Entry information : ZmPrx77
Entry ID 787
Creation 2005-12-05 (Christophe Dunand)
Last sequence changes 2005-12-05 (Christophe Dunand)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx77
Name ZmPrx77
Class Class III peroxidase    [Orthogroup: Prx152]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx77
start..stop
S start..stop
SbPrx113 573 0 22..336 26..338
SiPrx93 558 0 1..336 1..334
OsPrx69 501 1e-180 1..336 1..332
BdiPrx78 442 5e-157 5..336 3..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 129789679..129789918 240 N° 2 129788835..129789605 771  
complement(join(129788835..129789605,129789679..129789918))


exon

Literature and cross-references ZmPrx77
Literature Walbot,V., unpublished
Protein ref. UniProtKB:   B4FH35
DNA ref. GenBank:   AC192096.3 (148263..149343)
mRNA ref. GenBank:   BT036423
Cluster/Prediction ref. UniGene:   Zm.29873
Protein sequence: ZmPrx77
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (304)
PWM (Da):   %s   35576.17 (32273.5)  
PI (pH):   %s   9.86 (9.56) Peptide Signal:   %s   cut: 33 range:33-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSAKTRAGAAHVRRQLVAAVAVTVACFYSSEATQLQVGYYNGSCPAAESLIETIVHAAVRKDAGNGPGLIRLFFHDCFVRGCDASVLLDDPTGSPGNRTVEKTSPPNFPSLRGFSVISRAKRVVERRCPGTVSCADIVAFAARDAARIMGGIRFAMPSGRLDGRVSNASEATANLPPASFNLTQLLGRFASKNLSADDLVTLSGAHSIGRSHCSSFAPARLYPQLDPAMNATLGARLRARCPAGGGGRRDRVVDLDFATPLQLDNQYYRNVVTHEAVFSSDQALAGRNDTAALVALYAANRTLWSQRFAAAMVKMGSIEVLTGPPGEVRLKCNKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, intron 1), 3 mRNA and 22 ESTs. Cultivar="B73".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGCCAAGACCAGAGCTGGGGCCGCCCATGTACGCCGGCAGCTCGTCGCGGCCGTGGCGGTGACGGTGGCATGCTTCTACTCCTCGGAGGCGACGCAGCTGCAGGTGGGGTACTAC
AACGGCAGCTGCCCGGCCGCCGAGAGCCTCATCGAGACCATCGTCCACGCCGCCGTCCGCAAGGACGCCGGCAACGGGCCGGGCCTGATCCGGCTCTTCTTCCACGACTGCTTCGTCAGG
GTACGTAGGATTATTCGATGCCCAGCCCCAGCCCAATCGGACAATGCAATAATGCAACTGAGCTCCTTGACAGGGATGCGACGCGTCGGTGCTGCTGGACGACCCGACGGGCAGCCCGGG
GAACAGGACGGTGGAGAAGACGTCCCCGCCCAACTTCCCTAGCCTGCGCGGGTTCAGCGTGATCAGCCGCGCGAAGCGCGTGGTGGAGCGGCGGTGCCCCGGGACGGTGTCGTGCGCGGA
CATCGTGGCGTTCGCGGCGCGCGACGCGGCGCGCATCATGGGCGGCATCCGGTTCGCGATGCCGTCGGGGCGGCTGGACGGGCGCGTGTCGAACGCGTCGGAGGCCACGGCCAACCTGCC
GCCGGCGTCCTTCAACCTGACGCAGCTCCTGGGCCGCTTCGCGTCCAAGAACCTGAGCGCCGACGACCTGGTGACGCTGTCGGGGGCGCACTCCATCGGGCGCTCCCACTGCTCGTCCTT
CGCGCCCGCCAGGCTGTACCCGCAGCTGGACCCGGCGATGAACGCCACGCTGGGGGCGCGGCTCAGGGCGCGGTGCCCCGCCGGCGGCGGCGGGCGGCGCGACCGCGTCGTCGACCTCGA
CTTCGCCACGCCGCTGCAGCTGGACAACCAGTACTACCGCAACGTGGTGACGCACGAGGCCGTGTTCTCGTCGGACCAGGCGCTCGCGGGGCGCAACGACACGGCCGCGCTCGTGGCGCT
GTACGCCGCCAACCGCACGCTCTGGTCGCAGCGATTCGCCGCCGCCATGGTGAAGATGGGCAGCATCGAGGTGCTCACCGGGCCGCCCGGGGAGGTCAGGCTCAAGTGCAACAAGGTCAA
CTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGCCAAGACCAGAGCTGGGGCCGCCCATGTACGCCGGCAGCTCGTCGCGGCCGTGGCGGTGACGGTGGCATGCTTCTACTCCTCGGAGGCGACGCAGCTGCAGGTGGGGTACTAC
AACGGCAGCTGCCCGGCCGCCGAGAGCCTCATCGAGACCATCGTCCACGCCGCCGTCCGCAAGGACGCCGGCAACGGGCCGGGCCTGATCCGGCTCTTCTTCCACGACTGCTTCGTCAGG
GGATGCGACGCGTCGGTGCTGCTGGACGACCCGACGGGCAGCCCGGGGAACAGGACGGTGGAGAAGACGTCCCCGCCCAACTTCCCTAGCCTGCGCGGGTTCAGCGTGATCAGCCGCGCG
AAGCGCGTGGTGGAGCGGCGGTGCCCCGGGACGGTGTCGTGCGCGGACATCGTGGCGTTCGCGGCGCGCGACGCGGCGCGCATCATGGGCGGCATCCGGTTCGCGATGCCGTCGGGGCGG
CTGGACGGGCGCGTGTCGAACGCGTCGGAGGCCACGGCCAACCTGCCGCCGGCGTCCTTCAACCTGACGCAGCTCCTGGGCCGCTTCGCGTCCAAGAACCTGAGCGCCGACGACCTGGTG
ACGCTGTCGGGGGCGCACTCCATCGGGCGCTCCCACTGCTCGTCCTTCGCGCCCGCCAGGCTGTACCCGCAGCTGGACCCGGCGATGAACGCCACGCTGGGGGCGCGGCTCAGGGCGCGG
TGCCCCGCCGGCGGCGGCGGGCGGCGCGACCGCGTCGTCGACCTCGACTTCGCCACGCCGCTGCAGCTGGACAACCAGTACTACCGCAACGTGGTGACGCACGAGGCCGTGTTCTCGTCG
GACCAGGCGCTCGCGGGGCGCAACGACACGGCCGCGCTCGTGGCGCTGTACGCCGCCAACCGCACGCTCTGGTCGCAGCGATTCGCCGCCGCCATGGTGAAGATGGGCAGCATCGAGGTG
CTCACCGGGCCGCCCGGGGAGGTCAGGCTCAAGTGCAACAAGGTCAACTGA

Retrieve as FASTA