Entry information : BdiPrx76 (Bradi2g37010)
Entry ID 7864
Creation 2011-01-13 (Toky Ramarohetra)
Last sequence changes 2011-01-13 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx76 (Bradi2g37010)
Name (synonym) BdiPrx76 (Bradi2g37010)
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx76
start..stop
S start..stop
BdiPrx77 595 0 1..335 1..335
TaPrx06 521 0 22..334 27..339
ZmPrx22 498 2e-179 1..337 1..338
ZmPrx146 498 2e-179 1..337 1..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37393679..37393903 225 N° 2 37392788..37393576 789  
complement(join(37392788..37393576,37393679..37393903))


exon

Literature and cross-references BdiPrx76 (Bradi2g37010)
DNA ref. Phytozome 12:   Bd2 (37393903..37392788)
Protein sequence: BdiPrx76 (Bradi2g37010)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (315)
PWM (Da):   %s   36313.48 (34132.3)  
PI (pH):   %s   8.16 (7.96) Peptide Signal:   %s   cut: 23 range:23-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSPWLVLAAAALAVSVSSVTAYPPPSNSLKVGFYEHSCPQAEAIVRDAVRRAIARNPGFAPGLIRMHFHDCFVRGCDGSVLINSTPGNRAEKDSVANTPSLRGFEVIDDAKAILESVCPRTVSCADILAFAARDSTLLAGDIAYAVPSGRRDGLVSRESEVLDNNVPPPTDEVGALIASFARKGLSADDMVTLSGAHTIGRSHCSSFTQRLHNFTGVRGRTDPSIEPYYAAELKRRCPPETNDMNNPTVVPLDVVTPVQFDNQYFKNVLAHKVPLTSDQTLLTCKRTAGIVVFHAAVEKAWRAKFAVSMVRMGNVGVLTGDQGEIREKCFAVNRRY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTCGCCGTGGTTGGTTCTTGCGGCGGCGGCTCTCGCCGTGTCCGTCTCATCGGTCACGGCATATCCGCCGCCGTCCAACTCTTTGAAGGTTGGGTTCTACGAGCACTCCTGCCCG
CAGGCGGAGGCCATAGTGCGCGACGCCGTTCGCCGTGCCATCGCCCGTAACCCCGGCTTCGCCCCCGGCCTCATCCGCATGCACTTCCATGACTGCTTCGTCAGG
GTAAGCAAAGAAGAA
GAGCTTTGCATGCATGAATCTGGTCTTGTTGGTTGTCGTTGACTATGATCTGACCGTTGACTTTGCCACGTGTATGTACAAATACAGGGCTGCGATGGATCCGTGCTGATCAACTCGACC
CCGGGCAACCGGGCGGAGAAGGACTCGGTGGCCAACACCCCGAGCCTTCGAGGCTTCGAGGTGATCGACGACGCCAAGGCCATCCTGGAATCCGTGTGCCCGCGCACGGTCTCCTGCGCC
GACATCCTCGCCTTCGCCGCCCGCGACAGCACTCTCCTCGCCGGGGACATCGCCTACGCCGTCCCCTCCGGCCGCCGCGACGGCCTCGTCTCCCGGGAATCCGAGGTGCTCGATAACAAC
GTGCCGCCGCCCACCGACGAGGTCGGCGCCCTCATCGCCTCCTTCGCACGCAAGGGGCTCAGCGCCGACGACATGGTCACGCTCTCCGGCGCGCACACCATCGGCCGTTCCCACTGCTCC
TCCTTCACGCAGCGGCTCCACAACTTCACCGGTGTCCGAGGACGCACCGACCCTTCCATCGAGCCGTACTACGCGGCGGAGCTCAAACGGAGGTGCCCGCCGGAGACGAACGACATGAAC
AACCCCACCGTCGTGCCGCTTGACGTCGTGACGCCGGTGCAGTTTGATAACCAGTACTTCAAGAACGTGCTGGCGCATAAGGTGCCGCTCACGTCGGACCAGACGCTGCTCACCTGCAAG
CGCACCGCCGGGATTGTTGTCTTCCACGCCGCTGTGGAGAAGGCGTGGCGGGCCAAGTTTGCGGTGTCGATGGTCAGGATGGGCAACGTCGGTGTGCTCACCGGCGACCAGGGCGAGATC
AGGGAGAAATGCTTCGCCGTCAACAGACGCTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTCGCCGTGGTTGGTTCTTGCGGCGGCGGCTCTCGCCGTGTCCGTCTCATCGGTCACGGCATATCCGCCGCCGTCCAACTCTTTGAAGGTTGGGTTCTACGAGCACTCCTGCCCG
CAGGCGGAGGCCATAGTGCGCGACGCCGTTCGCCGTGCCATCGCCCGTAACCCCGGCTTCGCCCCCGGCCTCATCCGCATGCACTTCCATGACTGCTTCGTCAGG
GGCTGCGATGGATCC
GTGCTGATCAACTCGACCCCGGGCAACCGGGCGGAGAAGGACTCGGTGGCCAACACCCCGAGCCTTCGAGGCTTCGAGGTGATCGACGACGCCAAGGCCATCCTGGAATCCGTGTGCCCG
CGCACGGTCTCCTGCGCCGACATCCTCGCCTTCGCCGCCCGCGACAGCACTCTCCTCGCCGGGGACATCGCCTACGCCGTCCCCTCCGGCCGCCGCGACGGCCTCGTCTCCCGGGAATCC
GAGGTGCTCGATAACAACGTGCCGCCGCCCACCGACGAGGTCGGCGCCCTCATCGCCTCCTTCGCACGCAAGGGGCTCAGCGCCGACGACATGGTCACGCTCTCCGGCGCGCACACCATC
GGCCGTTCCCACTGCTCCTCCTTCACGCAGCGGCTCCACAACTTCACCGGTGTCCGAGGACGCACCGACCCTTCCATCGAGCCGTACTACGCGGCGGAGCTCAAACGGAGGTGCCCGCCG
GAGACGAACGACATGAACAACCCCACCGTCGTGCCGCTTGACGTCGTGACGCCGGTGCAGTTTGATAACCAGTACTTCAAGAACGTGCTGGCGCATAAGGTGCCGCTCACGTCGGACCAG
ACGCTGCTCACCTGCAAGCGCACCGCCGGGATTGTTGTCTTCCACGCCGCTGTGGAGAAGGCGTGGCGGGCCAAGTTTGCGGTGTCGATGGTCAGGATGGGCAACGTCGGTGTGCTCACC
GGCGACCAGGGCGAGATCAGGGAGAAATGCTTCGCCGTCAACAGACGCTACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTCGC CGTGGTTGGT TCTTGCGGCG GCGGCTCTCG CCGTGTCCGT CTCATCGGTC ACGGCATATC CGCCGCCGTC CAACTCTTTG AAGGTTGGGT TCTACGAGCA CTCCTGCCCG  CAGGCGGAGG CCATAGTGCG CGACGCCGTT CGCCGTGCCA TCGCCCGTAA CCCCGGCTTC GCCCCCGGCC TCATCCGCAT GCACTTCCAT GACTGCTTCG TCAGGGGCTG CGATGGATCC  GTGCTGATCA ACTCGACCCC GGGCAACCGG GCGGAGAAGG ACTCGGTGGC CAACACCCCG AGCCTTCGAG GCTTCGAGGT GATCGACGAC GCCAAGGCCA TCCTGGAATC CGTGTGCCCG  CGCACGGTCT CCTGCGCCGA CATCCTCGCC TTCGCCGCCC GCGACAGCAC TCTCCTCGCC GGGGACATCG CCTACGCCGT CCCCTCCGGC CGCCGCGACG GCCTCGTCTC CCGGGAATCC  GAGGTGCTCG ATAACAACGT GCCGCCGCCC ACCGACGAGG TCGGCGCCCT CATCGCCTCC TTCGCACGCA AGGGGCTCAG CGCCGACGAC ATGGTCACGC TCTCCGGCGC GCACACCATC  GGCCGTTCCC ACTGCTCCTC CTTCACGCAG CGGCTCCACA ACTTCACCGG TGTCCGAGGA CGCACCGACC CTTCCATCGA GCCGTACTAC GCGGCGGAGC TCAAACGGAG GTGCCCGCCG  GAGACGAACG ACATGAACAA CCCCACCGTC GTGCCGCTTG ACGTCGTGAC GCCGGTGCAG TTTGATAACC AGTACTTCAA GAACGTGCTG GCGCATAAGG TGCCGCTCAC GTCGGACCAG  ACGCTGCTCA CCTGCAAGCG CACCGCCGGG ATTGTTGTCT TCCACGCCGC TGTGGAGAAG GCGTGGCGGG CCAAGTTTGC GGTGTCGATG GTCAGGATGG GCAACGTCGG TGTGCTCACC  GGCGACCAGG GCGAGATCAG GGAGAAATGC TTCGCCGTCA ACAGACGCTA CTAAGCCACT CGCAGGCTTC CAATATCTGT TAATCCAAAT TTCAGTGCAG TACACATGTG TGTTCATGTT 
GGTCCTTCAG TTTCTTGTGA GTTCATTTCC CAATGTGAAT TGTTGTTGTT CGTTTGTGTC AAGAAAGGAG TAATTAAGAA AGAAACAATC TTGTGTGC 

Retrieve as FASTA