Entry information : BdiPrx78 (Bradi2g37040)
Entry ID 7866
Creation 2011-01-13 (Toky Ramarohetra)
Last sequence changes 2011-01-13 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx78 (Bradi2g37040)
Name (synonym) BdiPrx78 (Bradi2g37040)
Class Class III peroxidase    [Orthogroup: Prx153]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx78
start..stop
S start..stop
OsPrx69 471 1e-168 8..342 8..332
SiPrx93 460 4e-164 41..342 31..334
SbPrx113 457 3e-163 39..342 32..338
ZmPrx77 441 1e-156 44..342 34..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37438809..37439078 270 N° 2 37439184..37439942 759  
join(37438809..37439078,37439184..37439942)


exon

Literature and cross-references BdiPrx78 (Bradi2g37040)
Literature Hayden,D.M., Donze,T.J., Vivian,L.A., Stamova,B. and Coleman-Derr,D.
EST sequencing and phylogenetic analysis of the model grass Brachypodium distachyon.
Theor Appl Genet 113 (2), 186-195 (2006).
DNA ref. Phytozome 12:   Bd2 (37438809..37439942)
Protein sequence: BdiPrx78 (Bradi2g37040)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   342 (307)
PWM (Da):   %s   36456.46 (32922.7) Transmb domain:   %s   i13-35o
PI (pH):   %s   8.79 (8.91) Peptide Signal:   %s   cut: 36 range:36-342
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSRGGVGDARRVSSVLNAMVLLAWACSFLGGADAQAQAQAQAKLDVGYYNGSCPDAEDLVTTIVHASIRMDPGNGPGLIRLFFHDCFVRGCDASVLLDDPTGNSTAEKDAPPNFPSLRGFGVIDRAKRVVERRCPGTVSCADILAFAARDASRIMGGVKYSVPAGRLDGRVSRSAEALNNLPPASSNITRLVSLFKSKNLTADDMVTLSGAHSIGRSHCSSFTSRLYPRIDATLNVTLGKALRAGKCPAATGRLDRVVQLDHVTPLMLDTQYYVNVGNHEVLFGSDQALTDRTDTARLVAAYAGNRKLWSRRFGEAMVQMGYADVLTGPPGEIRKVCSRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 1 intron). 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCCAGAGGCGGCGTCGGCGATGCTCGTCGTGTCAGCTCAGTGCTGAATGCCATGGTCCTGCTCGCGTGGGCTTGCTCCTTCTTGGGCGGCGCCGACGCCCAGGCCCAGGCCCAG
GCCCAAGCAAAGCTGGATGTCGGCTACTACAACGGCAGCTGCCCGGACGCCGAGGACCTGGTCACCACGATCGTCCACGCCTCCATCCGCATGGACCCCGGCAACGGGCCCGGCCTCATC
CGCCTCTTCTTCCACGACTGCTTCGTCAGG
GTACATTACATTACACACACACACACACACACGCCATTATTGTTAATTTGAGTAACTCCTCAAGTTTCCATTGCTAAGTAGTGCTAACTC
GATCTTTGATTCCAGGGCTGCGACGCGTCGGTGCTGCTGGACGACCCGACGGGGAACTCGACGGCGGAGAAAGACGCGCCGCCAAACTTCCCCTCCCTACGAGGCTTCGGCGTGATCGAC
CGCGCGAAGCGCGTGGTGGAGCGCCGGTGCCCGGGGACCGTCTCCTGCGCCGACATCCTCGCCTTCGCGGCACGTGACGCGTCGCGCATAATGGGGGGCGTCAAGTACTCCGTCCCCGCG
GGACGGCTCGACGGCCGGGTCTCCCGGTCCGCCGAAGCGCTCAACAACCTCCCACCCGCGAGCTCCAACATCACGCGGCTCGTCTCCCTCTTCAAGTCCAAGAACCTGACCGCCGACGAC
ATGGTCACGCTGTCCGGGGCGCACTCCATCGGCCGATCCCACTGCTCCTCCTTCACCTCGCGCCTCTACCCGAGGATCGACGCCACGCTGAATGTCACTCTGGGGAAAGCTCTTCGTGCC
GGGAAGTGCCCGGCGGCGACGGGGAGGCTGGATAGAGTGGTTCAGTTGGACCATGTCACGCCGTTGATGCTGGACACGCAGTATTATGTCAATGTGGGGAACCATGAGGTGCTCTTCGGG
TCCGACCAGGCGCTGACGGACAGGACCGACACGGCGAGGCTCGTCGCGGCGTACGCCGGCAACCGGAAGCTCTGGTCGCGGCGGTTCGGGGAGGCCATGGTGCAGATGGGCTACGCCGAC
GTGCTCACCGGACCGCCAGGGGAGATCAGGAAAGTCTGCAGCAGAGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCCAGAGGCGGCGTCGGCGATGCTCGTCGTGTCAGCTCAGTGCTGAATGCCATGGTCCTGCTCGCGTGGGCTTGCTCCTTCTTGGGCGGCGCCGACGCCCAGGCCCAGGCCCAG
GCCCAAGCAAAGCTGGATGTCGGCTACTACAACGGCAGCTGCCCGGACGCCGAGGACCTGGTCACCACGATCGTCCACGCCTCCATCCGCATGGACCCCGGCAACGGGCCCGGCCTCATC
CGCCTCTTCTTCCACGACTGCTTCGTCAGG
GGCTGCGACGCGTCGGTGCTGCTGGACGACCCGACGGGGAACTCGACGGCGGAGAAAGACGCGCCGCCAAACTTCCCCTCCCTACGAGGC
TTCGGCGTGATCGACCGCGCGAAGCGCGTGGTGGAGCGCCGGTGCCCGGGGACCGTCTCCTGCGCCGACATCCTCGCCTTCGCGGCACGTGACGCGTCGCGCATAATGGGGGGCGTCAAG
TACTCCGTCCCCGCGGGACGGCTCGACGGCCGGGTCTCCCGGTCCGCCGAAGCGCTCAACAACCTCCCACCCGCGAGCTCCAACATCACGCGGCTCGTCTCCCTCTTCAAGTCCAAGAAC
CTGACCGCCGACGACATGGTCACGCTGTCCGGGGCGCACTCCATCGGCCGATCCCACTGCTCCTCCTTCACCTCGCGCCTCTACCCGAGGATCGACGCCACGCTGAATGTCACTCTGGGG
AAAGCTCTTCGTGCCGGGAAGTGCCCGGCGGCGACGGGGAGGCTGGATAGAGTGGTTCAGTTGGACCATGTCACGCCGTTGATGCTGGACACGCAGTATTATGTCAATGTGGGGAACCAT
GAGGTGCTCTTCGGGTCCGACCAGGCGCTGACGGACAGGACCGACACGGCGAGGCTCGTCGCGGCGTACGCCGGCAACCGGAAGCTCTGGTCGCGGCGGTTCGGGGAGGCCATGGTGCAG
ATGGGCTACGCCGACGTGCTCACCGGACCGCCAGGGGAGATCAGGAAAGTCTGCAGCAGAGTCAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATATATCCTC TGCACAGACC CAGAGGCCGG TAGCACTAAC TTCCACAATC CATCCATATC TAGCTCTCTA ACTAGCTCTA ACTAGCTAGC TTGGTCCGCC GGAGATGGAT TCCAGAGGCG  GCGTCGGCGA TGCTCGTCGT GTCAGCTCAG TGCTGAATGC CATGGTCCTG CTCGCGTGGG CTTGCTCCTT CTTGGGCGGC GCCGACGCCC AGGCCCAGGC CCAGGCCCAA GCAAAGCTGG  ATGTCGGCTA CTACAACGGC AGCTGCCCGG ACGCCGAGGA CCTGGTCACC ACGATCGTCC ACGCCTCCAT CCGCATGGAC CCCGGCAACG GGCCCGGCCT CATCCGCCTC TTCTTCCACG  ACTGCTTCGT CAGGGGCTGC GACGCGTCGG TGCTGCTGGA CGACCCGACG GGGAACTCGA CGGCGGAGAA AGACGCGCCG CCAAACTTCC CCTCCCTACG AGGCTTCGGC GTGATCGACC  GCGCGAAGCG CGTGGTGGAG CGCCGGTGCC CGGGGACCGT CTCCTGCGCC GACATCCTCG CCTTCGCGGC ACGTGACGCG TCGCGCATAA TGGGGGGCGT CAAGTACTCC GTCCCCGCGG  GACGGCTCGA CGGCCGGGTC TCCCGGTCCG CCGAAGCGCT CAACAACCTC CCACCCGCGA GCTCCAACAT CACGCGGCTC GTCTCCCTCT TCAAGTCCAA GAACCTGACC GCCGACGACA  TGGTCACGCT GTCCGGGGCG CACTCCATCG GCCGATCCCA CTGCTCCTCC TTCACCTCGC GCCTCTACCC GAGGATCGAC GCCACGCTGA ATGTCACTCT GGGGAAAGCT CTTCGTGCCG  GGAAGTGCCC GGCGGCGACG GGGAGGCTGG ATAGAGTGGT TCAGTTGGAC CATGTCACGC CGTTGATGCT GGACACGCAG TATTATGTCA ATGTGGGGAA CCATGAGGTG CTCTTCGGGT  CCGACCAGGC GCTGACGGAC AGGACCGACA CGGCGAGGCT CGTCGCGGCG TACGCCGGCA ACCGGAAGCT CTGGTCGCGG CGGTTCGGGG AGGCCATGGT GCAGATGGGC TACGCCGACG  TGCTCACCGG ACCGCCAGGG GAGATCAGGA AAGTCTGCAG CAGAGTCAAC TAAAGCTAGC TTAGCTAGTG GAGTAGTACA GCATCAAACA CATTTCTTTT GTTTTATTTT TTTCTCTCGA  TTCAGAGTTC TGTGCATGCA TGCACATGTG TACTGATCCG GCCGCTATTA GCTGTACATG ATATGATCGA TCGCCAGATT CTGCCTTAAT TGGCTCCGAG GTGCATGCTA CCTAAGGGTA  GATCAGTTGT CACATTGTCG GAAAATTCCA TTGATTGATT TTGTGGGGCT ATACTTGGTT ATTAGGAGAG AAATGAATGA ATCAAGAATG ATAATGAGAT CAGTGTATTA ATTGGTTGTT 
TCATAATA 

Retrieve as FASTA