGTGGCATACGCGGCAGGCCTCAAGAAAAAGTGTCCACCCGT
GACATCGGCACATGATGACCCTACGATGGTGCAGTTGGACGACGTGACACCGTTCGCCATGGACAATCAATACTACAAGAACGTGTTGGCTGGCACGGTGGCGTTCGGCTCCGACATGGC
GCTGTTGGAGAGCCCCGAGACGGCGGCGATGGTGGAGCGCTACGCTGCGAAGCCAACTGCTTACTGGCTCCGGCGCTTCGCCGCCGCCATGGTGAAGGTGAGCGAGATGGCAGTGCTCAC
CGGCAGCAAGGGGGAGATCAGGCTCAACTGCTCCAAGGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGCTCGTCGTCGGCGTTCAGCTTTGTCCTCCTCGTGCTGTTGCTGGCGGTGTGGTGGCCGGTGGCGGCGACGGCAGGGTCCGGACTGTCGGTGGGGTTCTACAGGGAGTCATGC
CCCAAGGCGGAGAAGGTGGTCAGAAGAATCATGGCCAAGGCCTTCAAGAAGGAGCCCGGCACCCCCGCCGACATCATCCGCCTCTTCTTCCACGACTGTTTCGTCCGT
GGTTGTGATGCA
TCGGTACTTTTGGAGTCCATGCCGGGGAGCATGGCGGAGAGGGACTCGAAGCCGAACAACCCTAGCCTAGACGGCTTTGAGGTCATCGCCGACGCCAAGGAGCTCCTGGAGAAGTTGTGC
CCAAGCACCGTCTCCTGCGCCGACATCCTTGCGCTTGCCGCCCGTGATGGAGCCTACCTTGCCGGCGGGTTTGACTACGCCATCCCCACGGGCCGCCGTGATGGCCTCGTCTCCAAGGAG
GAAGATGTTCTCCCCAATGTCCCTCACGCCGACTTCAACCATGATGAACTTGTAGGAAACTTCACCGCAAAAG
GTTTCACGCTGGAAGAGATGGTAACGCTTTCAGGGGCACACACCATC
GGCACCTCGCACTGCTCGTCATTCACGGACCGTCTCTACGACTATTACCATGATGGCGTGTACGGCACGGACCCGGGGATGCCAGTGGCATACGCGGCAGGCCTCAAGAAAAAGTGTCCA
CCCGTGACATCGGCACATGATGACCCTACGATGGTGCAGTTGGACGACGTGACACCGTTCGCCATGGACAATCAATACTACAAGAACGTGTTGGCTGGCACGGTGGCGTTCGGCTCCGAC
ATGGCGCTGTTGGAGAGCCCCGAGACGGCGGCGATGGTGGAGCGCTACGCTGCGAAGCCAACTGCTTACTGGCTCCGGCGCTTCGCCGCCGCCATGGTGAAGGTGAGCGAGATGGCAGTG
CTCACCGGCAGCAAGGGGGAGATCAGGCTCAACTGCTCCAAGGTGAACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTGCCTTGGC GGCACTAGCT AGCTAAGCAC ACTGGCCAAC TTAATTAGCT AGCTCCTACG CTAGCTAGAT CGATCACATT TTCTCCGGCG ATGGCCGGCT CGTCGTCGGC GTTCAGCTTT  GTCCTCCTCG TGCTGTTGCT GGCGGTGTGG TGGCCGGTGG CGGCGACGGC AGGGTCCGGA CTGTCGGTGG GGTTCTACAG GGAGTCATGC CCCAAGGCGG AGAAGGTGGT CAGAAGAATC  ATGGCCAAGG CCTTCAAGAA GGAGCCCGGC ACCCCCGCCG ACATCATCCG CCTCTTCTTC CACGACTGTT TCGTCCGTGG TTGTGATGCA TCGGTACTTT TGGAGTCCAT GCCGGGGAGC  ATGGCGGAGA GGGACTCGAA GCCGAACAAC CCTAGCCTAG ACGGCTTTGA GGTCATCGCC GACGCCAAGG AGCTCCTGGA GAAGTTGTGC CCAAGCACCG TCTCCTGCGC CGACATCCTT  GCGCTTGCCG CCCGTGATGG AGCCTACCTT GCCGGCGGGT TTGACTACGC CATCCCCACG GGCCGCCGTG ATGGCCTCGT CTCCAAGGAG GAAGATGTTC TCCCCAATGT CCCTCACGCC  GACTTCAACC ATGATGAACT TGTAGGAAAC TTCACCGCAA AAGGTTTCAC GCTGGAAGAG ATGGTAACGC TTTCAGGGGC ACACACCATC GGCACCTCGC ACTGCTCGTC ATTCACGGAC  CGTCTCTACG ACTATTACCA TGATGGCGTG TACGGCACGG ACCCGGGGAT GCCAGTGGCA TACGCGGCAG GCCTCAAGAA AAAGTGTCCA CCCGTGACAT CGGCACATGA TGACCCTACG  ATGGTGCAGT TGGACGACGT GACACCGTTC GCCATGGACA ATCAATACTA CAAGAACGTG TTGGCTGGCA CGGTGGCGTT CGGCTCCGAC ATGGCGCTGT TGGAGAGCCC CGAGACGGCG  GCGATGGTGG AGCGCTACGC TGCGAAGCCA ACTGCTTACT GGCTCCGGCG CTTCGCCGCC GCCATGGTGA AGGTGAGCGA GATGGCAGTG CTCACCGGCA GCAAGGGGGA GATCAGGCTC  AACTGCTCCA AGGTGAACTA GCGATGTTGT ATGTTGGGGG AAATGATATA CAGATACATA CTGTTCCTTC ATTTTCATGT CTCTTCTTCA TTAATTTTTC ATGTGTATGT TGGTGAGAAA 
CATATATGCA GTGCATACTA CAAGTTTGTT TGTTTAATAT AAACTGCGTC GATTCACATA TTACATCCTT GAGTATGAGT GCGGTTG 

Retrieve as FASTA