Entry information : BdiAPx04 (Bradi3g45700)
Entry ID 7878
Creation 2011-01-14 (Toky Ramarohetra)
Last sequence changes 2011-01-14 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-01-19 (Toky Ramarohetra (Scipio))
Peroxidase information: BdiAPx04 (Bradi3g45700)
Name (synonym) BdiAPx04 (Bradi3g45700)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue types Flowers
Spikes
Inducers Abiotic stress
Drought
Repressor N/D
Best BLASTp hits
Perox score E-value BdiAPx04
start..stop
S start..stop
TaAPx01-1A 738 0 40..440 29..431
HvAPx07 730 0 1..440 1..446
TaAPx01_C306 729 0 26..440 31..443
ZmAPx08 694 0 1..440 1..451
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 47703875..47704033 159 N° 2 47703652..47703795 144 N° 3 47702225..47702345 121 N° 4 47702020..47702120 101
N° 5 47701829..47701916 88 N° 6 47701624..47701691 68 N° 7 47701450..47701536 87 N° 8 47700845..47700919 75
N° 9 47700685..47700762 78 N° 10 47700483..47700587 105 N° 11 47700105..47700248 144 N° 12 47699865..47700017 153
complement(join(47699865..47700017,47700105..47700248,47700483..47700587,4770068 5..47700762,47700845..47700919,47701450..47701536,47701624..47701691,47701829..4 7701916,47702020..47702120,47702225..47702345,47703652..47703795,47703875..47704 033))


exon

Literature and cross-references BdiAPx04 (Bradi3g45700)
Literature Lucas,S., Rokhsar,D., Wang,M., Lindquist,E.A., Fox,S.E., Vogel,J., Bragg,J.N., McKenzie,N., Bevan,M.W., Garvin,D., Michael,T., Hazen
,S., Chang,J., Laudencia-Chingcuanco,D., Weng,Y. and Mockler,T.
DOE Joint Genome Institute Brachypodium distachyon EST project.
Unpublished (2009).
DNA ref. Phytozome 11:   Bd3 (47704033..47699865)
Protein sequence: BdiAPx04 (Bradi3g45700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   440
PWM (Da):   %s   47344.86 Transmb domain:   %s   o420-439i
PI (pH):   %s   5.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAERLASSASLLPASPSPSTRRAAAAAVASFPSCSGSARTGLRLRPSPSRFSQKAAGRGRGGAGGGLRVVRCMAASDAGQLKSAREDIKEILKTNYCHPILIRLGWHDSGTYDKNIEEWPLRGGADGSLRFDPELSHGANAGLTSALKLIQPIKDKYPGITYADLFQLASATAVEAGGPKIPMKYGRADITSPEQCPPEGRLPDAGPRIPAEHLREVFYRMGLDDEIVALSGAHTLGRSRPDRSGWGKSETKYTKDGPGEPGGQSWTAEWLKFDNSYFKDIKEQRDQDLLVLPTDAALFEDPSFKVYAEKYAEDQEAFFKDYAEAHAKLSNLGAKFDPPEGISLDDDKGDAPVEEKKVADADPAPADDNNGAASQPEPFVAAKYSYKKTELSDTMKQKIRAEYEGLGGSPEKALQSNYFLNIMIVIAGLAFLTSLLGS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 11 introns), 9 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAGCGCCTCGCCTCCTCGGCCTCCCTCCTCCCGGCCTCGCCTTCCCCGTCCACCCGCCGCGCCGCGGCAGCGGCCGTCGCCTCCTTCCCCTCCTGCTCCGGCTCCGCCCGCACC
GGGCTCCGCCTCCGTCCGTCGCCCTCGCGCTTCTCGCAG
GTCGGGTTCGATTTTTGTTTAGCATTCTAGCTTGATTGCGCCTACATCTGCTATCTGCTTACGTGGGAGTGAACTGCAGAA
GGCTGCGGGGAGAGGCCGCGGTGGCGCCGGCGGGGGGCTGCGGGTGGTCCGGTGCATGGCGGCGTCGGACGCCGGGCAGCTCAAGAGCGCGCGGGAGGACATCAAGGAGATCCTCAAGAC
CAATTACTGCCATCCCATCCTG
GTATGGATGTCCTACTATTCAGTGCTCTTCTTAATTATAATCTCTAGGCTAAGTTAACGTAGGTGGTAAATCAATTCCAGTCGTGAATTGTTGATGCC
ACATTGCTGCAAATTATGATCGCCAGACTGTAACACGTCGAAGTGTGCAGTTCGGGTTTGTCACTGTTAGCCGCTCATTCTTAACTTTAGTTTTTAGATACTCCCAGTTTGAATCGAATC
GCTTTTCTTGTGGGCTGCCGTGTCGTTTTCACACAATGTAAGATGCATGGGTTGTGGGCAGAGTAGAAAAAATAAGTTGCTCACAAGGAAAATGAAAGAAATCTCCCCTAATTGCTATGT
GACCTGTGCGATGCTACCTACTCCACTATTTTTTTGTAAGTTTAAAATAATGTTATTTATAGGTTGATAATTATCCTTTTAAACCTTGAAACGCATCTTTTCCTTGTAATTTCATGTCTT
TTCTGATCAGCCCTAGTTGTTCATATTTTCAACTTTTCAAGAAATGTGTCATGGAACAATGCTAGAGCTATCGGTTATCTTGCATCTTGCAATCAGTGCTAGTCCATGATATTGTTCTTA
TGTTATCTTAGTTTATAGTTTCGTGAATGTAATAGGTGGTTGTTATGTTGCTAAGTGATGCATTGTTTGGCAACCATCGCAAAATATAGTGGTACCTGTGCAATATAGTCGAGAATTTTT
ATGGTACCCTGGTACTCCCCAGAAGGGGTCAGGAGTACCAAACAAATCTGTCCGTCCATCTGTTAGGGTAGTTTAGACCTTTTGCCTAGGATGATTTGGACTTTCACGAGCGCCTCCTGA
CTGCACACCGCGCCGCTGCCTGATCGATCGAACTCCATGCTCCATGTACGAGAGTACAGGACCGATCAAGTTTGCCATCAGTGGCTTGGGCTGACGGCAGGCTCGGCCGGCCGGCGTGCT
ACTGCTTGGACTAAATTTCCTAGATATCGGAGCCAAATCTCGCCACCTCAATACTGGCCGCCGTAATTAACTGCGCTAAGTCCGTCCATCCAGCACTTACCCGGTTATCCCCTGTTAATT
GACTTCGTAATTACGATTTTAGCCCCACAAACGACGGTACTCCCCATTATTGATCGATGGTACTCCCCGGTTGCTAGCTTGGAGTACAGATAAAATCTGTCCGTTAGATTAGAAGAAATT
AACGGCTTATTTTAGTTCGTGGGTACTGTAAAAGTGCTCATATAGTCAGGAGTCATCAATCATCATGACACTCTGGTCACACACACCCGTTGTTGTGTGCAGATGCTAATGCTTTCAACT
ATGTTCAGATCCGCTTGGGATGGCATGATTCTGGTACGTACGACAAAAATATTGAGGAGTGGCCACTGAGAGGCGGAGCGGATGGTAGCTTAAGGTTTGATCCTGAGCTGAGCCATGGAG
CCAATGCTG
GTATTTTGCCTTGACTCTTGACAGTTTCATATCATCAATCCTTGAATCTTCCAAACTCTGAAAGTGTAGAGTAATAGCTAATATATTTGGTTGTTTTTGGCCAGGTCTGAC
TAGCGCTTTAAAGCTTATTCAGCCAATCAAGGATAAATACCCAGGTATCACTTATGCAGATTTGTTCCAGTTGGCGAGTGCTACTGCAGTTGAG
GTCTCAGCCTTTTTCTCTGTTCACGT
ATTTTTACTAGGCCATTTTGACAGAGGATCAGTAGAGTGTATATATGTGCTAATATGTCTTGTCAATCTCATTCCAGGAAGCTGGTGGCCCGAAAATTCCGATGAAATATGGACGGGCAG
ATATCACATCACCTGAGCAATGTCCACCTGAAGGGAGGCTTCCTG
GTTAGTGCTTCGGACAAGCTCGTCATTCCACAGTGATTTCTCCTTCCATGTTTCGATCGATTTCTGATGTTATGA
TCTGTGAGAGGTACTTATCAAGATGTATAAATTGGTTGCTGCTGAATATGCACATTCCGCAGATGCTGGCCCACGTATACCTGCTGAGCACCTTAGGGAGGTCTTCTATAGAATGGGCCT
TGATGACAAG
GTGTGGGATCATGCCAGAAACTGGAACTTTCCCTTTCGGCCTGTTTGTGCTTGAGCTGTGTTGTTGATCCCTTGGAGTATTGTGCAGGAAATTGTTGCACTATCCGGAGC
ACATACACTTGGAAGATCAAGGCCTGACCGGAGTGGCTGGGGAAAGTCAGAAACAAAATATACA
GTATGTTTTTCTGGGTCTCTTTATCGGGTTTAAAGCTGCAGGGCATTAATTTATTT
TTTGTAATATGAGTGAAAAATGTCAGTCCCATACAGCGTTTACTACTGTACATGTGGGTATAGACTATAGACCCACAACTGCTCTTTCGAGACCTGTGGGGATTCTGCATATCCTATAAT
CGAGTTGGAAAGAAATGCACAGTGTTGCTATAATTTTTCTATTTAAAAACCACAATGTGCTTAGAAGCCTCATGGCACACAAAACCAAACCCCCCTGAAATCCTAACCTCCTAGCTTCTC
CCTTTGGTTTTTAGTTCGTTAGGAGTTTTCTGTTAGTTTTGGTTTTGGTTGCCTGGTCACCACCACTCTTCTGGCACACATTTAGAGGCTTGAAGAAAAATAAAAAAGAATGTTGTGTTT
TCAAAATCTTTGAGTCCTTGATCTTACTTGGATGTGATCATGTGATTAATTTGAACTGACGGTCGATCGGTGATCATCTGAGAAAACTAAGCTGTTCTGCTATTGTGTGTACAGAAGGAT
GGGCCCGGTGAACCTGGAGGTCAGTCATGGACAGCTGAATGGTTGAAGTTTGACAACAGTTATTTCAAG
GTGTGTTCCATTTTCTTCAAGACTTGCGAGTTAAATTATTCATTTGAGTCT
CGGATGGTTCGAACGGTTAACAATGTTTCAGGACATAAAAGAGCAAAGGGATCAGGATCTTCTAGTATTGCCTACAGATGCTGCATTATTTGAGGACCCATCATTCAAGGTATACCTGAT
TATGCTTAATTTGTGACTGGTGAGGATGCTATGAAACGGTGGTACTTCTAGTTGAATCTGAGAATCTGAAACACGCATGCACGCAGGTATATGCAGAGAAGTACGCAGAAGACCAAGAGG
CATTCTTCAAAGACTACGCTGAAGCCCATGCTAAACTCAGCAACCTTGGTGCAAAGTTTGATCCTCCTGAG
GTGAACCCTGTTTAGGGCCTGTTTGGTTGTTTGCCATATTTGGGGGTTC
TTGTCAAACTTACCTAATAAGGGAGACTTTGCCAAATGGAGCAAAATCACCAGGAAGGCAATCCAGTTCTTTAGCTCTTCCAGCATATGCCATGCTTGCTTGCTCGTCCTATTTTCAGTG
TTCAGTTTTGCGTAGCTGCTCAAGTTCTTGTAAAACCTAACGTGTGGTTTGATAATATCATGCAGGGAATCTCGTTGGACGATGACAAGGGTGACGCCCCGGTGGAGGAGAAGAAGGTTG
CTGATGCTGATCCAGCACCAGCAGATGATAACAATGGAGCAGCGTCGCAGCCAGAACCCTTCGTTGCCGCCAAATACTCCTACAAAAAG
GTTTGCACTTGTACAATCCAGGCCCAGCTGG
ATGCTAAACGTAAGGAAGTAGGATGCTGAGAAACTGCCTGCTCCGTGAAATTGCAGACGGAGCTGTCGGACACGATGAAGCAGAAGATCAGGGCGGAGTACGAGGGGCTTGGAGGCAGCC
CGGAGAAGGCTCTGCAGTCTAACTACTTCCTCAACATTATGATCGTCATCGCAGGGCTGGCATTCTTGACATCTCTGCTCGGGAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAGCGCCTCGCCTCCTCGGCCTCCCTCCTCCCGGCCTCGCCTTCCCCGTCCACCCGCCGCGCCGCGGCAGCGGCCGTCGCCTCCTTCCCCTCCTGCTCCGGCTCCGCCCGCACC
GGGCTCCGCCTCCGTCCGTCGCCCTCGCGCTTCTCGCAG
AAGGCTGCGGGGAGAGGCCGCGGTGGCGCCGGCGGGGGGCTGCGGGTGGTCCGGTGCATGGCGGCGTCGGACGCCGGGCAG
CTCAAGAGCGCGCGGGAGGACATCAAGGAGATCCTCAAGACCAATTACTGCCATCCCATCCTG
ATCCGCTTGGGATGGCATGATTCTGGTACGTACGACAAAAATATTGAGGAGTGGCCA
CTGAGAGGCGGAGCGGATGGTAGCTTAAGGTTTGATCCTGAGCTGAGCCATGGAGCCAATGCTG
GTCTGACTAGCGCTTTAAAGCTTATTCAGCCAATCAAGGATAAATACCCAGGTATC
ACTTATGCAGATTTGTTCCAGTTGGCGAGTGCTACTGCAGTTGAG
GAAGCTGGTGGCCCGAAAATTCCGATGAAATATGGACGGGCAGATATCACATCACCTGAGCAATGTCCACCTGAA
GGGAGGCTTCCTG
ATGCTGGCCCACGTATACCTGCTGAGCACCTTAGGGAGGTCTTCTATAGAATGGGCCTTGATGACAAGGAAATTGTTGCACTATCCGGAGCACATACACTTGGAAGA
TCAAGGCCTGACCGGAGTGGCTGGGGAAAGTCAGAAACAAAATATACA
AAGGATGGGCCCGGTGAACCTGGAGGTCAGTCATGGACAGCTGAATGGTTGAAGTTTGACAACAGTTATTTC
AAG
GACATAAAAGAGCAAAGGGATCAGGATCTTCTAGTATTGCCTACAGATGCTGCATTATTTGAGGACCCATCATTCAAGGTATATGCAGAGAAGTACGCAGAAGACCAAGAGGCATTC
TTCAAAGACTACGCTGAAGCCCATGCTAAACTCAGCAACCTTGGTGCAAAGTTTGATCCTCCTGAG
GGAATCTCGTTGGACGATGACAAGGGTGACGCCCCGGTGGAGGAGAAGAAGGTT
GCTGATGCTGATCCAGCACCAGCAGATGATAACAATGGAGCAGCGTCGCAGCCAGAACCCTTCGTTGCCGCCAAATACTCCTACAAAAAG
ACGGAGCTGTCGGACACGATGAAGCAGAAG
ATCAGGGCGGAGTACGAGGGGCTTGGAGGCAGCCCGGAGAAGGCTCTGCAGTCTAACTACTTCCTCAACATTATGATCGTCATCGCAGGGCTGGCATTCTTGACATCTCTGCTCGGGAGC
TGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGACGGCCAA GATTAGACTC GTCTCCCACG CCCACGCAGC GCCTCTCGCT GGCCACCTCC AGTCCCCCGG CTAGTTCCCA GTTGTTCTCA GTCGCCCAAG CCGTGGACCA GCCATCAATC  CTCCTCTCCA AATATTCCAA ACCCCGCCCA CGCCGCGCCA TCGCCATGGC GGAGCGCCTC GCCTCCTCGG CCTCCCTCCT CCCGGCCTCG CCTTCCCCGT CCACCCGCCG CGCCGCGGCA  GCGGCCGTCG CCTCCTTCCC CTCCTGCTCC GGCTCCGCCC GCACCGGGCT CCGCCTCCGT CCGTCGCCCT CGCGCTTCTC GCAGAAGGCT GCGGGGAGAG GCCGCGGTGG CGCCGGCGGG  GGGCTGCGGG TGGTCCGGTG CATGGCGGCG TCGGACGCCG GGCAGCTCAA GAGCGCGCGG GAGGACATCA AGGAGATCCT CAAGACCAAT TACTGCCATC CCATCCTGAT CCGCTTGGGA  TGGCATGATT CTGGTACGTA CGACAAAAAT ATTGAGGAGT GGCCACTGAG AGGCGGAGCG GATGGTAGCT TAAGGTTTGA TCCTGAGCTG AGCCATGGAG CCAATGCTGG TCTGACTAGC  GCTTTAAAGC TTATTCAGCC AATCAAGGAT AAATACCCAG GTATCACTTA TGCAGATTTG TTCCAGTTGG CGAGTGCTAC TGCAGTTGAG GAAGCTGGTG GCCCGAAAAT TCCGATGAAA  TATGGACGGG CAGATATCAC ATCACCTGAG CAATGTCCAC CTGAAGGGAG GCTTCCTGAT GCTGGCCCAC GTATACCTGC TGAGCACCTT AGGGAGGTCT TCTATAGAAT GGGCCTTGAT  GACAAGGAAA TTGTTGCACT ATCCGGAGCA CATACACTTG GAAGATCAAG GCCTGACCGG AGTGGCTGGG GAAAGTCAGA AACAAAATAT ACAAAGGATG GGCCCGGTGA ACCTGGAGGT  CAGTCATGGA CAGCTGAATG GTTGAAGTTT GACAACAGTT ATTTCAAGGA CATAAAAGAG CAAAGGGATC AGGATCTTCT AGTATTGCCT ACAGATGCTG CATTATTTGA GGACCCATCA  TTCAAGGTAT ATGCAGAGAA GTACGCAGAA GACCAAGAGG CATTCTTCAA AGACTACGCT GAAGCCCATG CTAAACTCAG CAACCTTGGT GCAAAGTTTG ATCCTCCTGA GGGAATCTCG  TTGGACGATG ACAAGGGTGA CGCCCCGGTG GAGGAGAAGA AGGTTGCTGA TGCTGATCCA GCACCAGCAG ATGATAACAA TGGAGCAGCG TCGCAGCCAG AACCCTTCGT TGCCGCCAAA  TACTCCTACA AAAAGACGGA GCTGTCGGAC ACGATGAAGC AGAAGATCAG GGCGGAGTAC GAGGGGCTTG GAGGCAGCCC GGAGAAGGCT CTGCAGTCTA ACTACTTCCT CAACATTATG  ATCGTCATCG CAGGGCTGGC ATTCTTGACA TCTCTGCTCG GGAGCTGAGA GCGTTGGTCT TGACGGATCT GCCTTTTTTT TTGTTGGAAT ATACGGAGTG TCATTTGTCC AGAGATTGAC  CAGAGTACAG GATGAGCATG TGAACCAGCT GCATTGTTTT ATGTACCGCT ACATAAGCAA CACAAAACCA CATTTTCCTA TTGTAGCAGC CCCTGGTGTT CCTCACGTCT TGGTAACAAA 
AAGACAGATG TTGTTCTGTT TGTGCAGGCG TGTCTCGTCC GGTTCTTGTT ATACTTTTCG AAAATTTGAG TAATACTTGC GCATCA 

Retrieve as FASTA