Entry information : BdiPrx77 (Bradi2g37020)
Entry ID 7865
Creation 2011-01-13 (Toky Ramarohetra)
Last sequence changes 2011-01-13 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx77 (Bradi2g37020)
Name (synonym) BdiPrx77 (Bradi2g37020)
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx77
start..stop
S start..stop
BdiPrx76 595 0 1..335 1..335
TaPrx06 538 0 20..336 25..341
SiPrx108 507 0 2..336 3..335
SiPrx107 504 0 1..336 1..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37430209..37430433 225 N° 2 37430558..37431343 786  
join(37430209..37430433,37430558..37431343)


exon

Literature and cross-references BdiPrx77 (Bradi2g37020)
DNA ref. Phytozome 12:   Bd2 (37430209..37431343)
Protein sequence: BdiPrx77 (Bradi2g37020)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (314)
PWM (Da):   %s   35932.28 (33735.1) Transmb domain:   %s   i5-24o
PI (pH):   %s   7.78 (7.50) Peptide Signal:   %s   cut: 23 range:23-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRLPWFVLAAAALAVAVSSATAYAPPSKTLKVGFYEHSCPQAEAIVRDAVRRGIARNPGFAPGLIRMHFHDCFVRGCDGSVLINSTPGNRAEKDSVANTPSLRGFEVIDDAKAILESVCPRTVSCADVLAFAARDSADLAGGISYPLPSGRRDGRVSLESEVLDNNVPPPTDDVAALIASFARKGLSADDMVTLSGAHTIGRSHCSSFTQRIHNFTGVQGRTDPSIEPAYASDLKRRCPPATDDPNDPTVVPLDVVTPAEFDNQYYKNVLAHKVPLTSDQTLITSKRTAAIVVFHAAVEKAWRAKFAVSMVRMGNVGVLTGHQGEIREKCFAINRH*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 1 intron). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTGCCGTGGTTTGTTCTTGCGGCGGCAGCGCTCGCCGTGGCCGTGTCTTCGGCGACGGCGTATGCGCCACCGTCCAAGACTTTGAAGGTTGGGTTCTACGAGCACTCGTGCCCG
CAGGCGGAGGCCATCGTGCGCGACGCCGTCCGCCGCGGCATCGCCCGTAACCCCGGCTTCGCCCCCGGCCTCATCCGCATGCACTTCCATGACTGCTTCGTCAGG
GTAAGCAAAGCAAGC
AAGAAGAAGCTTATTAGTTACACTCTATTGCTTTGCTTAATAAATCCAACCTTCCATGCATGTAATATCTGGTCTGACCGTTGATTTTGCCACGTGTGTGTGTATATAGGGCTGCGATGG
ATCCGTGCTGATCAACTCGACCCCGGGCAACCGGGCGGAGAAGGACTCGGTGGCCAACACCCCGAGCCTTCGAGGCTTCGAGGTGATCGACGACGCCAAAGCCATCCTCGAATCCGTGTG
CCCACGCACGGTCTCCTGCGCCGACGTCCTCGCCTTCGCCGCCCGCGACAGCGCCGACCTCGCGGGCGGCATCTCCTACCCACTCCCCTCCGGCCGCCGCGACGGCCGCGTCTCCCTCGA
GTCCGAGGTGCTCGACAACAACGTGCCGCCCCCCACAGACGACGTCGCCGCCCTCATCGCCTCCTTCGCGCGCAAGGGGCTCAGCGCCGACGACATGGTCACGCTCTCCGGGGCCCACAC
CATCGGCCGCTCCCACTGCTCCTCCTTCACGCAGCGGATCCACAACTTCACCGGCGTCCAAGGCCGCACCGACCCTTCCATCGAGCCCGCCTACGCCTCGGACCTCAAACGGAGGTGCCC
GCCGGCGACGGATGACCCGAACGACCCCACCGTCGTGCCGCTCGATGTGGTGACGCCGGCGGAGTTCGACAACCAGTACTACAAGAACGTGCTGGCGCACAAGGTGCCGCTGACCTCGGA
CCAGACGCTGATCACCAGCAAGCGGACTGCCGCGATCGTCGTCTTCCACGCGGCTGTCGAGAAGGCGTGGCGGGCCAAGTTTGCCGTGTCGATGGTCAGGATGGGCAACGTCGGCGTGCT
CACCGGCCACCAGGGCGAGATCAGGGAGAAATGCTTCGCCATCAATAGACACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTGCCGTGGTTTGTTCTTGCGGCGGCAGCGCTCGCCGTGGCCGTGTCTTCGGCGACGGCGTATGCGCCACCGTCCAAGACTTTGAAGGTTGGGTTCTACGAGCACTCGTGCCCG
CAGGCGGAGGCCATCGTGCGCGACGCCGTCCGCCGCGGCATCGCCCGTAACCCCGGCTTCGCCCCCGGCCTCATCCGCATGCACTTCCATGACTGCTTCGTCAGG
GGCTGCGATGGATCC
GTGCTGATCAACTCGACCCCGGGCAACCGGGCGGAGAAGGACTCGGTGGCCAACACCCCGAGCCTTCGAGGCTTCGAGGTGATCGACGACGCCAAAGCCATCCTCGAATCCGTGTGCCCA
CGCACGGTCTCCTGCGCCGACGTCCTCGCCTTCGCCGCCCGCGACAGCGCCGACCTCGCGGGCGGCATCTCCTACCCACTCCCCTCCGGCCGCCGCGACGGCCGCGTCTCCCTCGAGTCC
GAGGTGCTCGACAACAACGTGCCGCCCCCCACAGACGACGTCGCCGCCCTCATCGCCTCCTTCGCGCGCAAGGGGCTCAGCGCCGACGACATGGTCACGCTCTCCGGGGCCCACACCATC
GGCCGCTCCCACTGCTCCTCCTTCACGCAGCGGATCCACAACTTCACCGGCGTCCAAGGCCGCACCGACCCTTCCATCGAGCCCGCCTACGCCTCGGACCTCAAACGGAGGTGCCCGCCG
GCGACGGATGACCCGAACGACCCCACCGTCGTGCCGCTCGATGTGGTGACGCCGGCGGAGTTCGACAACCAGTACTACAAGAACGTGCTGGCGCACAAGGTGCCGCTGACCTCGGACCAG
ACGCTGATCACCAGCAAGCGGACTGCCGCGATCGTCGTCTTCCACGCGGCTGTCGAGAAGGCGTGGCGGGCCAAGTTTGCCGTGTCGATGGTCAGGATGGGCAACGTCGGCGTGCTCACC
GGCCACCAGGGCGAGATCAGGGAGAAATGCTTCGCCATCAATAGACACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCAACTCATC TCCACATCAA ACCAACATCC AAATTCCAAT TCCATATATC TTGCCATTCC GGCCGAGCCC GAGCGAGCTT GCTTGAGCTT GACCCATAAG CTAATTCCCG GAGCTAAAGC  TTGACCATGA GGTTGCCGTG GTTTGTTCTT GCGGCGGCAG CGCTCGCCGT GGCCGTGTCT TCGGCGACGG CGTATGCGCC ACCGTCCAAG ACTTTGAAGG TTGGGTTCTA CGAGCACTCG  TGCCCGCAGG CGGAGGCCAT CGTGCGCGAC GCCGTCCGCC GCGGCATCGC CCGTAACCCC GGCTTCGCCC CCGGCCTCAT CCGCATGCAC TTCCATGACT GCTTCGTCAG GGGCTGCGAT  GGATCCGTGC TGATCAACTC GACCCCGGGC AACCGGGCGG AGAAGGACTC GGTGGCCAAC ACCCCGAGCC TTCGAGGCTT CGAGGTGATC GACGACGCCA AAGCCATCCT CGAATCCGTG  TGCCCACGCA CGGTCTCCTG CGCCGACGTC CTCGCCTTCG CCGCCCGCGA CAGCGCCGAC CTCGCGGGCG GCATCTCCTA CCCACTCCCC TCCGGCCGCC GCGACGGCCG CGTCTCCCTC  GAGTCCGAGG TGCTCGACAA CAACGTGCCG CCCCCCACAG ACGACGTCGC CGCCCTCATC GCCTCCTTCG CGCGCAAGGG GCTCAGCGCC GACGACATGG TCACGCTCTC CGGGGCCCAC  ACCATCGGCC GCTCCCACTG CTCCTCCTTC ACGCAGCGGA TCCACAACTT CACCGGCGTC CAAGGCCGCA CCGACCCTTC CATCGAGCCC GCCTACGCCT CGGACCTCAA ACGGAGGTGC  CCGCCGGCGA CGGATGACCC GAACGACCCC ACCGTCGTGC CGCTCGATGT GGTGACGCCG GCGGAGTTCG ACAACCAGTA CTACAAGAAC GTGCTGGCGC ACAAGGTGCC GCTGACCTCG  GACCAGACGC TGATCACCAG CAAGCGGACT GCCGCGATCG TCGTCTTCCA CGCGGCTGTC GAGAAGGCGT GGCGGGCCAA GTTTGCCGTG TCGATGGTCA GGATGGGCAA CGTCGGCGTG  CTCACCGGCC ACCAGGGCGA GATCAGGGAG AAATGCTTCG CCATCAATAG ACACTAGTAG TCTTTCCTTC CGTTAATCCA AAATTCAACT CAGATGCGTT AATTGTAGGT CATATACGTG  TGTACGTGTA CATGTTGGTC CTTAAATTTC TTGCAAGTGA TGAATTTGCC GATGTGAATT CTTGTTGTTG TTCGTGTATG TCAAAGAAGA AGGGAGTAAT AATTAAGAAT GAAACAATAT 
TTTGACGGG 

Retrieve as FASTA