Entry information : BdiPrx91 (Bradi2g40590)
Entry ID 7869
Creation 2011-01-14 (Toky Ramarohetra)
Last sequence changes 2011-01-14 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx91 (Bradi2g40590)
Name (synonym) BdiPrx91 (Bradi2g40590)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx91
start..stop
S start..stop
HvPrx95 581 0 30..332 35..337
SiPrx16 579 0 3..331 2..336
OsPrx17 576 0 7..332 1..335
SofPrx02 574 0 27..332 35..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 40884442..40884858 417 N° 2 40885656..40885821 166 N° 3 40886183..40886598 416  
join(40884442..40884858,40885656..40885821,40886183..40886598)


exon

Literature and cross-references BdiPrx91 (Bradi2g40590)
DNA ref. Phytozome 12:   Bd2 (40884442..40886598)
Protein sequence: BdiPrx91 (Bradi2g40590)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (304)
PWM (Da):   %s   35502.82 (32623.5)  
PI (pH):   %s   8.16 (7.77) Peptide Signal:   %s   cut: 29 range:29-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRKGGAMTMMMMMVAVALVFSCVSSASAQLDPHFYSHSCPQAQQIVASIVGKAHYQDPRMAASLLRLHFHDCFVKGCDASILLDSTASLASEKRSVPNKDSARGFEVVDEIKAALEAACPRTVSCADVLALAARDSTVMTGGPGWIVPLGRRDSLGASIQGSNNDIPAPNNTLPTIITKFKLQGLDIVDLVALLGSHTIGDSRCTSFRQRLYNQTGNGVPDLTLDASAAAVLRQRCPRSGGDQNLFFLDHVTPFKFDNQYYKNLLANKGVLSSDQVLLTGSPATADLVKLYAANQDIFFQHFAQSMVKMGNVSPLTGASGEVRTNCRSVNHN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, introns 2 and 3), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGAAGGGTGGCGCGATGACGATGATGATGATGATGGTTGCCGTCGCCCTTGTGTTCTCTTGCGTCTCCTCTGCTTCCGCGCAGCTGGACCCGCACTTCTACTCGCACTCGTGCCCG
CAGGCGCAGCAGATCGTGGCGTCCATCGTGGGCAAGGCGCACTACCAGGACCCGCGCATGGCGGCGTCCCTCCTCCGGCTCCACTTCCACGACTGCTTCGTCAAGGGCTGCGACGCCTCC
ATCCTCCTCGACAGCACCGCGTCGCTGGCGAGCGAGAAGCGGTCCGTCCCCAACAAGGACTCGGCCAGAGGGTTCGAGGTGGTGGATGAGATCAAGGCCGCCCTCGAGGCTGCTTGCCCC
CGCACCGTCTCCTGCGCCGACGTCCTCGCCCTCGCCGCCCGCGACTCCACCGTCATG
GTACGTTATTATTACCATCTATCTATATATGCTTTCTTATCTTGTTTGTCAGAAGAAATGCTA
TTATGAGTGTACACACGTACGAGCTAGCTAGCTAGCTATACACATGGTAAAAGAAAACCCGGGCCACCTTTGTCTTTGTCTTGAGTTAGAGTGTAAAACTGTCGAGTCGAGGACAAAGTA
ACTATACTACTCAAACAAGACACAAAGTGGGGGCACATTGCTCGGTAAAGCAGAGGCAAAGCTATCGCGGTACAATACAAAGGTGCATGTGCATGACATGCCACGGGATAATTAAGGACT
GACACGGTAAAAAGGTGCATGCTCTCTGTTATTTTAAATTTTAGGCTAAACAAACCTACTCCACTAAAGTTTTCATCAGGAAATTAACGGCGGGAGCTTAATTAGAAAAATGACGTTCAG
CGTTTGGAGAGTCTTTGGACTGAAACACGCTTATCGTACTGTCCAATTCCATGATCCACTCCTTTACAGAAAACACTCGAGCATTAATAATTGTTCACTTATCTTCGATATATATCTCCG
GTCCCGGCCCGTGCTAAGTTTGTGGGGTCATTTAGGCTCGAGCAAAAAGAGAAAAACAAATGATTATATGAGAGGAACCTTTTTACTGCTAGATTTTGGTTACAACGCAAAGATGCTCGG
TGTGCCCACTCACAGTCAAAGTGGGGGCTCTCCTCAAATCACAATCAAATCTGTTTAACAATTCCCTGACTTACATTTTCGTTGCTATTTGTTATGATGGTTTGTACTTACTATGGAAAA
TAAATCTTTGACAGACCGGTGGGCCAGGGTGGATCGTGCCGCTAGGCAGGAGGGACTCTCTGGGCGCCAGCATCCAGGGCTCCAACAACGACATCCCTGCCCCCAACAACACCCTCCCCA
CCATCATTACCAAGTTCAAGCTCCAGGGCCTTGACATCGTTGACCTCGTCGCTCTCCTCG
GTACGTAGCACATACATACGTACATACTCCTACCGACAGTGTTAATCCGTGCATGCAGTG
CGTGGTACCACGCGTATATGTGACATCTCGGCCGACCGATCATTAACTTGGCTACGTACCGACACGTCCATTTTTAAGCTAGCTAGCGAGGTCGCCCGCACGGCTGATATATAATTGGTA
CGAAGCCTAGCTCGAGCGAGCCCCGGGATTCATGCATCCACCCTACCGTAGCATGTCACATCTTGGCTGCACTTACAAAACAAAGCACATGGTGTGGAAAATAGGGCTGCTGCTGCGTGC
TGCACACATTGTTCCAAAAGCAATTGCCAGACAAATCCTCACATAATCTTACTTTGTACAGGTAGCCACACGATCGGCGACTCCCGGTGCACGAGCTTCCGGCAGCGGCTGTACAACCAG
ACGGGCAACGGCGTCCCGGACTTGACGCTGGACGCGTCGGCGGCCGCGGTGCTGCGGCAACGGTGCCCGCGGTCCGGTGGCGACCAGAACCTCTTCTTCCTGGACCACGTGACCCCCTTC
AAGTTCGACAACCAGTACTACAAGAACCTGCTGGCCAACAAGGGCGTGCTCAGCTCCGACCAGGTGCTCCTCACCGGCAGCCCCGCCACGGCGGACCTCGTGAAGCTCTACGCCGCCAAC
CAGGACATCTTCTTCCAGCACTTTGCTCAGTCCATGGTCAAGATGGGCAACGTCTCGCCGCTCACCGGCGCCAGCGGCGAGGTCAGGACCAACTGCAGGAGTGTCAACCACAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGAAGGGTGGCGCGATGACGATGATGATGATGATGGTTGCCGTCGCCCTTGTGTTCTCTTGCGTCTCCTCTGCTTCCGCGCAGCTGGACCCGCACTTCTACTCGCACTCGTGCCCG
CAGGCGCAGCAGATCGTGGCGTCCATCGTGGGCAAGGCGCACTACCAGGACCCGCGCATGGCGGCGTCCCTCCTCCGGCTCCACTTCCACGACTGCTTCGTCAAGGGCTGCGACGCCTCC
ATCCTCCTCGACAGCACCGCGTCGCTGGCGAGCGAGAAGCGGTCCGTCCCCAACAAGGACTCGGCCAGAGGGTTCGAGGTGGTGGATGAGATCAAGGCCGCCCTCGAGGCTGCTTGCCCC
CGCACCGTCTCCTGCGCCGACGTCCTCGCCCTCGCCGCCCGCGACTCCACCGTCATG
ACCGGTGGGCCAGGGTGGATCGTGCCGCTAGGCAGGAGGGACTCTCTGGGCGCCAGCATCCAG
GGCTCCAACAACGACATCCCTGCCCCCAACAACACCCTCCCCACCATCATTACCAAGTTCAAGCTCCAGGGCCTTGACATCGTTGACCTCGTCGCTCTCCTCG
GTAGCCACACGATCGGC
GACTCCCGGTGCACGAGCTTCCGGCAGCGGCTGTACAACCAGACGGGCAACGGCGTCCCGGACTTGACGCTGGACGCGTCGGCGGCCGCGGTGCTGCGGCAACGGTGCCCGCGGTCCGGT
GGCGACCAGAACCTCTTCTTCCTGGACCACGTGACCCCCTTCAAGTTCGACAACCAGTACTACAAGAACCTGCTGGCCAACAAGGGCGTGCTCAGCTCCGACCAGGTGCTCCTCACCGGC
AGCCCCGCCACGGCGGACCTCGTGAAGCTCTACGCCGCCAACCAGGACATCTTCTTCCAGCACTTTGCTCAGTCCATGGTCAAGATGGGCAACGTCTCGCCGCTCACCGGCGCCAGCGGC
GAGGTCAGGACCAACTGCAGGAGTGTCAACCACAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGAAGG GTGGCGCGAT GACGATGATG ATGATGATGG TTGCCGTCGC CCTTGTGTTC TCTTGCGTCT CCTCTGCTTC CGCGCAGCTG GACCCGCACT TCTACTCGCA CTCGTGCCCG  CAGGCGCAGC AGATCGTGGC GTCCATCGTG GGCAAGGCGC ACTACCAGGA CCCGCGCATG GCGGCGTCCC TCCTCCGGCT CCACTTCCAC GACTGCTTCG TCAAGGGCTG CGACGCCTCC  ATCCTCCTCG ACAGCACCGC GTCGCTGGCG AGCGAGAAGC GGTCCGTCCC CAACAAGGAC TCGGCCAGAG GGTTCGAGGT GGTGGATGAG ATCAAGGCCG CCCTCGAGGC TGCTTGCCCC  CGCACCGTCT CCTGCGCCGA CGTCCTCGCC CTCGCCGCCC GCGACTCCAC CGTCATGACC GGTGGGCCAG GGTGGATCGT GCCGCTAGGC AGGAGGGACT CTCTGGGCGC CAGCATCCAG  GGCTCCAACA ACGACATCCC TGCCCCCAAC AACACCCTCC CCACCATCAT TACCAAGTTC AAGCTCCAGG GCCTTGACAT CGTTGACCTC GTCGCTCTCC TCGGTAGCCA CACGATCGGC  GACTCCCGGT GCACGAGCTT CCGGCAGCGG CTGTACAACC AGACGGGCAA CGGCGTCCCG GACTTGACGC TGGACGCGTC GGCGGCCGCG GTGCTGCGGC AACGGTGCCC GCGGTCCGGT  GGCGACCAGA ACCTCTTCTT CCTGGACCAC GTGACCCCCT TCAAGTTCGA CAACCAGTAC TACAAGAACC TGCTGGCCAA CAAGGGCGTG CTCAGCTCCG ACCAGGTGCT CCTCACCGGC  AGCCCCGCCA CGGCGGACCT CGTGAAGCTC TACGCCGCCA ACCAGGACAT CTTCTTCCAG CACTTTGCTC AGTCCATGGT CAAGATGGGC AACGTCTCGC CGCTCACCGG CGCCAGCGGC  GAGGTCAGGA CCAACTGCAG GAGTGTCAAC CACAACTGAT CGCTCACTCC AAGTCGGCTG CTGGACTACT AGTACTTCTT TTCAGTCTGA TTGTTTCTGC TGGTTCATTG TTTGTCGATT  CGAGTCGGGT AGTGAGTGTG TTTTGCTGCG ATTTCTTTCT TGCTTCCGTT TTATTGTAGT ACGATTCGCC TTGTTGCCCA TGTGTTGTTT CCAGTGAAAT TATTGTGTTT TTTCTAGAGG  ATTTGATCTG TTCAGTGTGA CAAGACAGAA GCACATTGTT GGTTCCTGTC AGTTTCCGGC CAAGACAGTT TGGTTAACGA ATTGAAAGTT ATCTAGTTCG GTGTCGTCCT GTATTTTTTG 
TTGACCCGTA ACCGCATAGG GATGTTTTTT CT 

Retrieve as FASTA