Entry information : BdiPrx93 (Bradi2g48050)
Entry ID 7871
Creation 2011-01-14 (Toky Ramarohetra)
Last sequence changes 2011-01-14 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx93 (Bradi2g48050)
Name (synonym) BdiPrx93 (Bradi2g48050)
Class Class III peroxidase    [Orthogroup: Prx024]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx93
start..stop
S start..stop
SiPrx22 546 0 8..358 8..363
OsPrx18 519 0 3..358 2..364
SbPrx78 483 3e-172 5..360 7..388
ZmPrx100 483 3e-172 5..358 7..377
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 48374248..48374562 315 N° 2 48374698..48375049 352 N° 3 48375140..48375555 416  
join(48374248..48374562,48374698..48375049,48375140..48375555)


exon

Literature and cross-references BdiPrx93 (Bradi2g48050)
DNA ref. Phytozome 11:   Bd2 (48374248..48375555)
Protein sequence: BdiPrx93 (Bradi2g48050)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360 (337)
PWM (Da):   %s   38509.97 (35982.6)  
PI (pH):   %s   6.51 (5.98) Peptide Signal:   %s   cut: 24 range:24-360
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPRRPVRGTICFLAISLLLCTDAGRPSYALQLLGDDEDADGGDGSTSFSFSSPQTTPGGLAFGFYDGTCPGAEETVASTVRELYAADSNVAAALVRLFFHDCFVHGCDASVLLGRANGATKSERDAAPNRSLRGFGAVDKIKARLEKECPETVSCADILALAARDSLVLVGGPSYPVLTGRRDSAGSFYRDVNVPPPNATYAMTLDSFARHGFTERETVALLGAHSIGKVQCRFFRDRIYNFAGTGEPDDSIDRDMVSEMRAVCGGDGRAPMEMGYYRQGREVGFGAHYYAKLLAGRGILRSDQQLTAGSTVRWVRMYASERGEEAFREDFAHAMVKLSALAPLTGSAGQVRITCSKPAV

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, introns 1 and 2), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCACGACGCCCGGTCCGGGGAACCATCTGCTTTCTCGCCATCTCGTTGCTCCTGTGCACAGACGCCGGCCGGCCCTCCTACGCGCTCCAGCTGCTTGGCGACGACGAGGACGCCGAC
GGCGGCGACGGCTCGACGTCCTTCTCCTTCTCCTCCCCTCAGACGACGCCTGGCGGTCTGGCGTTCGGGTTCTACGACGGGACGTGCCCCGGCGCCGAGGAGACCGTGGCGTCCACCGTG
CGGGAGCTCTACGCCGCGGACTCCAACGTCGCCGCCGCGCTCGTCCGCCTCTTCTTCCACGACTGCTTCGTCCAC
GTACGTATACGAACGCCGACACCCGTATGCTCCATCAAGATGTCT
TTTGCCTGCGCAAACGCGCGCTAGCTCACGTACGCACACGCCAAGACGCCGTGCTCTGTTTTCTTTCTCTGCCTCGGGCGCGCATTGCAGGGCTGCGACGCCTCGGTGCTCCTGGGCCGC
GCCAATGGCGCCACCAAGTCGGAGAGGGACGCCGCGCCGAACCGCTCGCTGCGAGGCTTCGGCGCCGTGGACAAGATCAAGGCGAGGCTGGAGAAGGAGTGCCCGGAGACGGTCTCCTGC
GCCGACATCCTGGCCCTCGCCGCGCGGGACAGCCTCGTGCTTGTGGGCGGGCCGAGCTACCCCGTGCTCACCGGCCGCCGGGACAGCGCCGGGAGCTTCTACCGCGACGTGAACGTCCCG
CCCCCCAACGCCACCTACGCGATGACGCTCGATTCCTTCGCGCGCCACGGCTTCACCGAGCGCGAGACCGTCGCTCTCCTAG
GTACGCCCGTTAAATCTTCGTCTATCCGTTGGATCGAG
CTCCGTCTATATTTTGTGTTTGGTTGATCCTTCTTAATTGGCCGGCTTGTAGGAGCACATAGCATCGGGAAGGTGCAGTGCCGGTTCTTCAGGGACAGGATCTACAACTTCGCCGGGACC
GGCGAGCCGGACGATTCCATCGACAGGGACATGGTCAGCGAGATGCGAGCCGTGTGCGGCGGCGACGGCAGGGCGCCGATGGAGATGGGGTACTACCGGCAGGGCCGGGAGGTTGGGTTC
GGCGCGCACTACTACGCGAAGCTTCTGGCGGGGCGCGGCATCCTGCGCTCGGACCAGCAGCTCACGGCGGGGAGCACCGTGCGGTGGGTGCGCATGTACGCGTCGGAGCGCGGCGAGGAG
GCTTTCCGCGAGGACTTCGCGCACGCCATGGTGAAGCTCTCCGCGCTTGCGCCGCTCACTGGGTCGGCCGGCCAGGTCCGCATTACCTGCTCCAAGCCCGCTGTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCACGACGCCCGGTCCGGGGAACCATCTGCTTTCTCGCCATCTCGTTGCTCCTGTGCACAGACGCCGGCCGGCCCTCCTACGCGCTCCAGCTGCTTGGCGACGACGAGGACGCCGAC
GGCGGCGACGGCTCGACGTCCTTCTCCTTCTCCTCCCCTCAGACGACGCCTGGCGGTCTGGCGTTCGGGTTCTACGACGGGACGTGCCCCGGCGCCGAGGAGACCGTGGCGTCCACCGTG
CGGGAGCTCTACGCCGCGGACTCCAACGTCGCCGCCGCGCTCGTCCGCCTCTTCTTCCACGACTGCTTCGTCCAC
GGCTGCGACGCCTCGGTGCTCCTGGGCCGCGCCAATGGCGCCACC
AAGTCGGAGAGGGACGCCGCGCCGAACCGCTCGCTGCGAGGCTTCGGCGCCGTGGACAAGATCAAGGCGAGGCTGGAGAAGGAGTGCCCGGAGACGGTCTCCTGCGCCGACATCCTGGCC
CTCGCCGCGCGGGACAGCCTCGTGCTTGTGGGCGGGCCGAGCTACCCCGTGCTCACCGGCCGCCGGGACAGCGCCGGGAGCTTCTACCGCGACGTGAACGTCCCGCCCCCCAACGCCACC
TACGCGATGACGCTCGATTCCTTCGCGCGCCACGGCTTCACCGAGCGCGAGACCGTCGCTCTCCTAG
GAGCACATAGCATCGGGAAGGTGCAGTGCCGGTTCTTCAGGGACAGGATCTAC
AACTTCGCCGGGACCGGCGAGCCGGACGATTCCATCGACAGGGACATGGTCAGCGAGATGCGAGCCGTGTGCGGCGGCGACGGCAGGGCGCCGATGGAGATGGGGTACTACCGGCAGGGC
CGGGAGGTTGGGTTCGGCGCGCACTACTACGCGAAGCTTCTGGCGGGGCGCGGCATCCTGCGCTCGGACCAGCAGCTCACGGCGGGGAGCACCGTGCGGTGGGTGCGCATGTACGCGTCG
GAGCGCGGCGAGGAGGCTTTCCGCGAGGACTTCGCGCACGCCATGGTGAAGCTCTCCGCGCTTGCGCCGCTCACTGGGTCGGCCGGCCAGGTCCGCATTACCTGCTCCAAGCCCGCTGTT
TGA

Retrieve as FASTA