Entry information : BdiPrx117 (Bradi4g05980)
Entry ID 7883
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2014-01-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx117 (Bradi4g05980)
Name (synonym) BdiPrx117 (Bradi4g05980)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx117
start..stop
S start..stop
SbPrx107 469 1e-167 10..339 19..343
ZmPrx72 469 2e-167 26..338 45..354
HvPrx51 465 2e-166 24..329 24..322
OsPrx138 450 4e-160 21..338 30..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4956545..4956955 411 N° 2 4957053..4957225 173 N° 3 4961479..4961906 428  
join(4956545..4956955,4957053..4957225,4961479..4961906)


exon

Literature and cross-references BdiPrx117 (Bradi4g05980)
DNA ref. Phytozome 12:   Bd4 (4956545..4961906)
Protein sequence: BdiPrx117 (Bradi4g05980)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (314)
PWM (Da):   %s   35170.09 (32551.6)  
PI (pH):   %s   8.16 (7.44) Peptide Signal:   %s   cut: 26 range:26-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSVRAPRRLALLAVLLSACALADAAVLKAHFYRHSCPAAEAVVRDIVLARVAADPANALPARLLRLFFHDCFVRGCDASVLLDSAAGDNAAAAEKDAAPNKSLGGFDVVDTAKAVLEAVCPGVVSCADVVALAARDAISFQFGRELWEVQLGRRDGVESRAAEALAEIPSPSANFTALEAGFASKGLDVKDLVILSGAHTIGVGHCNLFSSRLFSSSSTTGAGAAAPATDPALNAAYAAQLRAACGSPSNNATAVAMDPGSPARFDAHYYVNLKLGRGLFSSDAALLSDPRAAGMIHALTREDYFLREFKGAVRKMGRVGVLTGAQGEIRRNCRVVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, introns 2 and 3), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGATCAGTGAGAGCGCCGCGGCGGCTGGCATTACTGGCCGTCCTACTGTCGGCGTGCGCTCTGGCGGATGCGGCGGTGCTGAAGGCGCACTTCTACCGGCACAGCTGCCCGGCGGCG
GAGGCGGTGGTGCGGGACATCGTGCTGGCCCGCGTGGCGGCCGACCCCGCCAACGCGCTCCCGGCCAGGCTGCTCCGCCTCTTCTTCCACGACTGCTTCGTGAGGGGCTGCGACGCGTCG
GTGCTGCTGGACTCGGCGGCGGGCGACAACGCGGCGGCGGCGGAGAAGGACGCGGCGCCGAATAAGTCGCTGGGCGGGTTCGACGTGGTGGACACGGCCAAGGCGGTGCTGGAGGCCGTC
TGCCCCGGCGTCGTCTCCTGCGCCGACGTCGTCGCGCTCGCCGCCAGGGAC
GCCATATCCTTCCAGGTCTGAGTCTATCGTCAGTTCGTCACACATATGAATCAGCTAGCATCACCGTTA
ATCTGTCGAGTAATGCTCATAATTAACGAGCTTTGATTGATTGCAGTTTGGGCGGGAGCTGTGGGAGGTGCAGCTGGGGCGGCGGGACGGCGTGGAGTCGCGCGCGGCGGAGGCGCTGGC
GGAGATCCCGTCGCCGTCGGCCAACTTTACGGCGCTGGAGGCCGGGTTCGCCAGCAAGGGGCTCGACGTCAAGGACCTCGT
CATCCTCTCCGGTACGTTACGTGCGTGCGTTATCACGTC
AGAATTAATTTAATTTAGACGTACTTATGGACAAGCATGCGCGTAATTAATGACGGGTCACTGTCGTTTCACGTAACACTGGCACGTCGACCTGTTAAGTTCTCGTCTCGACAATCGAGA
CAGTACTGACTCTTGGAAAATTGCCCGTCTTAATTAAATCAAATGATGTGTTTCGTTAATTAGGAACTTAAATTAGGATCACGGTCGATCTAGAGTCACATCGTCTGATGGAGCTAGCTA
GTGAACGCAGTACAGTACGCTGAGTAGCGGCTACACCACCGGCACCGGGATGACGGCGACCGGGCGGCTGCCGGCCGGTGCGTGTCCACTGCATGCATGTGCACGTACGTGCACGTGCAT
GGCCGCCGGGATCGACGCTCGACGGACGGCCAGCATCGGTCGATCGGTCGTTCCGTCGGTTAGTTTGGCTGCGAGTGCATGCATATGCGGCATATGCACGGGCGTTCGCATATGGATGGA
TGGAAGCAAGGCAGCAAGCTATATATAGCGCTGTGTATCTACTATCTAGCGCTGGAAAAGGATGGAGCAACCACCGCGTAGCTAGGCGCGTGCGCCCATCGGTCGGCCGCTTGCAGTGCG
TGGTCGATCGAGCCCGCCGGCCATTCATAGCCGCTCGTTGCTGATCGGCTAGCTACGGCCGTTACGTGCTCCGTCGTATCATGTTATGTCCATGGATGCATTTTTCCTCACGTCAATAAT
ATTAGGATCATGGATGTATTTTTCCTCACGTCAGTTATGTCCAGCGGGCTCTTTGCCTGACGTGTACTCAGTCAACGTGCCACGTAGGCCGGTCAAACGCTCCTGCACGAGCGTAGGACT
TGTCGTGACACACTTCGCAAAAAATTGGGACTTAAATATGCAGTTTAGTAATTTTAGAACTAACTTGACACTTTATCAATAATATTAGGACCGAGGGTGTATTTAATCTAATTTTATAGT
TTTAGTCATGTCCAGCGGACCCTTTAGCTGACGTATATTTGGTCAGCATGCCACGTAGGCTGCTCAAACGTTCTTGGGCAAGCTTAGAACCTATCATGACACACTTTCAAAAAAAAAATA
GGACCTAAATATGTAGTTTAGTAATTTTAGGACTAACTTGATACCTCGTTAATAATAATAGGACCGCCGGTGTATTTTACTCGACGTTAAACTACTGCACAGTGTGACATCATAAGTTTG
GCACAAATATAGGGAAATGCATGTCAGCTTCCGTGATCGATCGACACGTACGTGCTCTACACAGAGAAATCTGGCCTCAAAATGATCATATCACACGTCAATAATTAACTAAAGCCAGTT
GACTACATTAAGAAGCATATTAGTTTAATTTGAGGCTTAGGAATCCAAACGAAACAATAACGACAATGGTTATAGTGGCATGAAATAAGTTAATTAGTTAGACCATCTCTTAGAGAGTTC
TCATCACATTCCCTATAGTCAAATTTAATGATTTTGCTTCAAAAAGGCACTCCAACAGATGCCCCATCCCATTCCCCACCTCAAGACGTCCCCAAATTGAGCTAGGGATTCCTCATATTG
AGAAGTGGGATGGGGCCCCATATCAATCTGAGGTGAGATAGAGAAAGAAAATGGTAGGAGGGAGAGCCAAATCAACCCTTAATTTGACTTTTCCGAATCTTGATGAGATATAGGGGATGA
GATATGAGGAAGAGGATTTTTGGAGGGTATCTTTTATAAGGAATTCTTAAATATAGGTTTTGGGAAAACAAATATGGGGAAGCTTTTGGAGATGCTCTTAGGGCTAGGGCTAAGTCAAAA
GACACTCGATCTAATAAGTTTCGCCCTTTCCACAAAAAGGCCATTGCTGATGAGTGGTAATCCCGTTCCCTGAATGCATGCATGTGCATGCATTGTGCCCTGCTCAATCAGGCGCGCAGC
AGAACCAAGTGGCTACTGTCTCGTCAAAAGATCGAATTATCACAGCTTGCTATCCCATCAACAAATTTAAGGAAGGAGATGCTTGCATGGTCCTGGTTTTAAATCACTTAGTGCAGCTGC
TGATACAGCTATTTCAGCTGTACTGTTAGCTAAGATAGTGCCTCTTAGTGTGGTGGTTACGGTAACCGCCAACCACCCCCACTCCTAACTAACGCCCTACGCATATCCAAGCAACTGTGC
TGCATCGAGTGGAAGAGATTGGATCCTGTTTGGTACATCTATCATTGGTTAAGTGATGTGGGCAATGTCCTAGATTTCTCTAGTGTCGTCTCAAGTGCCAAATGCCAATTTATGAGCTGT
TTGGCTGCCGTACATGCATGGACCGCCGCACCTGACCGGCATGGGCTAACTAACTAGCTAGATGCAGACTGGAAATAGCGGCTGAGTGAAGTGGACCAATGCCGAATGTTCGAGTTAATC
ATTATCGTTCTTTGGACTTGTTTGCTCTAGCTACCTGGCCACATTTTTATGCGCACCTGCACTGCATAGCTCAGAAGTGGGGTGATTGTGGGAGAGTAGCCTCATATATACTCGTAGCGC
TTGTTATGTATGGCATGATCCATCAAATGCATTCTTGGATTAGTTCCGGTTTAAGTATGCATTACATAGTTAAAAATGTTATGAAAACTAAAAACGTATATGTGATTATTATTATTTTTG
AAAATAACTGATTGCATTGTTCACATGCATACAAACCACATGACGCACGCACCCACACAACACATACAGAAGAAAAGAATGACCGGAGATGCCATACTAATGACGGACACGTCACCTCCC
ACTAAAAAGATAATCCGTCTCAAATGGAACACACATGACATCGAATCTATGATCGAGGATTCAGCCACAACTTTAATCATCAATTGTTGGTTCTCATGATATGTTTTCTAAATCAATCTG
GAACAGAATATATGGTCGTTTCTCTAGGACTGAAAAAGCAGTGGAAACTTTCAACCATTACAAAGAAAAAAGCTAGATGAGAATACAAATACCACACCAACAAAAATTGTGCAAATGAAA
AAGAACAATGATTTCTGAAGAAACAGCCATGAAAATACGAAAATGGAATTTTCCATTTCAGCAAATACATAAATATGTCTGCCCACACAAGCCTATACTTAGCCCAACTGAATAACCCAT
AGGCCAACCCAAGCTTGTCTTGCCTTCTGGATACCCACTGTGAACCTAAACTCTCATATGTTTTCCAAACCCCCGCCCTTCGTGCATGACCACTTAGCTCTCGTGGTCTCTATCGTCCTT
CACAACGCTAGTTGCCCGACACATCGTTGCATCCTCTCAAGTTTCTCGAGATTTGTGTTGAATCAAGAGATCCAATGGTGCAACAAGGTCTAACACTGGGTCCGGTTCTTTTAGAATTAT
TTCTCCACCAGGACCTCGCCTCTCCATAGACGACCCATTTCCGATCCCATGTTTGTACCACCTCCACTTAACCACGCCTCAGCCTAGCGTGCCGTTTAACTGGGGGTTTTGTGTTTTGAC
AAATATTTGCTTTTGTGTCTTTTACGTTCCACATTCACTCTATATTTAGTTTAATATATATTTTTTTATTTCCAGCTTTTGTGCTAAAAGATATGAAAACAAATACATAGCGCTATGTTT
CATCCATTTTTGCCACTAGTAGTTATCTCAAACTTGATTTGAAAAGTGTGGCATCATTTCGTACTTATGCAAGACTTGGTATAGTTTTGCGAAACTTTTTCCCAATTTCTAGAGAAAAGT
ACTTTTTTCGTCTCTCAACTTGTCGGAAAGTTTGCTTTTCGTCCCTCAAAAAATTTCGTACTTTTTTTGTCTCTCAATTTTCAAAACCGGACATTTTTAGTCTCTCGGTCCATCCAAAGT
GGTTTTCCTAACCACGTGTCTGGTTTTCGCATAGTTTTTTCACTTATTTTTTTTCAATCAAGATATGGATGATGCAGATGGAAGAGAAGTACAACCAGTGCCTAGACGAGATCCAGAGCA
CGACGGCGGCCAATTTCAACAGCCTCGGCGACCACGGGATTAAGTGCAAACCGGACACGTGGCTAGACAAACCGCTTCGTATAGCTTTAAGGACTAAAAGTGTCTGGTTTTGAAAGTTGA
GAGATGAAAAAAGTACTAATTGTTTTTAAGAGACGAGAAATGAATTTTCCGACGAGTCGAGGGACGAAAAAAATACTTCTCTCCAATTTGTCTGTTTCAAACTTACCATACACAAACACA
TAAACATTTCGCAGGCGCACACACCATCGGCGTGGGCCACTGCAACCTGTTCAGCAGCCGCCTCTTCAGCTCCTCCTCCACCACCGGCGCCGGCGCCGCCGCCCCGGCCACGGACCCGGC
CCTGAACGCCGCCTACGCCGCGCAGCTGCGGGCCGCGTGCGGGTCCCCGTCCAACAACGCGACGGCGGTGGCCATGGACCCCGGCAGCCCGGCCCGGTTCGACGCCCACTACTACGTGAA
CCTCAAGCTGGGCCGCGGCCTGTTCAGCTCCGACGCCGCGCTGCTGTCCGACCCCCGCGCCGCCGGCATGATCCACGCGCTCACCAGGGAGGACTACTTCCTCCGGGAGTTCAAGGGCGC
CGTCCGCAAGATGGGCCGCGTGGGCGTGCTCACCGGCGCCCAAGGGGAGATCAGGAGGAACTGCAGGGTCGTCAACTCGTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGATCAG TGAGAGCGCC GCGGCGGCTG GCATTACTGG CCGTCCTACT GTCGGCGTGC GCTCTGGCGG ATGCGGCGGT GCTGAAGGCG CACTTCTACC GGCACAGCTG CCCGGCGGCG  GAGGCGGTGG TGCGGGACAT CGTGCTGGCC CGCGTGGCGG CCGACCCCGC CAACGCGCTC CCGGCCAGGC TGCTCCGCCT CTTCTTCCAC GACTGCTTCG TGAGGGGCTG CGACGCGTCG  GTGCTGCTGG ACTCGGCGGC GGGCGACAAC GCGGCGGCGG CGGAGAAGGA CGCGGCGCCG AATAAGTCGC TGGGCGGGTT CGACGTGGTG GACACGGCCA AGGCGGTGCT GGAGGCCGTC  TGCCCCGGCG TCGTCTCCTG CGCCGACGTC GTCGCGCTCG CCGCCAGGGA CGCCATATCC TTCCAGTTTG GGCGGGAGCT GTGGGAGGTG CAGCTGGGGC GGCGGGACGG CGTGGAGTCG  CGCGCGGCGG AGGCGCTGGC GGAGATCCCG TCGCCGTCGG CCAACTTTAC GGCGCTGGAG GCCGGGTTCG CCAGCAAGGG GCTCGACGTC AAGGACCTCG TCATCCTCTC CGGCGCACAC  ACCATCGGCG TGGGCCACTG CAACCTGTTC AGCAGCCGCC TCTTCAGCTC CTCCTCCACC ACCGGCGCCG GCGCCGCCGC CCCGGCCACG GACCCGGCCC TGAACGCCGC CTACGCCGCG  CAGCTGCGGG CCGCGTGCGG GTCCCCGTCC AACAACGCGA CGGCGGTGGC CATGGACCCC GGCAGCCCGG CCCGGTTCGA CGCCCACTAC TACGTGAACC TCAAGCTGGG CCGCGGCCTG  TTCAGCTCCG ACGCCGCGCT GCTGTCCGAC CCCCGCGCCG CCGGCATGAT CCACGCGCTC ACCAGGGAGG ACTACTTCCT CCGGGAGTTC AAGGGCGCCG TCCGCAAGAT GGGCCGCGTG  GGCGTGCTCA CCGGCGCCCA AGGGGAGATC AGGAGGAACT GCAGGGTCGT CAACTCGTAG AGCCCGGTCC ATCCATCTGG AGGGGATCGG CTATGTATAT TCTGGTCATT TGGTGGTAAT  TAATTAATTA TTATATCGAG TTTGATTGTG TTTATTCAGG CGTGTTGTGG TGTGGACATG GATTGTGCAG AATAAGAAAT ATAAGCTGGC TAATTGGATT GATTCCAGCT GGGTTGTATA 
ATTTCGAGAT AAGTTGAACA TTGTGTTGTT CTGCCTAATG GTAGATAAGG GATTGTTGAT CTGGTACAAC A 

Retrieve as FASTA