Entry information : BdiAPx03 (Bradi3g42340)
Entry ID 7876
Creation 2011-01-14 (Toky Ramarohetra)
Last sequence changes 2011-01-14 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-01-19 (Toky Ramarohetra (Scipio))
Peroxidase information: BdiAPx03 (Bradi3g42340)
Name (synonym) BdiAPx03 (Bradi3g42340)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiAPx03
start..stop
S start..stop
ScAPx04 528 0 1..288 1..289
TaAPx06 525 0 1..288 1..289
HvAPx01 520 0 1..288 1..289
SbAPx04 515 0 1..288 1..287
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 44005222..44005334 113 N° 2 44006674..44006798 125 N° 3 44007271..44007320 50 N° 4 44007470..44007535 66
N° 5 44007617..44007665 49 N° 6 44007797..44007879 83 N° 7 44007957..44008036 80 N° 8 44008137..44008239 103
N° 9 44008353..44008553 201  
join(44005222..44005334,44006674..44006798,44007271..44007320,44007470..44007535 ,44007617..44007665,44007797..44007879,44007957..44008036,44008137..44008239,440 08353..44008553)


exon

Literature and cross-references BdiAPx03 (Bradi3g42340)
DNA ref. Phytozome 11:   Bd3 (44005222..44008553)
Protein sequence: BdiAPx03 (Bradi3g42340)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   289
PWM (Da):   %s   31395.26 Transmb domain:   %s   o261-283i
PI (pH):   %s   7.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVPVVDAEYLRQVDRARRALRALIASKGCAPIMLRLAWHDAGTYDVNTRTGGANGSIRHEEEYNHGSNAGLKIAIDLDPIKAKYPKVTYADLYLAGVVAVEVTGGPTVEFIPGRRDSSVCPREGRLPDAKKGAPHLRDIFYRMGLTDKDIVALSGGHCGKAHPERSGFEGAWTRDPLKFDNSYFVELLKGESEGLLKLPTDKALLDDPEFRRYVDLYADEDAFFKDYAESHKKLSELGFTPRSGSTSTKSDLPTAVILAQSAVGVAVAAAVVIAGYLYEASKKK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 8 introns), 7 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTCCCGGTGGTGGACGCCGAGTACCTGCGCCAGGTCGACAGGGCGCGCCGCGCGCTCCGCGCTCTCATCGCCTCCAAGGGATGCGCCCCCATCATGCTCCGCCTCGCGTACGTA
CTCCCCCAGCCCCCGTCCCCTGCCATTTCACCACCTCCTGCTACTTCCTGTATCTGCTCGACTGATCGCACACGCCTAGTTCACGTTGCTCGAGGGCTCGTGTTTTTTCCTTCTTCTTTG
CTTGTTAAGTCGAGGAGCGATTTACCTACCGGCGTGGTTCTGGTACCGAGTTGAGTCGCGTGCCAGATTCGGGCTCCCTGGTTTGATGGTTGCTGGGCGACCGCGAGCCTGGTGTGACTA
TGGTTGCCCGTTTTGGGCGAGGAAATTCGACAAACACCGTATGTGCGTGCCTCTGGAGCTTCAGAGTTCGAACGGTTCCTAATTTTTGGTCGCGTGGTTACGGTTGTGGACCCTGGCAGC
AAGAGGTGGCTATTTAGTTCACTTGTAGACCATAGTCTTTTGTTCATGCGTTGCTTTCTCGTGTTACTTGTAAGAGGAAAGGAGATGTGTCATGTGTTCCATGTATAGTGGCAGGGGAAT
TGGTTGTTACTTGTAAGAGGAAAGGAGCAATCACTGGTATCAAATTCCACATGCAAATATAGTTGCAGAATCTAGTACTCCCTCTGTCCAACAAAGGATGTCTCAACTTTGATCAAATTT
GAATGCATTTATACACTAAGTCATGTCTAGAACTCTAGATACATCCAAATTTTGACAAACTCGAGACATCTTTTGTTGGACGGAGGAAGTATATGATCTCGGTTTCGCCTGAGGACAATT
CAACAAACACTTGTGTGCGTATCTTTGGAGCTCCACACGGCTCCCAATTTTTTGGTTGCGTGGTTACGGCTGTGGACCCTAGGAAGAAGATACGGTTGTTTGTCCACATGTAGACTATAG
ACTTCTGTTCATACGTTGCTTTCTCGTGTTGGTGAACTGAACTGGGGGGAGATGTGTCATGTGCCATGTGTTCCATGTACAGCAGCAGGCGAAACTGTTGTTACTTGTAAGTGGAAAGGG
GCAATCATCGGTTCCCCAATTCCGTCTGCAAACGTTGTTGCATAATCGGGTTAAGCTGACACGAATTGCCTGTTCTAAGGCTTCCACTCCTTGAACTTTCCTGCACATGTGTGGCGTTTT
CAGAGAGATATATGCTTGTATATAGTATATGCACTGTATTTACTGTTTGATTTGTTGCAGGAATGCTGGTATACACCGGGTTCCTATGTGTGGTTCCCGTTTCCCTGGTTTGATGCTTGT
ATAGATCTAATTAGTAATACCTAGATAAAGCTGCCTCTAACTTCCATTTTCTGCTTGTGTGGTTCCCATTCGTGTCACTTCTAGACTTCCTTCCTTTTCTTTATGCGCAAGTCTCTTCAC
TCTCCCTTGCAGATGGCATGATGCTGGCACGTATGATGTGAATACAAGAACTGGTGGCGCAAATGGTTCAATTAGGCATGAGGAAGAGTACAACCATGGTTCAAATGCTGGTCTAAAAAT
TGCAATTGATCTCCTTG
GTATGTATCATTTATATCCAAACATGCCCATTGCTTGTATATGGCTGTCCAAACTTACTCTTTCCTTTATGAGAAGGACTCTTTAAGCTAAGTATCAAATCGG
TTTGAGCTTTCTTGTTAGTTTCCCCAAGTTCATATTCTTTCTATCACTGTTGGTTTCTGCAATAGCTTGAAGACAAGACTGTAACTGATTTTATGGCAAGTTAAACAATTTAGGATCATA
CACACGAAACTAACAGTGCGCTAGTGCAGCCTTGTAACTTCGTTACACTATGCTGCATTATTCACATCGCCACATGTACAAGTGGGAGATATTTTATCTGCTGAGTAACTATCCATGGCC
TTGCAACTCTGTGTCTAATAATATTCTGCAATCACATGATTTACTCATTTCAGTTTTGCTAAGTTTGTTATGCTGTTCCTTGCTTCATGCTGAATGAATCATAATAACTTATTCAACTGT
CATTTACAGATCCTATTAAAGCAAAGTATCCAAAGGTTACATACGCAGACCTTTATCAGGTAATTTTTTTTATTTGCACGAGTTGGCTCTAAGCAAACACTGATTACTAGGACGACAATA
CTTGCACATTGGAGCTGTTGCTTCCTATTGTGTACTGTGAAATCTATACTCATATAGTACTTATTTGCTAACTAGATTTTACTTGCAGCTTGCTGGAGTCGTTGCAGTTGAAGTCACTGG
GGGTCCAACTGTTGAGTTCATTCCTGGAAGACGT
GTATGTGAAACATCATTTCTGTATAAATGGATGCATTATTCCTGATGCTCACATATTATTAATGTTTTCGACCTGAGTTAGGATTC
TTCGGTTTGCCCTCGTGAAGGTCGTCTTCCTGATGCTAAGAAAG
GTCACTACTGCAAACTATTCTCTCTACTGGCCAATTTATTCAAGTGTTTACGTTTGTTACTGCTTAGTTTCTGTAT
CTTATAATCATATGTCTATTGCTGAGAGATAAATCTGTTTTTTTGTCATGAGTAGGTGCACCACATCTAAGGGACATCTTTTATCGCATGGGCTTGACAGATAAAGATATCGTAGCTCTA
TCTGGGGGGCACTGTCTG
GTACTTGTTGTATTCTGTGAAGTAAAAGCACACATGATCAGAAAGGCAGTATTTAATACTGGAGTTTGTTCTCTTAGGGAAAGGCGCATCCTGAAAGGTCTG
GGTTCGAAGGTGCATGGACTCGTGATCCTCTGAAGTTTGACAACTCATACTTTGT
GTAAGTTTAACGCAAAGCCATGAACATCTATTTTTGTTTCGGAGGCTCGATCTGAGAAGAATATC
AGTGTAAAGTTGTTTGCTTTTTAACCTCACTGCAGTGAGCTACTGAAGGGGGAATCTGAGGGGCTTCTGAAGCTCCCTACTGATAAGGCATTGTTGGATGATCCTGAATTTAGACGCTAT
GTGGATCTTTATGCAAAG
GTGCACCTGAATTTTGTTATTCTTAAATTTCATGCAGCTGACACTATCATGCTAGTAGCACCTACAAGTTTCAGAATTCAGATTCAGAACAATGCCTATTTT
CTGTGTTGCAGGATGAGGACGCCTTCTTCAAGGACTATGCGGAATCACACAAGAAACTTTCTGAACTTGGCTTCACTCCACGCAGCGGTAGCACATCTACAAAATCAGATCTTCCAACTG
CTGTTATACTCGCACAGAGTGCCGTCGGGGTAGCAGTTGCTGCAGCTGTAGTCATCGCTGGCTACCTGTACGAGGCTTCCAAGAAGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTCCCGGTGGTGGACGCCGAGTACCTGCGCCAGGTCGACAGGGCGCGCCGCGCGCTCCGCGCTCTCATCGCCTCCAAGGGATGCGCCCCCATCATGCTCCGCCTCGCATGGCAT
GATGCTGGCACGTATGATGTGAATACAAGAACTGGTGGCGCAAATGGTTCAATTAGGCATGAGGAAGAGTACAACCATGGTTCAAATGCTGGTCTAAAAATTGCAATTGATCTCCTTG
AT
CCTATTAAAGCAAAGTATCCAAAGGTTACATACGCAGACCTTTATCAG
CTTGCTGGAGTCGTTGCAGTTGAAGTCACTGGGGGTCCAACTGTTGAGTTCATTCCTGGAAGACGTGATTCT
TCGGTTTGCCCTCGTGAAGGTCGTCTTCCTGATGCTAAGAAAG
GTGCACCACATCTAAGGGACATCTTTTATCGCATGGGCTTGACAGATAAAGATATCGTAGCTCTATCTGGGGGGCAC
TGTCTG
GGAAAGGCGCATCCTGAAAGGTCTGGGTTCGAAGGTGCATGGACTCGTGATCCTCTGAAGTTTGACAACTCATACTTTGTTGAGCTACTGAAGGGGGAATCTGAGGGGCTTCTG
AAGCTCCCTACTGATAAGGCATTGTTGGATGATCCTGAATTTAGACGCTATGTGGATCTTTATGCAAAG
GATGAGGACGCCTTCTTCAAGGACTATGCGGAATCACACAAGAAACTTTCT
GAACTTGGCTTCACTCCACGCAGCGGTAGCACATCTACAAAATCAGATCTTCCAACTGCTGTTATACTCGCACAGAGTGCCGTCGGGGTAGCAGTTGCTGCAGCTGTAGTCATCGCTGGC
TACCTGTACGAGGCTTCCAAGAAGAAGTAA

Retrieve as FASTA