Entry information : BdiPrx89 (Bradi2g38700)
Entry ID 7868
Creation 2011-01-14 (Toky Ramarohetra)
Last sequence changes 2011-01-14 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: BdiPrx89 (Bradi2g38700)
Name (synonym) BdiPrx89 (Bradi2g38700)
Class Class III peroxidase    [Orthogroup: Prx101]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx89
start..stop
S start..stop
BdiPrx85 380 6e-133 28..324 27..319
BdiPrx87 362 6e-126 1..326 1..322
BdiPrx86 356 1e-123 26..325 24..316
BdiPrx90 285 3e-95 7..325 3..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38979788..38979991 204 N° 2 38980374..38981159 786  
join(38979788..38979991,38980374..38981159)


exon

Literature and cross-references BdiPrx89 (Bradi2g38700)
DNA ref. Phytozome 12:   Bd2 (38979788..38981159)
Protein sequence: BdiPrx89 (Bradi2g38700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (297)
PWM (Da):   %s   34843.01 (31739.2) Transmb domain:   %s   i9-27o
PI (pH):   %s   7.45 (6.67) Peptide Signal:   %s   cut: 33 range:33-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKSGEKGSVLVLVAFAAAILLLGAQVKPAVADGYNTDIEGKVRGIVNARIYDAPGLIRLVFHDCWVKGCDASVLLKRADGLAEMDAVQNGGLRGLDVIQAIKDALTKDYPAVTCADAVVYAAREACYILSYGKIAYPVDGPGYHKDAVGSFKDDAAALPPPFGPSSSFKNLTKNFGGKPGFGAGDLVILSGAHAVGLAHRPAFVDRLDLQVAARGEIDVLYQKKIDQVSNASPAKAIHNNVRDIDQPETVPGVLDNSYYAANLGKKVLFNSDWALITDPAARGQMERFEKFPGDWYDLFGKAMAKLSRLPAEGPTLSVPRARCDGTSY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1), no EST. Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGAGCGGCGAAAAGGGGTCTGTTTTGGTGCTCGTGGCCTTTGCCGCTGCCATCCTCCTCCTGGGCGCGCAGGTGAAGCCGGCTGTTGCTGATGGCTATAACACCGATATAGAG
GGCAAGGTGAGGGGTATAGTGAATGCCAGAATCTACGACGCCCCTGGACTCATCCGGCTCGTGTTCCACGACTGCTGGGTAAAG
GTAACAATTATTCAAACAGCCACTCTTGATATTGCA
GTTATTTAGTGCTCATGTTTCTCTTTTTCGGTGGTAAAGTAATCAGGGGCATTTTGTTACATTTGCAAATGTTTCCGGCAATCATGGGTACATGAACATATGTAGCAAAATGAAACAGGG
TGTGGTTTTATCTCAGCCGTCAGATTTTTAAGTATAAATCTCAGTTGACGCATCAGAACTGTTGGATTAAAATCTGATTGCCATCATAATTTTTCCTTCTCTCACATGCTGCCGTTGGAT
TAAGATTTGATGGTCAAAAAGTCGACTGATTTTCTAATTAAAAGACAAGTAACTTCTCATCAGCAAAAAACAGAATGAAATAACACATTCGTACGGTTTGTATCAGGGTTGCGATGCATC
CGTGTTGCTGAAGAGAGCTGATGGGCTGGCAGAGATGGACGCGGTCCAGAACGGCGGACTCCGGGGCCTGGACGTGATCCAGGCCATCAAGGACGCGCTCACCAAGGACTACCCGGCCGT
CACCTGCGCCGACGCAGTTGTCTACGCGGCGCGCGAGGCGTGCTACATCCTTAGCTACGGCAAGATCGCGTACCCCGTGGACGGGCCGGGCTACCACAAGGACGCCGTCGGCTCGTTCAA
GGACGACGCGGCGGCGCTCCCGCCGCCCTTCGGACCCTCGTCCAGCTTCAAGAACCTCACCAAGAACTTCGGCGGCAAGCCGGGCTTCGGTGCCGGTGATCTCGTAATCCTCTCTGGCGC
GCACGCCGTCGGCCTGGCCCACCGCCCGGCCTTTGTAGACCGCCTGGACCTGCAGGTCGCGGCCCGTGGCGAGATCGACGTCCTTTACCAGAAAAAGATCGATCAGGTGTCGAATGCAAG
CCCGGCGAAGGCGATCCACAACAACGTCCGCGACATCGACCAACCTGAGACGGTGCCTGGCGTCCTGGACAACAGCTACTACGCCGCCAACCTCGGTAAGAAGGTGCTCTTCAACTCCGA
CTGGGCGCTCATCACGGACCCGGCCGCGCGGGGACAAATGGAAAGGTTCGAGAAATTCCCCGGCGACTGGTACGACCTCTTCGGCAAGGCAATGGCCAAGCTCAGCAGGCTCCCTGCCGA
GGGCCCCACTCTCAGTGTGCCCAGGGCGAGATGCGATGGCACCAGCTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGAGCGGCGAAAAGGGGTCTGTTTTGGTGCTCGTGGCCTTTGCCGCTGCCATCCTCCTCCTGGGCGCGCAGGTGAAGCCGGCTGTTGCTGATGGCTATAACACCGATATAGAG
GGCAAGGTGAGGGGTATAGTGAATGCCAGAATCTACGACGCCCCTGGACTCATCCGGCTCGTGTTCCACGACTGCTGGGTAAAG
GGTTGCGATGCATCCGTGTTGCTGAAGAGAGCTGAT
GGGCTGGCAGAGATGGACGCGGTCCAGAACGGCGGACTCCGGGGCCTGGACGTGATCCAGGCCATCAAGGACGCGCTCACCAAGGACTACCCGGCCGTCACCTGCGCCGACGCAGTTGTC
TACGCGGCGCGCGAGGCGTGCTACATCCTTAGCTACGGCAAGATCGCGTACCCCGTGGACGGGCCGGGCTACCACAAGGACGCCGTCGGCTCGTTCAAGGACGACGCGGCGGCGCTCCCG
CCGCCCTTCGGACCCTCGTCCAGCTTCAAGAACCTCACCAAGAACTTCGGCGGCAAGCCGGGCTTCGGTGCCGGTGATCTCGTAATCCTCTCTGGCGCGCACGCCGTCGGCCTGGCCCAC
CGCCCGGCCTTTGTAGACCGCCTGGACCTGCAGGTCGCGGCCCGTGGCGAGATCGACGTCCTTTACCAGAAAAAGATCGATCAGGTGTCGAATGCAAGCCCGGCGAAGGCGATCCACAAC
AACGTCCGCGACATCGACCAACCTGAGACGGTGCCTGGCGTCCTGGACAACAGCTACTACGCCGCCAACCTCGGTAAGAAGGTGCTCTTCAACTCCGACTGGGCGCTCATCACGGACCCG
GCCGCGCGGGGACAAATGGAAAGGTTCGAGAAATTCCCCGGCGACTGGTACGACCTCTTCGGCAAGGCAATGGCCAAGCTCAGCAGGCTCCCTGCCGAGGGCCCCACTCTCAGTGTGCCC
AGGGCGAGATGCGATGGCACCAGCTACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGA GCGGCGAAAA GGGGTCTGTT TTGGTGCTCG TGGCCTTTGC CGCTGCCATC CTCCTCCTGG GCGCGCAGGT GAAGCCGGCT GTTGCTGATG GCTATAACAC CGATATAGAG  GGCAAGGTGA GGGGTATAGT GAATGCCAGA ATCTACGACG CCCCTGGACT CATCCGGCTC GTGTTCCACG ACTGCTGGGT AAAGGGTTGC GATGCATCCG TGTTGCTGAA GAGAGCTGAT  GGGCTGGCAG AGATGGACGC GGTCCAGAAC GGCGGACTCC GGGGCCTGGA CGTGATCCAG GCCATCAAGG ACGCGCTCAC CAAGGACTAC CCGGCCGTCA CCTGCGCCGA CGCAGTTGTC  TACGCGGCGC GCGAGGCGTG CTACATCCTT AGCTACGGCA AGATCGCGTA CCCCGTGGAC GGGCCGGGCT ACCACAAGGA CGCCGTCGGC TCGTTCAAGG ACGACGCGGC GGCGCTCCCG  CCGCCCTTCG GACCCTCGTC CAGCTTCAAG AACCTCACCA AGAACTTCGG CGGCAAGCCG GGCTTCGGTG CCGGTGATCT CGTAATCCTC TCTGGCGCGC ACGCCGTCGG CCTGGCCCAC  CGCCCGGCCT TTGTAGACCG CCTGGACCTG CAGGTCGCGG CCCGTGGCGA GATCGACGTC CTTTACCAGA AAAAGATCGA TCAGGTGTCG AATGCAAGCC CGGCGAAGGC GATCCACAAC  AACGTCCGCG ACATCGACCA ACCTGAGACG GTGCCTGGCG TCCTGGACAA CAGCTACTAC GCCGCCAACC TCGGTAAGAA GGTGCTCTTC AACTCCGACT GGGCGCTCAT CACGGACCCG  GCCGCGCGGG GACAAATGGA AAGGTTCGAG AAATTCCCCG GCGACTGGTA CGACCTCTTC GGCAAGGCAA TGGCCAAGCT CAGCAGGCTC CCTGCCGAGG GCCCCACTCT CAGTGTGCCC  AGGGCGAGAT GCGATGGCAC CAGCTACTAG GAGAGATCCA ACGACACGTA CGCACGGCCC GCCCAAGCGC CAACATTTGA ACAAGACATG CATTGCTTGC ATGCACATTG ATTTATTCGT  TACTTTACCT ATCATGTTTG TCAATTATTG TTTAATTTAC TTATGCTAGT ACTAATAATT GTACCTTTTT TTGCTTGCCC TGCTTTTGTA ATACATATGC ATGTTCTGAA AGTTATGTTG 
TCCTACATAT GTAATCCACG CCGTAAACGC TTTGAAATAA CATGACCATT CAATTTGCCT TTTGGAA 

Retrieve as FASTA