Entry information : BdiPrx106 (Bradi3g29500)
Entry ID 7874
Creation 2011-01-14 (Toky Ramarohetra)
Last sequence changes 2011-01-14 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx106 (Bradi3g29500)
Name (synonym) BdiPrx106 (Bradi3g29500)
Class Class III peroxidase    [Orthogroup: Prx124]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx106
start..stop
S start..stop
SiPrx44 440 1e-156 4..331 3..320
SbPrx140 427 7e-152 6..331 1..317
OsPrx91 423 4e-150 9..331 8..319
OsPrx93 417 1e-147 6..331 4..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31583110..31583328 219 N° 2 31583426..31583623 198 N° 3 31583705..31583864 160 N° 4 31583950..31584368 419
join(31583110..31583328,31583426..31583623,31583705..31583864,31583950..31584368 )


exon

Literature and cross-references BdiPrx106 (Bradi3g29500)
DNA ref. Phytozome 12:   Bd3 (31583110..31584368)
Protein sequence: BdiPrx106 (Bradi3g29500)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (305)
PWM (Da):   %s   35117.11 (32330.6)  
PI (pH):   %s   5.21 (5.19) Peptide Signal:   %s   cut: 27 range:27-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTNERLRFLALLLASIAADLSLMATAQLRPDHYAGVCPDLESIVRGAVSRSMAHSPVAAPATLRLFFHDCAVRGCDASILLTRPDGGDEWRSPDGLTLKPEGFDTVMHAKDAVDGDPRCRHKVSCADVLALAARDAVYLSGGPNYEVELGRYDGTASTESSVTVPHGDFDLDRLNAFFSGLGLSQTDMIALSGAHTIGAAACNFFEYRVAVGNETAGDPAAAGMDAGFAARLRGACAGATNNRSGGFAFLDGATPTRFDNAYYENLRRGRGVLGSDQALHDDARSRGKVELYAGDEDAFFDDFAAAMMRLGRVGVRMAGNGEIRRDCRFPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 3 introns), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGAACGAGCGCCTCCGGTTCTTGGCCTTGCTCCTCGCATCCATCGCGGCTGATCTGTCGCTAATGGCGACCGCGCAGCTGAGGCCGGACCACTACGCCGGCGTCTGCCCCGACCTG
GAGAGCATTGTCCGCGGCGCCGTCAGCCGGTCCATGGCGCACTCGCCCGTCGCCGCGCCAGCCACGCTCAGGCTCTTCTTCCACGACTGCGCCGTCAGA
GTACGTGAGAAGAAGAGCTCT
ATTCATCATTCAGTCACCCATATTTTGTTCATGAATGATCGTCTGAAGTTGTTGGTGATCGATGATTTTGTTGCAGGGCTGTGACGCGTCGATCCTGCTGACGAGGCCGGACGGCGGCGA
TGAGTGGCGGAGCCCCGACGGGCTGACGCTGAAGCCGGAGGGGTTCGACACGGTGATGCACGCCAAGGACGCCGTCGACGGCGACCCGCGGTGCCGGCACAAGGTGTCGTGCGCCGACGT
GCTGGCACTGGCGGCCAGGGACGCCGTCTACCTG
GTAACCAATTAATCCCACGAACCCGCAGTCCCCATTTTCCTTCCACCAACGCGCGCCGCGGCCATTAATGCTTTGCTGCAGAGCGG
AGGGCCGAACTACGAGGTGGAGCTAGGCAGGTACGACGGCACGGCGTCCACCGAGAGCAGCGTCACCGTCCCGCACGGCGACTTCGACCTCGACCGCCTCAACGCCTTCTTCTCCGGCCT
CGGCCTCTCCCAGACCGACATGATCGCGCTCTCAG
GTTAATTTTACTTGCTCATAGGCAGCCGAGCTGAGCTGCAACACGGACTGAAAAACGGCACTGAGTTTAGCTTGGCCTGCGGCAG

GGGCGCACACGATCGGCGCGGCGGCGTGCAACTTCTTCGAGTACAGGGTCGCCGTGGGGAACGAGACGGCCGGCGACCCGGCCGCCGCGGGCATGGACGCCGGGTTCGCGGCGCGGCTGC
GGGGCGCCTGCGCCGGCGCTACGAACAACCGGAGCGGCGGGTTCGCGTTCCTCGACGGCGCGACGCCGACGCGGTTCGACAACGCCTACTACGAGAACCTGCGGCGCGGGCGGGGCGTCC
TGGGCTCCGACCAGGCGCTGCACGATGACGCGAGGTCCCGCGGCAAGGTCGAGCTCTACGCCGGCGACGAGGACGCCTTCTTCGACGACTTCGCGGCGGCGATGATGAGGCTCGGGAGGG
TCGGGGTCAGGATGGCCGGCAACGGGGAGATACGCCGCGACTGCAGATTCCCCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGAACGAGCGCCTCCGGTTCTTGGCCTTGCTCCTCGCATCCATCGCGGCTGATCTGTCGCTAATGGCGACCGCGCAGCTGAGGCCGGACCACTACGCCGGCGTCTGCCCCGACCTG
GAGAGCATTGTCCGCGGCGCCGTCAGCCGGTCCATGGCGCACTCGCCCGTCGCCGCGCCAGCCACGCTCAGGCTCTTCTTCCACGACTGCGCCGTCAGA
GGCTGTGACGCGTCGATCCTG
CTGACGAGGCCGGACGGCGGCGATGAGTGGCGGAGCCCCGACGGGCTGACGCTGAAGCCGGAGGGGTTCGACACGGTGATGCACGCCAAGGACGCCGTCGACGGCGACCCGCGGTGCCGG
CACAAGGTGTCGTGCGCCGACGTGCTGGCACTGGCGGCCAGGGACGCCGTCTACCTG
AGCGGAGGGCCGAACTACGAGGTGGAGCTAGGCAGGTACGACGGCACGGCGTCCACCGAGAGC
AGCGTCACCGTCCCGCACGGCGACTTCGACCTCGACCGCCTCAACGCCTTCTTCTCCGGCCTCGGCCTCTCCCAGACCGACATGATCGCGCTCTCAG
GGGCGCACACGATCGGCGCGGCG
GCGTGCAACTTCTTCGAGTACAGGGTCGCCGTGGGGAACGAGACGGCCGGCGACCCGGCCGCCGCGGGCATGGACGCCGGGTTCGCGGCGCGGCTGCGGGGCGCCTGCGCCGGCGCTACG
AACAACCGGAGCGGCGGGTTCGCGTTCCTCGACGGCGCGACGCCGACGCGGTTCGACAACGCCTACTACGAGAACCTGCGGCGCGGGCGGGGCGTCCTGGGCTCCGACCAGGCGCTGCAC
GATGACGCGAGGTCCCGCGGCAAGGTCGAGCTCTACGCCGGCGACGAGGACGCCTTCTTCGACGACTTCGCGGCGGCGATGATGAGGCTCGGGAGGGTCGGGGTCAGGATGGCCGGCAAC
GGGGAGATACGCCGCGACTGCAGATTCCCCAACTGA

Retrieve as FASTA