Entry information : BdiPrx118 (Bradi4g22660)
Entry ID 7884
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx118 (Bradi4g22660)
Name (synonym) BdiPrx118 (Bradi4g22660)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx118
start..stop
S start..stop
SbPrx88 523 0 23..331 30..341
OsPrx133 521 0 24..331 27..334
OsPrx132 521 0 24..331 27..334
ZmPrx45 518 0 23..331 33..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 27100350..27100568 219 N° 2 27100088..27100273 186 N° 3 27099822..27099984 163 N° 4 27099218..27099645 428
complement(join(27099218..27099645,27099822..27099984,27100088..27100273,2710035 0..27100568))


exon

Literature and cross-references BdiPrx118 (Bradi4g22660)
DNA ref. Phytozome 12:   Bd4 (27100568..27099218)
Protein sequence: BdiPrx118 (Bradi4g22660)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (305)
PWM (Da):   %s   34542.49 (31999.1)  
PI (pH):   %s   6.13 (5.71) Peptide Signal:   %s   cut: 27 range:27-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSSRASTTMALLLLVLGAIVSVSQGQLQVGFYSSSCPGAESTVASAVRSASASDSTILPALLRLQFHDCFVRGCDASVLIKGGNNNAEVDNGKHQGLRGLDVIDSAKAQLESQCPGVVSCADIVVLAARDAVAFTGGPSFDVPTGRRDSKVSNLRDADVLPDVKDSAQVLRSKFAAAGLDHKDLVLLSAAHTVGTTACFFIQDRLYNTPLPGGGRGSDPSIPDAFLSELKSRCAPGDFNTRLALDRGSERVFDTSILRNIRNGYAVIASDAALYNDTATVDVVDSYSGLLSAVFGPYFRPDFADAMVKMGSIGVLTGSQGEVRKLCSKFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, intron 1, 2 and 3), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAGCAGCCGTGCAAGCACCACCATGGCCCTGCTCCTGCTAGTTCTAGGAGCAATCGTGAGCGTGTCCCAAGGGCAGCTCCAGGTGGGGTTCTACTCCAGCTCCTGCCCCGGCGCC
GAGTCCACGGTGGCCTCCGCCGTCCGGTCCGCCTCGGCCTCCGACTCCACCATCCTCCCCGCGCTCCTCCGCCTCCAGTTCCACGACTGCTTCGTCAGG
GTAACAATCTTCTTCACGATG
AGATGATCGTCTTTCTAAATTTCTCTAAACTTGGATCATGGTTTATTTTTGCTAGGGGTGTGACGCGTCGGTGCTGATCAAGGGAGGGAACAACAACGCGGAGGTGGACAACGGGAAGCA
CCAGGGGCTGCGTGGGCTGGACGTGATCGACAGCGCCAAGGCCCAGCTCGAGTCCCAGTGCCCCGGCGTCGTCTCCTGCGCCGACATCGTCGTCCTCGCCGCCCGTGACGCCGTCGCCTT
C
GTACGAACATACATATGCACATATATGCACTCTGTCTCTTCTTCTTCTTTTTCACCGGCCTGATCGATTTCATTAATATGTTGTTTGCAATGCCTGGTTGCAGACGGGCGGCCCGTCGT
TCGACGTGCCGACGGGCCGGCGCGACAGCAAGGTGTCGAACCTGCGCGACGCCGACGTGCTCCCAGACGTCAAGGACTCCGCCCAGGTCCTCCGCTCCAAGTTCGCCGCCGCCGGCCTCG
ACCACAAGGACCTCGTCCTCCTGAGCG
GTAAGCATCATTCGTGCATGCAACTCTCCATGCCGCAATAAAATTGGATGTGTGCATCATTTTCATGCAGAGTTCAGGATACTATCTTTTTTC
CAAAAAAAATATATGCAATTCTGTATCTTCCTTCCTGCTCATGTCCTAGCCTCACTGATCATGCGGCGAATGCATGCATGCAGCGGCGCACACGGTGGGCACGACGGCATGCTTCTTCAT
CCAGGACAGGCTCTACAACACCCCGCTCCCGGGCGGCGGGCGGGGCTCGGACCCATCCATCCCTGACGCCTTCCTCTCCGAGCTCAAGTCCCGGTGTGCGCCGGGGGACTTCAACACGCG
CTTGGCATTGGACCGGGGCAGCGAGAGGGTGTTCGACACGTCCATCCTCCGCAACATCCGCAATGGCTACGCCGTGATCGCCTCCGACGCGGCCCTCTACAACGACACGGCCACCGTCGA
CGTCGTCGACTCCTACTCGGGCCTCCTCAGCGCCGTCTTCGGCCCATATTTCCGGCCCGACTTCGCGGATGCCATGGTCAAGATGGGCAGCATCGGGGTGCTCACGGGGTCCCAGGGGGA
GGTCCGGAAGCTCTGCTCCAAGTTTAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAGCAGCCGTGCAAGCACCACCATGGCCCTGCTCCTGCTAGTTCTAGGAGCAATCGTGAGCGTGTCCCAAGGGCAGCTCCAGGTGGGGTTCTACTCCAGCTCCTGCCCCGGCGCC
GAGTCCACGGTGGCCTCCGCCGTCCGGTCCGCCTCGGCCTCCGACTCCACCATCCTCCCCGCGCTCCTCCGCCTCCAGTTCCACGACTGCTTCGTCAGG
GGGTGTGACGCGTCGGTGCTG
ATCAAGGGAGGGAACAACAACGCGGAGGTGGACAACGGGAAGCACCAGGGGCTGCGTGGGCTGGACGTGATCGACAGCGCCAAGGCCCAGCTCGAGTCCCAGTGCCCCGGCGTCGTCTCC
TGCGCCGACATCGTCGTCCTCGCCGCCCGTGACGCCGTCGCCTTC
ACGGGCGGCCCGTCGTTCGACGTGCCGACGGGCCGGCGCGACAGCAAGGTGTCGAACCTGCGCGACGCCGACGTG
CTCCCAGACGTCAAGGACTCCGCCCAGGTCCTCCGCTCCAAGTTCGCCGCCGCCGGCCTCGACCACAAGGACCTCGTCCTCCTGAGCG
CGGCGCACACGGTGGGCACGACGGCATGCTTC
TTCATCCAGGACAGGCTCTACAACACCCCGCTCCCGGGCGGCGGGCGGGGCTCGGACCCATCCATCCCTGACGCCTTCCTCTCCGAGCTCAAGTCCCGGTGTGCGCCGGGGGACTTCAAC
ACGCGCTTGGCATTGGACCGGGGCAGCGAGAGGGTGTTCGACACGTCCATCCTCCGCAACATCCGCAATGGCTACGCCGTGATCGCCTCCGACGCGGCCCTCTACAACGACACGGCCACC
GTCGACGTCGTCGACTCCTACTCGGGCCTCCTCAGCGCCGTCTTCGGCCCATATTTCCGGCCCGACTTCGCGGATGCCATGGTCAAGATGGGCAGCATCGGGGTGCTCACGGGGTCCCAG
GGGGAGGTCCGGAAGCTCTGCTCCAAGTTTAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCACCACCTC TCCTCGAGCC ACACCCACAC ACACTCCTCC TTCACTACAC GTTCTAGCTA GATCCCCTTT CCCAAGATGG GCAGCAGCCG TGCAAGCACC ACCATGGCCC TGCTCCTGCT  AGTTCTAGGA GCAATCGTGA GCGTGTCCCA AGGGCAGCTC CAGGTGGGGT TCTACTCCAG CTCCTGCCCC GGCGCCGAGT CCACGGTGGC CTCCGCCGTC CGGTCCGCCT CGGCCTCCGA  CTCCACCATC CTCCCCGCGC TCCTCCGCCT CCAGTTCCAC GACTGCTTCG TCAGGGGGTG TGACGCGTCG GTGCTGATCA AGGGAGGGAA CAACAACGCG GAGGTGGACA ACGGGAAGCA  CCAGGGGCTG CGTGGGCTGG ACGTGATCGA CAGCGCCAAG GCCCAGCTCG AGTCCCAGTG CCCCGGCGTC GTCTCCTGCG CCGACATCGT CGTCCTCGCC GCCCGTGACG CCGTCGCCTT  CACGGGCGGC CCGTCGTTCG ACGTGCCGAC GGGCCGGCGC GACAGCAAGG TGTCGAACCT GCGCGACGCC GACGTGCTCC CAGACGTCAA GGACTCCGCC CAGGTCCTCC GCTCCAAGTT  CGCCGCCGCC GGCCTCGACC ACAAGGACCT CGTCCTCCTG AGCGCGGCGC ACACGGTGGG CACGACGGCA TGCTTCTTCA TCCAGGACAG GCTCTACAAC ACCCCGCTCC CGGGCGGCGG  GCGGGGCTCG GACCCATCCA TCCCTGACGC CTTCCTCTCC GAGCTCAAGT CCCGGTGTGC GCCGGGGGAC TTCAACACGC GCTTGGCATT GGACCGGGGC AGCGAGAGGG TGTTCGACAC  GTCCATCCTC CGCAACATCC GCAATGGCTA CGCCGTGATC GCCTCCGACG CGGCCCTCTA CAACGACACG GCCACCGTCG ACGTCGTCGA CTCCTACTCG GGCCTCCTCA GCGCCGTCTT  CGGCCCATAT TTCCGGCCCG ACTTCGCGGA TGCCATGGTC AAGATGGGCA GCATCGGGGT GCTCACGGGG TCCCAGGGGG AGGTCCGGAA GCTCTGCTCC AAGTTTAACT GATGATACCC  AGATCGAACG GAAGATTATT CAGACTTCGG AGATCCGCGA AGAATTGTTC ATCCTTCATT GCGCTGCCGG ATTAATGGTT GGCTAGCTGG AGATAGATCG CTCCAAAAAG CAGACTCTAG  CTATATAGCT GGCCCGTGCA TATGCATCTC GTGCATGGTT TCATGGGCAT GCATTTCGTC CTTGGATTAT TTAATTGTGT ACATGTGGGA AGAAAAAGAA GAGAGATCGA GGGGGGAGAG  TTAGTGTATT CATGTGATTC ATGGGAAATG GTTTTAGGAT CTGTGCAGTT TCTCTTTTTT GCAGTGGTGA TATTCCAAAT CGAAGATACT AGTAGTATAT TTTTGTTTTT TTATGTTTAT  ATGTACACAC ACATTATGTG CACTTATGCG GACGTGTTAT TATTTTGTTC TTGGGCAATG GTTCCTTTAA TTTATTTAAC GTCCGAGTGC TGCAACTGTA AATTCAGGAA AGGTCAATAT 
GGTGTGACCA TTCGTTGTCG ATCTACCTTA TATAGTCTTT TTGTTAGATT GTGAA 

Retrieve as FASTA